Starting /dee2/code/volunteer_pipeline.sh SRR8096893 current disk space = 1542763278336 free memory = 1600785364 SRR8096893 SRAfilesize 2242ace56071a51a547e099b04658be3 SRR8096893.sra SRR8096893.sra file validated SRR8096893 is paired end SRR8096893 is conventional basespace SRR8096893 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.82875 34.0 33.0 34.0 32.0 34.0 2 33.09175 34.0 33.0 34.0 32.0 34.0 3 33.23225 34.0 33.0 34.0 32.0 34.0 4 33.31075 34.0 33.0 34.0 33.0 34.0 5 33.27125 34.0 33.0 34.0 33.0 34.0 6 37.0355 38.0 37.0 38.0 36.0 38.0 7 37.2915 38.0 38.0 38.0 37.0 38.0 8 37.39575 38.0 38.0 38.0 37.0 38.0 9 37.3575 38.0 38.0 38.0 37.0 38.0 10-14 37.384249999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.44714999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.47085 38.0 38.0 38.0 37.8 38.0 25-29 37.43025 38.0 38.0 38.0 37.4 38.0 30-34 37.37929999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.32325000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.13099999999999 38.0 38.0 38.0 36.6 38.0 45-49 37.16875 38.0 38.0 38.0 36.8 38.0 50-54 37.10680000000001 38.0 38.0 38.0 36.4 38.0 55-59 36.94785 38.0 38.0 38.0 35.6 38.0 60-64 36.91935 38.0 38.0 38.0 36.0 38.0 65-69 36.677600000000005 38.0 38.0 38.0 35.6 38.0 70-74 36.577200000000005 38.0 38.0 38.0 35.0 38.0 75-79 36.017 38.0 38.0 38.0 34.4 38.0 80-84 35.9833 38.0 38.0 38.0 34.0 38.0 85-89 36.00705 38.0 38.0 38.0 34.2 38.0 90-94 35.8401 38.0 38.0 38.0 33.4 38.0 95-99 35.72709999999999 38.0 38.0 38.0 33.6 38.0 100-104 35.6103 38.0 38.0 38.0 33.2 38.0 105-109 35.3952 38.0 38.0 38.0 32.2 38.0 110-114 35.362 38.0 38.0 38.0 31.8 38.0 115-119 35.08815 38.0 37.6 38.0 29.8 38.0 120-124 34.835499999999996 38.0 36.6 38.0 28.6 38.0 125-129 34.678250000000006 38.0 36.2 38.0 28.2 38.0 130-134 34.34895 38.0 35.8 38.0 24.8 38.0 135-139 31.402499999999996 36.6 27.4 38.0 17.8 38.0 140-144 32.019349999999996 37.0 30.4 38.0 18.2 38.0 145-149 30.956850000000003 36.6 30.4 38.0 6.4 38.0 150 20.22625 24.0 2.0 34.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 3.0 9 1.0 10 0.0 11 1.0 12 4.0 13 2.0 14 3.0 15 6.0 16 5.0 17 9.0 18 30.0 19 48.0 20 4.0 21 9.0 22 9.0 23 9.0 24 16.0 25 14.0 26 19.0 27 28.0 28 39.0 29 53.0 30 50.0 31 55.0 32 62.0 33 99.0 34 136.0 35 239.0 36 748.0 37 2296.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.16636101650511 13.99004453759497 7.440398218496201 33.40319622740372 2 24.4 18.7 33.975 22.925 3 21.175 21.625 28.599999999999998 28.599999999999998 4 27.05 26.775 20.075000000000003 26.1 5 28.925 30.575000000000003 21.9 18.6 6 24.25 32.35 22.425 20.974999999999998 7 18.775 24.625 37.65 18.95 8 18.875 25.224999999999998 27.975 27.925 9 23.674999999999997 19.45 30.875000000000004 26.0 10-14 23.34 27.425 23.56 25.674999999999997 15-19 23.875 24.975 24.73 26.419999999999998 20-24 23.145 26.290000000000003 25.3 25.264999999999997 25-29 22.765 25.369999999999997 25.35 26.515 30-34 23.325000000000003 25.335 25.185000000000002 26.155 35-39 24.565 24.990000000000002 25.34 25.105 40-44 22.61 24.67 26.36 26.36 45-49 24.875 24.285 26.845000000000002 23.995 50-54 23.849999999999998 23.669999999999998 25.27 27.21 55-59 24.0 24.555 26.51 24.935 