Starting /dee2/code/volunteer_pipeline.sh SRR8096889 current disk space = 1543085084672 free memory = 1602721020 SRR8096889 SRAfilesize a11a16aafd85a87d9fa737a20a69eee3 SRR8096889.sra SRR8096889.sra file validated SRR8096889 is paired end SRR8096889 is conventional basespace SRR8096889 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34875 34.0 33.0 34.0 32.0 34.0 2 33.0915 34.0 33.0 34.0 32.0 34.0 3 33.112 34.0 33.0 34.0 32.0 34.0 4 33.21775 34.0 33.0 34.0 32.0 34.0 5 33.3025 34.0 33.0 34.0 33.0 34.0 6 36.8725 38.0 37.0 38.0 35.0 38.0 7 37.26225 38.0 38.0 38.0 36.0 38.0 8 37.32825 38.0 38.0 38.0 37.0 38.0 9 37.32275 38.0 38.0 38.0 37.0 38.0 10-14 37.4289 38.0 38.0 38.0 37.0 38.0 15-19 37.47455 38.0 38.0 38.0 37.0 38.0 20-24 37.3948 38.0 38.0 38.0 37.0 38.0 25-29 37.3799 38.0 38.0 38.0 37.0 38.0 30-34 37.344049999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.30005 38.0 38.0 38.0 37.0 38.0 40-44 37.185449999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.199 38.0 38.0 38.0 37.0 38.0 50-54 37.14555 38.0 38.0 38.0 36.6 38.0 55-59 37.07325 38.0 38.0 38.0 36.2 38.0 60-64 37.08579999999999 38.0 38.0 38.0 36.2 38.0 65-69 36.880399999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.7116 38.0 38.0 38.0 35.2 38.0 75-79 36.39875 38.0 38.0 38.0 35.0 38.0 80-84 36.21265 38.0 38.0 38.0 34.2 38.0 85-89 35.448949999999996 38.0 37.4 38.0 30.0 38.0 90-94 36.0296 38.0 37.8 38.0 33.8 38.0 95-99 36.10125000000001 38.0 38.0 38.0 34.0 38.0 100-104 35.9902 38.0 38.0 38.0 33.8 38.0 105-109 35.791399999999996 38.0 38.0 38.0 33.0 38.0 110-114 35.6163 38.0 38.0 38.0 32.8 38.0 115-119 35.27045 38.0 37.0 38.0 30.6 38.0 120-124 35.3396 38.0 37.4 38.0 31.0 38.0 125-129 35.153549999999996 38.0 36.8 38.0 30.6 38.0 130-134 34.522949999999994 38.0 35.8 38.0 26.2 38.0 135-139 34.43095 38.0 35.8 38.0 26.2 38.0 140-144 33.9764 38.0 35.6 38.0 23.8 38.0 145-149 32.8387 38.0 33.6 38.0 13.4 38.0 150 23.0315 29.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 0.0 9 2.0 10 1.0 11 1.0 12 2.0 13 1.0 14 1.0 15 2.0 16 5.0 17 7.0 18 23.0 19 35.0 20 3.0 21 8.0 22 10.0 23 9.0 24 10.0 25 12.0 26 24.0 27 22.0 28 33.0 29 30.0 30 50.0 31 43.0 32 71.0 33 101.0 34 138.0 35 229.0 36 545.0 37 2579.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.886480908152734 12.461300309597522 7.533539731682147 40.11867905056759 2 21.975 19.1 35.85 23.075000000000003 3 22.650000000000002 21.425 26.674999999999997 29.25 4 27.975 27.375 19.925 24.725 5 27.800000000000004 30.875000000000004 22.650000000000002 18.675 6 22.2 32.574999999999996 22.7 22.525000000000002 7 18.3 22.650000000000002 38.824999999999996 20.225 8 19.8 23.474999999999998 29.975 26.75 9 22.325 19.325 32.2 26.150000000000002 10-14 22.68 27.169999999999998 24.635 25.515 15-19 23.32 25.05 25.990000000000002 25.64 20-24 23.064999999999998 25.895000000000003 26.534999999999997 24.505 25-29 22.405 25.569999999999997 26.14 25.885 30-34 23.315 25.665 25.45 25.569999999999997 35-39 22.63 25.405 25.985000000000003 25.979999999999997 40-44 22.650000000000002 25.745 26.375 25.230000000000004 45-49 23.865 25.435000000000002 25.97 24.73 