Starting /dee2/code/volunteer_pipeline.sh SRR7865997 current disk space = 1523456720896 free memory = 1562741928 SRR7865997 SRAfilesize 07684f41ff1fd72cd941e20a19712e25 SRR7865997.sra SRR7865997.sra file validated SRR7865997 is single end SRR7865997 is conventional basespace SRR7865997 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6175 32.0 32.0 32.0 32.0 32.0 2 23.07875 32.0 2.0 32.0 2.0 32.0 3 33.97875 37.0 32.0 37.0 32.0 37.0 4 36.05125 37.0 37.0 37.0 32.0 37.0 5 36.4525 37.0 37.0 37.0 37.0 37.0 6 39.7605 41.0 41.0 41.0 37.0 41.0 7 39.66375 41.0 41.0 41.0 37.0 41.0 8 40.21575 41.0 41.0 41.0 37.0 41.0 9 39.93675 41.0 41.0 41.0 37.0 41.0 10 40.2705 41.0 41.0 41.0 41.0 41.0 11 40.50725 41.0 41.0 41.0 41.0 41.0 12 40.2855 41.0 41.0 41.0 41.0 41.0 13 40.08875 41.0 41.0 41.0 37.0 41.0 14 39.82375 41.0 41.0 41.0 37.0 41.0 15 39.99075 41.0 41.0 41.0 37.0 41.0 16 39.80875 41.0 41.0 41.0 37.0 41.0 17 39.98925 41.0 41.0 41.0 37.0 41.0 18 40.13125 41.0 41.0 41.0 37.0 41.0 19 40.06225 41.0 41.0 41.0 37.0 41.0 20 40.128 41.0 41.0 41.0 37.0 41.0 21 40.15675 41.0 41.0 41.0 37.0 41.0 22 40.094 41.0 41.0 41.0 37.0 41.0 23 39.95625 41.0 41.0 41.0 37.0 41.0 24 39.9375 41.0 41.0 41.0 37.0 41.0 25 39.8565 41.0 41.0 41.0 37.0 41.0 26 39.9065 41.0 41.0 41.0 37.0 41.0 27 40.186 41.0 41.0 41.0 41.0 41.0 28 39.78525 41.0 41.0 41.0 37.0 41.0 29 39.99125 41.0 41.0 41.0 37.0 41.0 30 40.02725 41.0 41.0 41.0 37.0 41.0 31 39.80525 41.0 41.0 41.0 37.0 41.0 32 40.12525 41.0 41.0 41.0 37.0 41.0 33 39.92525 41.0 41.0 41.0 37.0 41.0 34 39.91925 41.0 41.0 41.0 37.0 41.0 35 40.212 41.0 41.0 41.0 41.0 41.0 36 40.144 41.0 41.0 41.0 41.0 41.0 37 40.13425 41.0 41.0 41.0 41.0 41.0 38 40.018 41.0 41.0 41.0 37.0 41.0 39 40.1515 41.0 41.0 41.0 41.0 41.0 40 39.92075 41.0 41.0 41.0 37.0 41.0 41 39.754 41.0 41.0 41.0 37.0 41.0 42 40.034 41.0 41.0 41.0 37.0 41.0 43 40.01975 41.0 41.0 41.0 37.0 41.0 44 40.07875 41.0 41.0 41.0 41.0 41.0 45 40.1445 41.0 41.0 41.0 37.0 41.0 46 40.0535 41.0 41.0 41.0 37.0 41.0 47 39.752 41.0 41.0 41.0 37.0 41.0 48 39.72775 41.0 41.0 41.0 37.0 41.0 49 39.51225 41.0 41.0 41.0 37.0 41.0 50 39.978 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 3.0 27 1.0 28 4.0 29 15.0 30 22.0 31 31.0 32 38.0 33 55.0 34 71.0 35 96.0 36 104.0 37 156.0 38 230.0 39 1224.0 40 1947.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.8 15.65 7.1499999999999995 42.4 2 23.932820153953813 20.608817354793562 34.70958712386284 20.748775367389783 3 21.175 24.4 23.200000000000003 31.225 4 26.6 30.25 19.0 24.15 5 24.175 32.5 20.599999999999998 22.725 6 20.25 30.825000000000003 21.375 27.55 7 18.65 16.725 38.175 26.450000000000003 8 22.2 18.55 26.275 32.975 9 20.525 18.95 29.525000000000002 31.0 10 25.2 30.725 19.525000000000002 24.55 11 29.9 18.475 17.625 34.0 12 27.474999999999998 15.65 22.400000000000002 34.475 13 22.650000000000002 22.5 24.025 30.825000000000003 14 25.575 23.724999999999998 26.150000000000002 24.55 15 25.1 23.45 24.675 26.775 16 26.275 22.85 22.0 28.875 17 24.925 23.7 24.224999999999998 27.150000000000002 18 24.85 23.5 23.724999999999998 27.925 19 24.975 24.2 24.025 26.8 20 