60-64 24.095 24.555 25.874999999999996 25.474999999999998 65-69 23.265 27.584999999999997 24.205 24.945 70-74 23.195 27.08 24.474999999999998 25.25 75-79 23.435 26.029999999999998 24.445 26.090000000000003 80-84 24.05 24.51 25.735000000000003 25.705 85-89 23.44 25.205 25.124999999999996 26.229999999999997 90-94 23.915 24.39 25.525 26.169999999999998 95-99 24.45 24.765 24.995 25.790000000000003 100-104 23.990000000000002 25.485000000000003 24.87 25.655 105-109 24.44 25.96 24.18 25.419999999999998 110-114 23.855 25.935000000000002 24.54 25.669999999999998 115-119 23.745 24.995 25.305 25.955000000000002 120-124 24.15 24.79 24.884999999999998 26.174999999999997 125-129 24.385 25.874999999999996 24.065 25.674999999999997 130-134 24.55 26.31 23.895 25.245 135-139 25.165 25.095 24.065 25.674999999999997 140-144 23.76 25.814999999999998 23.9 26.525 145-149 24.83 25.665 23.919999999999998 25.585 150 20.724999999999998 26.424999999999997 24.375 28.475 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 2.5 3 3.0 4 3.0 5 3.0 6 1.0 7 0.5 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.0 27 1.5 28 3.0 29 6.5 30 7.5 31 13.5 32 21.5 33 25.5 34 35.5 35 43.5 36 48.0 37 58.0 38 76.5 39 98.0 40 117.5 41 153.5 42 169.5 43 165.5 44 173.0 45 180.0 46 172.5 47 168.0 48 164.0 49 157.5 50 148.0 51 135.5 52 133.5 53 113.0 54 98.5 55 98.5 56 92.0 57 95.5 58 110.5 59 106.0 60 103.0 61 96.0 62 79.0 63 73.5 64 71.0 65 76.5 66 67.0 67 47.5 68 41.5 69 34.0 70 26.5 71 24.5 72 16.0 73 11.0 74 7.5 75 1.0 76 1.5 77 2.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.78666666666666 91.675 2 1.7866666666666666 3.35 3 0.24 0.675 4 0.02666666666666667 0.1 5 0.0 0.0 6 0.02666666666666667 0.15 7 0.0 0.0 8 0.05333333333333334 0.4 9 0.0 0.0 >10 0.05333333333333334 0.7000000000000001 >50 0.0 0.0 >100 0.02666666666666667 2.9499999999999997 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGTAGCATCTCGTATGC 118 2.9499999999999997 TruSeq Adapter, Index 22 (97% over 37bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGTAGCATCTCGTATG 15 0.375 TruSeq Adapter, Index 22 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 13 0.325 No Hit ATCGGAAGAGCACACGTCTGAACTCCAGTCACGGTAGCATCTCGTATGCC 8 0.2 TruSeq Adapter, Index 22 (97% over 36bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACGGTAGCATCTCGTATGC 8 0.2 TruSeq Adapter, Index 11 (97% over 35bp) GTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTTCTTCACCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.4 0.0 0.0 0.0 0.0 2 0.4 0.0 0.0 0.0 0.0 3 0.4 0.0 0.0 0.0 0.0 4 0.4 0.0 0.0 0.0 0.0 5 0.4 0.0 0.0 0.0 0.0 6 0.4 0.0 0.0 0.0 0.0 7 0.4 0.0 0.0 0.0 0.0 8 0.4 0.0 0.0 0.0 0.0 9 0.4 0.0 0.0 0.0 0.0 10-11 0.4 0.0 0.0 0.0 0.0 12-13 0.4 0.0 0.0 0.0 0.0 14-15 0.4 0.0 0.0 0.0 0.0 16-17 0.4 0.0 0.0 0.0 0.0 18-19 0.4 0.0 0.0 0.0 0.0 20-21 0.4 0.0 0.0 0.0 0.0 22-23 0.4 0.0 0.0 0.0 0.0 24-25 0.4 0.0 0.0 0.0 0.0 26-27 0.4 0.0 0.0 0.0 0.0 28-29 0.4125 0.0 0.0 0.0 0.0 30-31 0.425 0.0 0.0 0.0 0.0 32-33 0.425 0.0 0.0 0.0 0.0 34-35 0.425 0.0 0.0 0.0 0.0 36-37 0.425 0.0 0.0 0.0 0.0 38-39 0.425 0.0 0.0 0.0 0.0 40-41 0.425 0.0 0.0 0.0 0.0 42-43 0.425 0.0 0.0 0.0 0.0 44-45 0.425 0.0 0.0 0.0 0.0 46-47 0.425 0.0 0.0 0.0 