50-54 23.23 24.64 25.61 26.52 55-59 22.830000000000002 24.585 27.065 25.52 60-64 23.69 25.455 25.779999999999998 25.074999999999996 65-69 22.615 27.134999999999998 24.95 25.3 70-74 23.064999999999998 26.590000000000003 25.105 25.240000000000002 75-79 23.155 26.185000000000002 24.935 25.724999999999998 80-84 22.955000000000002 26.13 25.430000000000003 25.485000000000003 85-89 23.919999999999998 25.740000000000002 25.025 25.314999999999998 90-94 23.855 25.695 25.130000000000003 25.319999999999997 95-99 22.875 25.495 25.665 25.965 100-104 23.305 25.919999999999998 25.4 25.374999999999996 105-109 23.46 25.71 25.21 25.619999999999997 110-114 23.04 26.31 25.535000000000004 25.115 115-119 23.419999999999998 25.924999999999997 25.064999999999998 25.590000000000003 120-124 22.735 26.14 25.124999999999996 26.0 125-129 23.61 25.71 25.230000000000004 25.45 130-134 23.1 26.419999999999998 24.945 25.535000000000004 135-139 23.369999999999997 26.55 24.07 26.009999999999998 140-144 23.9 25.835 24.92 25.345000000000002 145-149 23.29 26.095000000000002 24.709999999999997 25.905 150 24.0 24.6 25.275 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.0 2 1.0 3 0.5 4 0.5 5 1.0 6 1.0 7 1.0 8 1.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.0 27 3.0 28 3.5 29 4.5 30 6.5 31 10.0 32 23.5 33 33.0 34 24.5 35 33.0 36 46.5 37 62.5 38 83.0 39 103.0 40 128.0 41 166.5 42 182.0 43 170.5 44 194.0 45 207.5 46 204.5 47 196.5 48 183.0 49 172.0 50 161.0 51 143.5 52 131.0 53 117.5 54 109.0 55 100.0 56 91.5 57 101.5 58 96.0 59 84.5 60 75.5 61 71.5 62 73.0 63 63.0 64 52.0 65 55.0 66 50.5 67 40.5 68 29.5 69 19.0 70 19.0 71 18.0 72 14.0 73 10.5 74 5.0 75 3.5 76 3.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.99406757802424 95.95 2 0.8769667268506577 1.7000000000000002 3 0.025793139025019347 0.075 4 0.051586278050038695 0.2 5 0.0 0.0 6 0.025793139025019347 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025793139025019347 1.925 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 77 1.925 TruSeq Adapter, Index 11 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.0625 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.3375 0.0 0.0 0.0 0.0 132-133 4.7 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138 6.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGATC 10 0.0069772652 143.975 8 TGCTTCT 10 0.0069772652 143.975 8 GCTTCTG 10 0.0069772652 143.975 9 >>END_MODULE SRR8096889 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096889_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 36 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 12.29775 2.0 2.0 18.0 2.0 31.0 2 12.48025 2.0 2.0 18.0 2.0 32.0 3 12.466 2.0 2.0 18.0 2.0 31.0 4 11.80625 2.0 2.0 15.0 2.0 32.0 5 11.36875 2.0 2.0 15.0 2.0 29.0 6 12.3115 2.0 2.0 16.0 2.0 34.0 7 12.1035 2.0 2.0 16.0 2.0 34.0 8 11.9165 2.0 2.0 16.0 2.0 34.0 9 11.8835 2.0 2.0 16.0 2.0 34.0 10-14 11.4505 2.0 2.0 16.0 2.0 34.0 15-19 10.78535 2.0 2.0 16.0 2.0 33.8 20-24 10.143849999999999 2.0 2.0 16.0 2.0 33.6 25-29 9.505600000000001 2.0 2.0 16.0 2.0 32.2 30-34 9.087599999999998 2.0 2.0 16.0 2.0 29.8 35-39 8.8002 2.0 2.0 