23.075000000000003 25.224999999999998 24.474999999999998 27.224999999999998 21 24.7 22.8 26.125 26.375 22 24.55 24.75 23.325000000000003 27.375 23 24.10602650662666 23.605901475368842 25.806451612903224 26.481620405101275 24 23.799999999999997 23.9 25.025 27.275 25 25.650000000000002 24.8 23.3 26.25 26 24.425 25.0 24.75 25.825 27 24.975 23.225 23.95 27.85 28 24.575 25.575 23.25 26.6 29 25.275 24.25 24.474999999999998 26.0 30 25.681420355088775 24.681170292573142 23.055763940985248 26.581645411352838 31 25.025 23.974999999999998 23.375 27.625 32 24.025 25.5 23.849999999999998 26.625 33 24.224999999999998 23.25 25.224999999999998 27.3 34 26.25 24.474999999999998 22.3 26.974999999999998 35 26.625 23.325000000000003 23.45 26.6 36 24.675 24.025 24.05 27.250000000000004 37 25.75 22.875 23.075000000000003 28.299999999999997 38 24.325 25.5 24.375 25.8 39 24.775 22.825 24.25 28.15 40 26.281570392598148 23.23080770192548 23.63090772693173 26.85671417854464 41 25.312656328164078 23.111555777888945 24.712356178089045 26.863431715857928 42 25.581395348837212 23.330832708177045 24.131032758189548 26.9567391847962 43 25.481370342585645 24.20605151287822 23.23080770192548 27.081770442610654 44 25.2 24.725 24.05 26.025 45 24.85 23.025000000000002 25.1 27.025 46 25.55 22.925 22.900000000000002 28.625 47 24.8 23.849999999999998 24.85 26.5 48 24.25 23.775 24.224999999999998 27.750000000000004 49 24.925 24.15 22.475 28.449999999999996 50 25.724999999999998 23.875 24.7 25.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.0 24 2.0 25 2.5 26 3.0 27 6.0 28 9.0 29 17.5 30 26.0 31 38.5 32 51.0 33 53.0 34 55.0 35 82.5 36 110.0 37 125.5 38 141.0 39 176.5 40 212.0 41 221.5 42 231.0 43 256.0 44 281.0 45 283.0 46 285.0 47 307.0 48 329.0 49 320.0 50 311.0 51 284.5 52 258.0 53 253.0 54 248.0 55 225.5 56 203.0 57 202.5 58 202.0 59 175.0 60 148.0 61 152.0 62 156.0 63 139.5 64 123.0 65 121.0 66 119.0 67 115.5 68 112.0 69 106.5 70 101.0 71 95.0 72 89.0 73 76.0 74 63.0 75 60.5 76 58.0 77 47.5 78 37.0 79 26.0 80 15.0 81 13.0 82 11.0 83 7.0 84 3.0 85 2.5 86 2.0 87 1.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 28.549999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.025 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.05 42 0.025 43 0.025 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 97.88103140158285 95.85000000000001 2 2.118968598417156 4.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766637 READS because READLEN < 1 Read 6766637 spots for SRR7865997.sra Written 6766637 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra Rejected 6766632 READS because READLEN < 1 Read 6766632 spots for SRR7865997.sra Written 6766632 spots for SRR7865997.sra SRR ids: ['SRR7865997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_npvd7g6s SRR7865997.sra spots: 135332645 blocks: [[1, 6766632], [6766633, 13533264], [13533265, 20299896], [20299897, 27066528], [27066529, 33833160], [33833161, 40599792], [40599793, 47366424], [47366425, 54133056], [54133057, 60899688], [60899689, 67666320], [67666321, 74432952], [74432953, 81199584], [81199585, 87966216], [87966217, 