0.0 48-49 0.425 0.0 0.0 0.0 0.0 50-51 0.425 0.0 0.0 0.0 0.0 52-53 0.425 0.0 0.0 0.0 0.0 54-55 0.45 0.0 0.0 0.0 0.0 56-57 0.45 0.0 0.0 0.0 0.0 58-59 0.45 0.0 0.0 0.0 0.0 60-61 0.525 0.0 0.0 0.0 0.0 62-63 0.575 0.0 0.0 0.0 0.0 64-65 0.575 0.0 0.0 0.0 0.0 66-67 0.575 0.0 0.0 0.0 0.0 68-69 0.575 0.0 0.0 0.0 0.0 70-71 0.575 0.0 0.0 0.0 0.0 72-73 0.575 0.0 0.0 0.0 0.0 74-75 0.5874999999999999 0.0 0.0 0.0 0.0 76-77 0.6 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.2875 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 4.7375 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138 5.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 40 3.8799044E-9 107.99063 4 TCGGAAG 45 8.800271E-9 95.99167 3 GGAAGAG 45 8.800271E-9 95.99167 5 GAGCACA 50 1.8299033E-8 86.392494 9 ATCGGAA 50 1.8299033E-8 86.392494 2 GATCGGA 55 3.2385287E-8 79.53279 1 GAAGAGC 55 3.54612E-8 78.538635 6 AGAGCAC 55 3.54612E-8 78.538635 8 AAGAGCA 60 6.4843334E-8 71.99375 7 GAAAAAA 35 0.0036832115 20.569643 60-64 GTATGCC 45 6.867625E-4 19.198334 45-49 TATGCCG 45 6.867625E-4 19.198334 45-49 TTCTGCT 45 6.867625E-4 19.198334 55-59 CCGTCTT 45 6.867625E-4 19.198334 50-54 ATGCCGT 45 6.867625E-4 19.198334 45-49 CGTATGC 45 6.867625E-4 19.198334 40-44 TCGTATG 45 6.867625E-4 19.198334 40-44 GCCGTCT 45 6.867625E-4 19.198334 45-49 GCATCTC 45 6.867625E-4 19.198334 35-39 ACGGTAG 45 6.867625E-4 19.198334 30-34 >>END_MODULE SRR8096893 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096893_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.25875 33.0 32.0 33.0 18.0 34.0 2 30.3955 33.0 32.0 34.0 18.0 34.0 3 30.20725 33.0 31.0 34.0 18.0 34.0 4 29.94075 33.0 31.0 34.0 15.0 34.0 5 30.11075 33.0 32.0 34.0 15.0 34.0 6 33.723 38.0 35.0 38.0 16.0 38.0 7 33.87575 38.0 35.0 38.0 16.0 38.0 8 33.92775 38.0 35.0 38.0 16.0 38.0 9 33.86925 38.0 35.0 38.0 16.0 38.0 10-14 33.6447 38.0 35.0 38.0 16.0 38.0 15-19 33.36605 38.0 34.4 38.0 16.0 38.0 20-24 33.2581 38.0 34.8 38.0 16.0 38.0 25-29 32.99905 38.0 34.0 38.0 16.0 38.0 30-34 32.58585 38.0 33.4 38.0 16.0 38.0 35-39 32.450750000000006 38.0 33.0 38.0 16.0 38.0 40-44 32.2664 38.0 33.0 38.0 15.2 38.0 45-49 31.9535 38.0 31.4 38.0 14.8 38.0 50-54 31.88935 38.0 31.8 38.0 14.6 38.0 55-59 31.605399999999996 37.8 30.0 38.0 15.0 38.0 60-64 31.541949999999996 38.0 30.2 38.0 14.2 38.0 65-69 31.0796 37.6 29.0 38.0 11.6 38.0 70-74 30.210649999999998 37.0 27.4 38.0 2.0 38.0 75-79 29.58455 37.0 25.6 38.0 2.0 38.0 80-84 29.3108 36.4 24.6 38.0 2.0 38.0 85-89 28.72615 36.0 20.8 38.0 2.0 38.0 90-94 28.4515 35.8 18.2 38.0 2.0 38.0 95-99 27.771049999999995 34.8 15.0 38.0 2.0 38.0 100-104 27.318450000000002 34.8 15.0 38.0 2.0 38.0 105-109 26.692650000000004 34.0 15.0 38.0 2.0 38.0 110-114 25.850749999999998 34.0 14.4 38.0 2.0 38.0 115-119 25.27145 33.8 13.8 38.0 2.0 38.0 120-124 24.32065 31.6 13.0 37.8 2.0 38.0 125-129 23.34235 30.4 6.4 37.2 2.0 38.0 130-134 22.24145 28.0 2.0 36.2 2.0 38.0 135-139 20.6505 24.0 2.0 35.4 2.0 38.0 140-144 19.0682 19.8 2.0 34.4 2.0 38.0 145-149 16.3168 6.4 2.0 33.0 2.0 38.0 150 11.4 2.0 2.0 28.