16.0 2.0 29.6 40-44 8.479000000000001 2.0 2.0 15.2 2.0 29.4 45-49 8.20435 2.0 2.0 14.4 2.0 28.8 50-54 7.9506 2.0 2.0 11.6 2.0 28.6 55-59 7.7032 2.0 2.0 2.0 2.0 28.0 60-64 7.5386 2.0 2.0 2.0 2.0 28.0 65-69 7.34965 2.0 2.0 2.0 2.0 28.0 70-74 7.08075 2.0 2.0 2.0 2.0 27.8 75-79 6.8476 2.0 2.0 2.0 2.0 27.0 80-84 6.50745 2.0 2.0 2.0 2.0 25.8 85-89 6.205749999999999 2.0 2.0 2.0 2.0 24.0 90-94 5.98155 2.0 2.0 2.0 2.0 23.0 95-99 5.7658000000000005 2.0 2.0 2.0 2.0 19.4 100-104 5.45775 2.0 2.0 2.0 2.0 15.0 105-109 5.179450000000001 2.0 2.0 2.0 2.0 15.0 110-114 4.866899999999999 2.0 2.0 2.0 2.0 15.0 115-119 4.595549999999999 2.0 2.0 2.0 2.0 14.2 120-124 4.3346 2.0 2.0 2.0 2.0 6.4 125-129 4.037400000000001 2.0 2.0 2.0 2.0 2.0 130-134 3.8140500000000004 2.0 2.0 2.0 2.0 2.0 135-139 3.52005 2.0 2.0 2.0 2.0 2.0 140-144 3.27615 2.0 2.0 2.0 2.0 2.0 145-149 2.9880000000000004 2.0 2.0 2.0 2.0 2.0 150 2.60375 2.0 2.0 2.0 2.0 2.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 2 2170.0 3 278.0 4 197.0 5 137.0 6 89.0 7 98.0 8 57.0 9 49.0 10 48.0 11 64.0 12 55.0 13 52.0 14 64.0 15 61.0 16 42.0 17 53.0 18 50.0 19 31.0 20 47.0 21 27.0 22 36.0 23 35.0 24 26.0 25 20.0 26 21.0 27 26.0 28 17.0 29 19.0 30 25.0 31 12.0 32 21.0 33 18.0 34 23.0 35 15.0 36 15.0 37 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.675050301810863 35.11066398390342 22.183098591549296 26.03118712273642 2 15.630505914925749 40.75006292474201 19.50667002265291 24.112761137679335 3 14.925748804429903 42.53712559778505 17.367228794361942 25.169896803423107 4 17.291719103951674 41.404480241631006 18.37402466649887 22.92977598791845 5 16.666666666666664 39.803625377643506 20.39274924471299 23.136958710976838 6 14.828801611278951 44.03323262839879 17.270896273917423 23.867069486404834 7 14.652567975830816 42.74924471299094 18.12688821752266 24.47129909365559 8 16.440080563947635 41.591137965760325 17.245720040281974 24.72306143001007 9 15.181268882175228 44.36052366565962 15.15609264853978 25.302114803625376 10-14 14.953929812194753 44.72584462010976 16.837017270026685 23.4832082976688 15-19 12.84994964753273 46.067472306143 16.90332326283988 24.179254783484392 20-24 13.600201409869083 45.97683786505539 15.664652567975832 24.758308157099698 25-29 14.453282319774466 44.90032219089811 16.19512686266613 24.451268626661296 30-34 13.435690913667253 46.65995469418575 15.041530329725648 24.862824062421343 35-39 13.692423861062169 47.90838157563554 14.090108230556256 24.309086332746034 40-44 14.170651900327208 47.772464132897056 13.717593757865593 24.339290208910143 45-49 13.22492952074104 48.7968183648812 13.713250100684657 24.265002013693113 50-54 13.20678717083732 48.54740446100398 13.685111525099442 24.56069684305926 55-59 13.241365421407714 48.82690564897795 13.820360487362803 24.111368442251536 60-64 12.698892245720039 48.096676737160124 14.214501510574017 24.98992950654582 65-69 12.784491440080565 48.7865055387714 13.353474320241693 25.075528700906347 70-74 11.923464249748237 50.51359516616314 12.925478348439073 24.637462235649547 75-79 12.41691842900302 51.02719033232629 12.326283987915408 24.229607250755286 