94732848], [94732849, 101499480], [101499481, 108266112], [108266113, 115032744], [115032745, 121799376], [121799377, 128566008], [128566009, 135332645]] SRR7865997 file size 19078461 SRR7865997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865997 SRR7865997_1.fastq Input file: SRR7865997_1.fastq trimmed: SRR7865997-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:32:07 2024 >> started Tue Dec 10 01:33:35 2024 >> done (88.042s) 135332645 reads processed; of these: 9807 ( 0.01%) short reads filtered out after trimming by size control 14934 ( 0.01%) empty reads filtered out after trimming by size control 135307904 (99.98%) reads available; of these: 357 ( 0.00%) trimmed reads available after processing 135307547 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 343 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 14 0.00% 50 135307547 100.00% 135307904 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=9.16 fanout-score-rank=13 prefix-density=0.19 prefix-fanout=5.0 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=7 fanout-score=163.50 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=20.5 sequence=GCGGCGGCGGCG Started job on | Dec 10 01:33:52 Started mapping on | Dec 10 01:33:53 Finished on | Dec 10 01:35:23 Mapping speed, Million of reads per hour | 5412.32 Number of input reads | 135307904 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 126729111 Uniquely mapped reads % | 93.66% Average mapped length | 49.93 Number of splices: Total | 19876319 Number of splices: Annotated (sjdb) | 19258563 Number of splices: GT/AG | 19613225 Number of splices: GC/AG | 235372 Number of splices: AT/AC | 10961 Number of splices: Non-canonical | 16761 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4987688 % of reads mapped to multiple loci | 3.69% Number of reads mapped to too many loci | 2651009 % of reads mapped to too many loci | 1.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3591105 3591105 3591105 N_multimapping 4987688 4987688 4987688 N_noFeature 3904962 124461999 4683341 N_ambiguous 1608143 11065 117451 UnstrandedReadsAssigned:121216006 PositiveStrandReadsAssigned:2256047 NegativeStrandReadsAssigned:121928319 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR7865997 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865997-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 135,307,904 reads, 122,282,759 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52973 SRR7865997.ke.tsv 35125 SRR7865997.se.tsv 88098 total ==> SRR7865997.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 900.709 14.2008 PNS24247 1044 945 102.35 1.42925 PNS24249 1928 1829 1220.12 8.80324 PNS24246 1044 945 102.35 1.42925 PNS24248 1044 945 102.35 1.42925 PNS24244 1471 1372 149.125 1.43434 PNS24243 293 194 0 0 KQK14069 1603 1504 156.212 1.37063 KQK14071 474 375 61.1623 2.15232 ==> SRR7865997.se.tsv <== BRADI_1g14170v3 246 BRADI_1g53295v3 34 BRADI_1g59795v3 1799 BRADI_1g07683v3 0 BRADI_1g00485v3 486 BRADI_1g20270v3 41114 BRADI_1g74790v3 217 BRADI_1g09890v3 11 BRADI_1g77505v3 1763 BRADI_1g48960v3 4 SRR7865997 completed mapping pipeline successfully