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 140.0 3 45.0 4 25.0 5 22.0 6 28.0 7 19.0 8 8.0 9 21.0 10 14.0 11 39.0 12 29.0 13 40.0 14 46.0 15 43.0 16 52.0 17 53.0 18 49.0 19 55.0 20 49.0 21 54.0 22 55.0 23 62.0 24 79.0 25 74.0 26 100.0 27 102.0 28 128.0 29 134.0 30 173.0 31 204.0 32 218.0 33 299.0 34 343.0 35 447.0 36 501.0 37 250.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.73587747928697 19.708762239517952 8.03414511674617 28.52121516444891 2 26.965725806451612 25.65524193548387 28.17540322580645 19.203629032258064 3 23.97277539702546 23.367784219813462 28.031257877489285 24.62818250567179 4 25.403632694248234 30.953582240161452 18.592330978809283 25.050454086781027 5 29.739964655390054 31.86064125220904 18.90936632163595 19.490027770764957 6 25.93805086879879 32.561067741123146 18.559556786703602 22.941324603374465 7 21.399798590130917 22.910372608257802 32.45216515609265 23.23766364551863 8 21.102996726265424 25.48476454293629 22.941324603374465 30.47091412742382 9 26.62975081802165 21.79713063176441 24.79234835137176 26.780770198842184 10-14 27.69664618793433 25.143518984792024 21.593312518884076 25.566522308389565 15-19 26.51488440034252 24.61592706391981 23.75459628267768 25.114592253059993 20-24 26.918815471394037 26.03746978243352 22.285455278001614 24.758259468170827 25-29 26.25006294375346 26.300417946522987 22.55904124074727 24.890477868976284 30-34 26.108622338551367 25.071726984446567 24.311672622942567 24.507978054059496 35-39 25.252982933091676 25.756431556159693 23.767809495041032 25.2227760157076 40-44 28.02355428053752 24.399818813226634 23.418390457496603 24.158236448739242 45-49 25.684517817596138 24.14938594725186 23.686329776525064 26.479766458626937 50-54 25.708818049050713 24.983632975776803 23.956287455305432 25.35126151986705 55-59 24.777201550777907 26.41357434167464 23.926287699511605 24.88293640803585 60-64 24.881683616957005 27.454435605679183 22.99869096767697 24.665189809686836 65-69 25.54134353912781 27.772182495719612 22.625642058616176 24.06083190653641 70-74 25.707380928406003 26.81502366327661 22.42473064142584 25.052864766891553 75-79 24.904349577124446 27.10430930326218 22.855416834474426 25.135924285138945 80-84 25.439170483716715 26.96431267931746 22.539890270297477 25.056626566668346 85-89 25.44182065354212 26.720708927042946 23.1005488142591 24.736921605155835 90-94 24.919452275473216 26.86770036246476 23.2078131292791 25.005034232782926 95-99 25.611720874030812 27.066760648474474 22.248514751787333 25.073003725707384 100-104 25.408887323234865 26.742489054400885 22.79200845453173 25.05661516783252 105-109 25.340983441542104 27.137752277417082 23.066082842619156 24.45518143842166 110-114 26.047587906836362 26.907792142461894 22.19930580009055 24.8453141506112 115-119 25.31709281256291 27.76323736661969 22.35252667606201 24.567143144755384 120-124 25.334675390035226 27.65475591343734 22.501258178158025 24.5093105183694 125-129 26.213250100684654 27.56242448650826 22.362062021747885 23.8622633910592 130-134 25.77739760491094 27.98128207708564 22.406158800442793 23.835161517560632 135-139 24.79754539510085 27.714903676877423 23.42437503143705 24.063175896584678 140-144 25.376138479343837 28.873345745483824 21.91415488351029 23.836360891662054 145-149 25.543396036108728 28.60456906551011 21.91235059760956 23.939684300771596 150 25.572615152277876 30.505914925748804 21.142713314875408 22.77875660709791 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 12.0 2 1.