80-84 11.319234642497483 51.81772406847935 12.190332326283988 24.672708962739172 85-89 10.579053373615308 52.65357502517624 11.832829808660625 24.934541792547833 90-94 11.228600201409868 52.27593152064451 11.812688821752266 24.682779456193355 95-99 11.545820745216515 51.72205438066465 12.109768378650553 24.622356495468278 100-104 11.566544136159926 53.34608993403494 10.670225086862379 24.417140842942747 105-109 10.881168177240685 54.06847935548842 10.68479355488419 24.365558912386707 110-114 10.906344410876132 53.272910372608266 10.886203423967775 24.934541792547833 115-119 10.28700906344411 53.82175226586102 11.178247734138973 24.712990936555894 120-124 9.692849949647533 56.253776435045324 10.090634441087614 23.962739174219536 125-129 10.1460221550856 55.140986908358514 10.090634441087614 24.622356495468278 130-134 10.14047631035698 55.57121997885302 9.767886813352803 24.52041689743719 135-139 9.491440080563947 55.76032225579053 10.080563947633433 24.667673716012082 140-144 10.069986405518353 55.95387946226273 9.083127737777554 24.893006394441368 145-149 9.222933790529979 57.294135444506075 9.354041651959054 24.12888911300489 150 5.41289023162135 71.82779456193353 5.4884189325276935 17.270896273917423 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 37.0 1 23.5 2 7.5 3 5.5 4 3.0 5 3.0 6 5.0 7 5.5 8 8.5 9 8.0 10 10.0 11 12.5 12 15.0 13 21.0 14 25.5 15 25.0 16 25.0 17 35.0 18 45.0 19 47.5 20 49.0 21 50.0 22 58.5 23 69.5 24 74.0 25 85.5 26 93.0 27 85.5 28 82.0 29 86.0 30 96.0 31 101.5 32 95.0 33 110.0 34 119.0 35 109.0 36 110.5 37 115.0 38 119.5 39 120.5 40 124.0 41 116.5 42 102.5 43 103.0 44 119.0 45 117.5 46 95.5 47 93.0 48 89.0 49 83.0 50 79.5 51 69.0 52 67.0 53 62.5 54 54.0 55 48.0 56 41.0 57 42.0 58 40.5 59 40.0 60 36.0 61 27.0 62 30.5 63 26.5 64 16.0 65 16.0 66 14.5 67 11.0 68 12.0 69 10.0 70 6.5 71 4.5 72 3.5 73 4.0 74 3.0 75 3.0 76 3.0 77 1.0 78 1.5 79 2.0 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.675 3 0.675 4 0.675 5 0.7000000000000001 6 0.7000000000000001 7 0.7000000000000001 8 0.7000000000000001 9 0.7000000000000001 10-14 0.695 15-19 0.7000000000000001 20-24 0.7000000000000001 25-29 0.6799999999999999 30-34 0.675 35-39 0.675 40-44 0.675 45-49 0.6799999999999999 50-54 0.695 55-59 0.69 60-64 0.7000000000000001 65-69 0.7000000000000001 70-74 0.7000000000000001 75-79 0.7000000000000001 80-84 0.7000000000000001 85-89 0.7000000000000001 90-94 0.7000000000000001 95-99 0.7000000000000001 100-104 0.705 105-109 0.7000000000000001 110-114 0.7000000000000001 115-119 0.7000000000000001 120-124 0.7000000000000001 125-129 0.7000000000000001 130-134 0.695 135-139 0.7000000000000001 140-144 0.695 145-149 0.845 150 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84836997725549 98.775 2 0.10108668182966893 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050543340914834464 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 17 0.42500000000000004 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.075 0.0 0.0 0.0 0.0 122-123 0.075 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.1375 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.175 0.0 0.0 0.0 0.0 134-135 0.2 0.0 0.0 0.0 0.0 136-137 0.2 0.0 0.0 0.0 0.0 138 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147022 spots for SRR8096889.sra Written 2147022 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra Read 2147020 spots for SRR8096889.sra Written 2147020 spots for SRR8096889.sra SRR ids: ['SRR8096889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_np3q_d_5 SRR8096889.sra spots: 42940402 blocks: [[1, 2147020], [2147021, 4294040], [4294041, 6441060], [6441061, 8588080], [8588081, 10735100], [10735101, 12882120], [12882121, 15029140], [15029141, 17176160], [17176161, 19323180], [19323181, 21470200], [21470201, 23617220], [23617221, 25764240], [25764241, 27911260], [27911261, 30058280], [30058281, 32205300], [32205301, 34352320], [34352321, 36499340], [36499341, 38646360], [38646361, 40793380], [40793381, 42940402]] SRR8096889 file size 14445524 SRR8096889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096889 SRR8096889_1.fastq SRR8096889_2.fastq Input file: SRR8096889_1.fastq Paired file: SRR8096889_2.fastq trimmed: SRR8096889-trimmed-pair1.fastq, SRR8096889-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:28:21 2024 >> started Sat Dec 7 14:29:15 2024 >> done (53.925s) 42940402 read pairs processed; of these: 1154620 ( 2.69%) short read pairs filtered out after trimming by size control 4022041 ( 9.37%) empty read pairs filtered out after trimming by size control 37763741 (87.94%) read pairs available; of these: 25042042 (66.31%) trimmed read pairs available after processing 12721699 (33.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 48 0.00% 19 50 0.00% 20 55 0.00% 21 88 0.00% 22 97 0.00% 23 108 0.00% 24 122 0.00% 25 130 0.00% 26 107 0.00% 27 141 0.00% 28 133 0.00% 29 129 0.00% 30 122 0.00% 31 128 0.00% 32 150 0.00% 33 172 0.00% 34 183 0.00% 35 273 0.00% 36 237 0.00% 37 257 0.00% 38 264 0.00% 39 287 0.00% 40 455 0.00% 41 438 0.00% 42 431 0.00% 43 455 0.00% 44 565 0.00% 45 673 0.00% 46 762 0.00% 47 726 0.00% 48 890 0.00% 49 998 0.00% 50 1032 0.00% 51 1100 0.00% 52 1195 0.00% 53 1357 0.00% 54 1319 0.00% 55 1609 0.00% 56 1712 0.00% 57 1814 0.00% 58 2015 0.01% 59 2397 0.01% 60 2703 0.01% 61 3709 0.01% 62 2832 0.01% 63 2476 0.01% 64 2657 0.01% 65 2934 0.01% 66 3161 0.01% 67 3605 0.01% 68 4397 0.01% 69 5946 0.02% 70 5692 0.02% 71 5466 0.01% 72 5851 0.02% 73 6430 0.02% 74 6657 0.02% 75 7440 0.02% 76 8218 0.02% 77 9103 0.02% 78 10110 0.03% 79 11521 0.03% 80 13288 0.04% 81 15960 0.04% 82 19922 0.05% 83 36163 0.10% 84 121691 0.32% 85 113400 0.30% 86 106967 0.28% 87 99268 0.26% 88 94817 0.25% 89 92290 0.24% 90 90970 0.24% 91 89311 0.24% 92 88465 0.23% 93 89794 0.24% 94 91507 0.24% 95 93273 0.25% 96 95456 0.25% 97 98677 0.26% 98 100246 0.27% 99 100355 0.27% 100 101222 0.27% 101 103665 0.27% 102 106801 0.28% 103 111372 0.29% 104 114575 0.30% 105 118168 0.31% 106 120369 0.32% 107 125422 0.33% 108 130065 0.34% 109 132035 0.35% 110 134766 0.36% 111 139112 0.37% 112 143503 0.38% 113 147207 0.39% 114 151901 0.40% 115 159255 0.42% 116 165579 0.44% 117 171328 0.45% 118 177949 0.47% 119 183625 