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.0 24 2.5 25 2.0 26 2.5 27 3.5 28 4.0 29 9.0 30 12.5 31 11.5 32 13.5 33 15.0 34 18.0 35 33.5 36 43.0 37 48.5 38 72.5 39 88.5 40 111.0 41 126.0 42 123.0 43 158.5 44 181.0 45 169.5 46 164.0 47 166.0 48 162.0 49 134.0 50 120.5 51 130.5 52 129.0 53 119.0 54 108.0 55 103.5 56 97.0 57 94.5 58 112.0 59 119.0 60 105.5 61 99.5 62 112.0 63 105.0 64 84.0 65 82.0 66 73.5 67 66.0 68 63.5 69 49.5 70 36.5 71 24.5 72 17.0 73 15.5 74 10.0 75 5.5 76 2.5 77 1.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.8 3 0.8250000000000001 4 0.8999999999999999 5 0.975 6 0.7250000000000001 7 0.7000000000000001 8 0.7250000000000001 9 0.675 10-14 0.7100000000000001 15-19 0.735 20-24 0.72 25-29 0.705 30-34 0.6649999999999999 35-39 0.685 40-44 0.655 45-49 0.66 50-54 0.715 55-59 0.695 60-64 0.69 65-69 0.7100000000000001 70-74 0.69 75-79 0.6799999999999999 80-84 0.6649999999999999 85-89 0.695 90-94 0.6799999999999999 95-99 0.69 100-104 0.645 105-109 0.655 110-114 0.605 115-119 0.66 120-124 0.65 125-129 0.6799999999999999 130-134 0.63 135-139 0.5950000000000001 140-144 0.635 145-149 0.855 150 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28482328482329 94.55 2 1.3513513513513513 2.6 3 0.2598752598752599 0.75 4 0.02598752598752599 0.1 5 0.0 0.0 6 0.02598752598752599 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02598752598752599 0.42500000000000004 >50 0.02598752598752599 1.425 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 57 1.425 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.275 0.0 0.0 0.0 0.0 7 0.275 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10-11 0.275 0.0 0.0 0.0 0.0 12-13 0.275 0.0 0.0 0.0 0.0 14-15 0.275 0.0 0.0 0.0 0.0 16-17 0.275 0.0 0.0 0.0 0.0 18-19 0.275 0.0 0.0 0.0 0.0 20-21 0.275 0.0 0.0 0.0 0.0 22-23 0.275 0.0 0.0 0.0 0.0 24-25 0.275 0.0 0.0 0.0 0.0 26-27 0.275 0.0 0.0 0.0 0.0 28-29 0.2875 0.0 0.0 0.0 0.0 30-31 0.3 0.0 0.0 0.0 0.0 32-33 0.3 0.0 0.0 0.0 0.0 34-35 0.3 0.0 0.0 0.0 0.0 36-37 0.3 0.0 0.0 0.0 0.0 38-39 0.3 0.0 0.0 0.0 0.0 40-41 0.3 0.0 0.0 0.0 0.0 42-43 0.3 0.0 0.0 0.0 0.0 44-45 0.3 0.0 0.0 0.0 0.0 46-47 0.3 0.0 0.0 0.0 0.0 48-49 0.3 0.0 0.0 0.0 0.0 50-51 0.3 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.325 0.0 0.0 0.0 0.0 56-57 0.325 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.325 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.35 0.0 0.0 0.0 0.0 66-67 0.35 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.4500000000000002 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.5875000000000004 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGAA 10 0.006973645 144.0 9 AGAGCGA 10 0.006973645 144.0 8 GAGCGTC 30 1.46121765E-5 96.0 9 AAGAGCG 45 8.794814E-9 96.0 7 GAAGAGC 45 8.794814E-9 96.0 6 CGGAAGA 45 8.794814E-9 96.0 4 GATCGGA 50 1.828812E-8 86.399994 1 TCGGAAG 50 1.828812E-8 86.399994 3 GGAAGAG 50 1.828812E-8 86.399994 5 AGAGCGT 35 3.1411873E-5 82.28571 8 ATCGGAA 55 3.543937E-8 78.545456 2 AGGGAAA 35 0.0036813593 20.571428 20-24 GGGAAAG 35 0.0036813593 20.571428 20-24 GGAAAGA 40 0.007966741 18.0 1 AAAAAAA 260 1.469889E-7 8.861538 60-64 >>END_MODULE Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527265 spots for SRR8096893.sra Written 2527265 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra Read 2527256 spots for SRR8096893.sra Written 2527256 spots for SRR8096893.sra SRR ids: ['SRR8096893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zm_dn1lg SRR8096893.sra spots: 50545129 blocks: [[1, 2527256], [2527257, 5054512], [5054513, 7581768], [7581769, 10109024], [10109025, 12636280], [12636281, 15163536], [15163537, 17690792], [17690793, 20218048], [20218049, 22745304], [22745305, 25272560], [25272561, 27799816], [27799817, 30327072], [30327073, 32854328], [32854329, 35381584], [35381585, 37908840], [37908841, 40436096], [40436097, 42963352], [42963353, 45490608], [45490609, 48017864], [48017865, 50545129]] SRR8096893 file size 17007664 SRR8096893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096893 SRR8096893_1.fastq SRR8096893_2.fastq Input file: SRR8096893_1.fastq Paired file: SRR8096893_2.fastq trimmed: SRR8096893-trimmed-pair1.fastq, SRR8096893-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:08:15 2024 >> started Sat Dec 7 15:09:15 2024 >> done (60.843s) 50545129 read pairs processed; of these: 469439 ( 0.93%) short read pairs filtered out after trimming by size control 2806344 ( 5.55%) empty read pairs filtered out after trimming by size control 47269346 (93.52%) read pairs available; of these: 26521086 (56.11%) trimmed read pairs available after processing 20748260 (43.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 219 0.00% 19 260 0.00% 20 132 0.00% 21 274 0.00% 22 235 0.00% 23 290 0.00% 24 397 0.00% 25 335 0.00% 26 308 0.00% 27 323 0.00% 28 1057 0.00% 29 747 0.00% 30 1016 0.00% 31 354 0.00% 32 558 0.00% 33 319 0.00% 34 471 0.00% 35 549 0.00% 36 469 0.00% 37 546 0.00% 38 540 0.00% 39 824 0.00% 40 1139 0.00% 41 1193 0.00% 42 1004 0.00% 43 1365 0.00% 44 1422 0.00% 45 2168 0.00% 46 2301 0.00% 47 2358 0.00% 48 2345 0.00% 49 2721 0.01% 50 2761 0.01% 51 3089 0.01% 52 3184 0.01% 53 3673 0.01% 54 3791 0.01% 55 4526 0.01% 56 5392 0.01% 57 4900 0.01% 58 7612 0.02% 59 10060 0.02% 60 6849 0.01% 61 26528 0.06% 62 7500 0.02% 63 3456 0.01% 64 3356 0.01% 65 3735 0.01% 66 3828 0.01% 67 4293 0.01% 68 5029 0.01% 69 7294 0.02% 70 7160 0.02% 71 6168 0.01% 72 6055 0.01% 73 7608 0.02% 74 6726 0.01% 75 7299 0.02% 76 7926 0.02% 77 8791 0.02% 78 9716 0.02% 79 10714 0.02% 80 12042 0.03% 81 13417 0.03% 82 15990 0.03% 83 21828 0.05% 84 51862 0.11% 85 51778 0.11% 86 53684 0.11% 87 56157 0.12% 88 56041 0.12% 89 56116 0.12% 90 54418 0.12% 91 53353 0.11% 92 54829 0.12% 93 55151 0.12% 94 57011 0.12% 95 58833 0.12% 96 63580 0.13% 97 67437 0.14% 98 71069 0.15% 99 73602 0.16% 100 74553 0.16% 101 78815 0.17% 102 82050 0.17% 103 86064 0.18% 104 90545 0.19% 105 93153 0.20% 106 99093 0.21% 107 103848 0.22% 108 107890 0.23% 109 107726 0.23% 110 109581 0.23% 111 112123 0.24% 112 116686 0.25% 113 119786 0.25% 114 124041 0.26% 115 128854 0.27% 116 133377 0.28% 117 139185 0.29% 118 143533 0.30% 119 150455 0.32% 120 155842 0.33% 121 160617 0.34% 122 