0.49% 120 190553 0.50% 121 199566 0.53% 122 205804 0.54% 123 214478 0.57% 124 220060 0.58% 125 228141 0.60% 126 234838 0.62% 127 246055 0.65% 128 257648 0.68% 129 264472 0.70% 130 274002 0.73% 131 283787 0.75% 132 294740 0.78% 133 306818 0.81% 134 321368 0.85% 135 332803 0.88% 136 352274 0.93% 137 375467 0.99% 138 387153 1.03% 139 410504 1.09% 140 438345 1.16% 141 463302 1.23% 142 507276 1.34% 143 549967 1.46% 144 623528 1.65% 145 724892 1.92% 146 903552 2.39% 147 1207034 3.20% 148 2092319 5.54% 149 7405425 19.61% 150 12721699 33.69% 37763741 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=44.12 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=39.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=1.08 sequence-density-rank=1 fanout-score=44.12 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=39.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=2.9 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=28.53 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR8096889 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:30:04 Started mapping on | Dec 07 14:30:04 Finished on | Dec 07 14:33:44 Mapping speed, Million of reads per hour | 617.95 Number of input reads | 37763741 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 36118551 Uniquely mapped reads % | 95.64% Average mapped length | 279.61 Number of splices: Total | 36604687 Number of splices: Annotated (sjdb) | 34580332 Number of splices: GT/AG | 36122852 Number of splices: GC/AG | 420391 Number of splices: AT/AC | 11606 Number of splices: Non-canonical | 49838 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.01% Deletion average length | 1.88 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 600296 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 14275 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1921736 1921736 1921736 N_multimapping 600296 600296 600296 N_noFeature 1369355 35041880 1642004 N_ambiguous 972941 5070 172713 UnstrandedReadsAssigned:33776255 PositiveStrandReadsAssigned:1071601 NegativeStrandReadsAssigned:34303834 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096889 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096889-trimmed-pair1.fastq SRR8096889-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,763,741 reads, 34,929,940 reads pseudoaligned [quant] estimated average fragment length: 310.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR8096889.ke.tsv 35125 SRR8096889.se.tsv 88098 total ==> SRR8096889.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.118 0 0 PNS24247 1044 734.371 111.691 5.94162 PNS24249 1928 1618.37 44.7442 1.08009 PNS24246 1044 734.371 111.691 5.94162 PNS24248 1044 734.371 111.691 5.94162 PNS24244 1471 1161.37 188.183 6.33011 PNS24243 293 75.804 0 0 KQK14069 1603 1293.37 6903.88 208.532 KQK14071 474 196.911 200.696 39.8172 ==> SRR8096889.se.tsv <== BRADI_1g14170v3 8619 BRADI_1g53295v3 43 BRADI_1g59795v3 1318 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 414 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 465 BRADI_1g48960v3 0 SRR8096889 completed mapping pipeline successfully