166743 0.35% 123 174277 0.37% 124 181242 0.38% 125 185889 0.39% 126 195201 0.41% 127 201407 0.43% 128 209427 0.44% 129 218418 0.46% 130 223979 0.47% 131 233880 0.49% 132 246873 0.52% 133 256953 0.54% 134 270657 0.57% 135 285211 0.60% 136 302791 0.64% 137 320514 0.68% 138 339076 0.72% 139 366542 0.78% 140 393475 0.83% 141 432438 0.91% 142 473595 1.00% 143 537284 1.14% 144 629862 1.33% 145 761557 1.61% 146 977417 2.07% 147 1363103 2.88% 148 2496569 5.28% 149 10333433 21.86% 150 20748260 43.89% 47269346 reads passed initial QC criterion=sequence-density sequence-density=1.91 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=15 prefix-density=1.97 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.49 sequence-density-rank=16 fanout-score=10.05 fanout-score-rank=1 prefix-density=1.25 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.33 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=11 prefix-density=1.49 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.40 sequence-density-rank=17 fanout-score=10.06 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=3.8 sequence=CAGAGCATCCTCGCCATTTGGGCATGCCAAGTTGTGCTCATGGGC SRR8096893 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:10:00 Started mapping on | Dec 07 15:10:00 Finished on | Dec 07 15:14:32 Mapping speed, Million of reads per hour | 625.62 Number of input reads | 47269346 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 45639307 Uniquely mapped reads % | 96.55% Average mapped length | 287.49 Number of splices: Total | 43563407 Number of splices: Annotated (sjdb) | 41225455 Number of splices: GT/AG | 42989976 Number of splices: GC/AG | 496253 Number of splices: AT/AC | 11833 Number of splices: Non-canonical | 65345 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470619 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 9748 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1558418 1558418 1558418 N_multimapping 470619 470619 470619 N_noFeature 1461400 44214990 1797244 N_ambiguous 1275903 5196 191404 UnstrandedReadsAssigned:42902004 PositiveStrandReadsAssigned:1419121 NegativeStrandReadsAssigned:43650659 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096893 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096893-trimmed-pair1.fastq SRR8096893-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,269,346 reads, 43,776,988 reads pseudoaligned [quant] estimated average fragment length: 258.521 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52973 SRR8096893.ke.tsv 35125 SRR8096893.se.tsv 88098 total ==> SRR8096893.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.85 0 0 PNS24247 1044 786.479 101.802 3.88543 PNS24249 1928 1670.48 37.2075 0.668591 PNS24246 1044 786.479 101.802 3.88543 PNS24248 1044 786.479 101.802 3.88543 PNS24244 1471 1213.48 341.387 8.44471 PNS24243 293 88.7921 0 0 KQK14069 1603 1345.48 10149.9 226.441 KQK14071 474 230.938 209.86 27.2776 ==> SRR8096893.se.tsv <== BRADI_1g14170v3 12167 BRADI_1g53295v3 74 BRADI_1g59795v3 2248 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 795 BRADI_1g74790v3 174 BRADI_1g09890v3 0 BRADI_1g77505v3 646 BRADI_1g48960v3 0 SRR8096893 completed mapping pipeline successfully