Starting /dee2/code/volunteer_pipeline.sh SRR8096894 current disk space = 1542805831680 free memory = 1600736488 SRR8096894 SRAfilesize 2c9037685bd466b132aaf28931ce0852 SRR8096894.sra SRR8096894.sra file validated SRR8096894 is paired end SRR8096894 is conventional basespace SRR8096894 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.178 34.0 33.0 34.0 32.0 34.0 2 33.12875 34.0 33.0 34.0 32.0 34.0 3 33.2485 34.0 33.0 34.0 32.0 34.0 4 33.2745 34.0 33.0 34.0 33.0 34.0 5 33.3205 34.0 33.0 34.0 33.0 34.0 6 37.117 38.0 38.0 38.0 36.0 38.0 7 37.327 38.0 38.0 38.0 37.0 38.0 8 37.43975 38.0 38.0 38.0 37.0 38.0 9 37.35925 38.0 38.0 38.0 37.0 38.0 10-14 37.39595 38.0 38.0 38.0 37.0 38.0 15-19 37.43105 38.0 38.0 38.0 37.0 38.0 20-24 37.464150000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.4113 38.0 38.0 38.0 37.6 38.0 30-34 37.3609 38.0 38.0 38.0 37.0 38.0 35-39 37.338049999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.24655 38.0 38.0 38.0 37.0 38.0 45-49 37.16985 38.0 38.0 38.0 37.0 38.0 50-54 37.1432 38.0 38.0 38.0 37.0 38.0 55-59 37.0027 38.0 38.0 38.0 36.2 38.0 60-64 37.051249999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.0075 38.0 38.0 38.0 36.0 38.0 70-74 36.908100000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.868700000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.7869 38.0 38.0 38.0 35.8 38.0 85-89 36.72915 38.0 38.0 38.0 35.4 38.0 90-94 36.599000000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.5346 38.0 38.0 38.0 34.6 38.0 100-104 36.40285 38.0 38.0 38.0 34.4 38.0 105-109 36.2937 38.0 38.0 38.0 34.0 38.0 110-114 36.217949999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.081050000000005 38.0 38.0 38.0 33.8 38.0 120-124 35.8977 38.0 37.8 38.0 33.0 38.0 125-129 35.72995 38.0 37.4 38.0 32.2 38.0 130-134 35.3291 38.0 36.4 38.0 31.0 38.0 135-139 32.63590000000001 36.8 28.6 38.0 23.8 38.0 140-144 33.05475 37.0 31.2 38.0 26.4 38.0 145-149 31.799950000000003 36.8 30.8 38.0 11.6 38.0 150 20.2425 24.0 2.0 34.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 5.0 13 0.0 14 2.0 15 2.0 16 2.0 17 6.0 18 5.0 19 10.0 20 2.0 21 6.0 22 7.0 23 10.0 24 8.0 25 15.0 26 14.0 27 26.0 28 23.0 29 31.0 30 50.0 31 44.0 32 59.0 33 91.0 34 162.0 35 288.0 36 792.0 37 2334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.92946058091287 10.632780082987551 7.365145228215768 45.072614107883815 2 21.7 16.1 39.175 23.025000000000002 3 21.6 20.25 25.85 32.300000000000004 4 27.025 26.450000000000003 21.675 24.85 5 25.775 31.225 23.225 19.775000000000002 6 20.424999999999997 32.800000000000004 24.224999999999998 22.55 7 17.974999999999998 21.55 41.0 19.475 8 19.775000000000002 21.3 31.3 27.625 9 20.549999999999997 19.875 33.875 25.7 10-14 22.795 26.284999999999997 25.264999999999997 25.655 15-19 23.189999999999998 25.41 25.96 25.44 20-24 23.05 25.195 26.39 25.365 25-29 22.43 25.88 25.540000000000003 26.150000000000002 30-34 22.994999999999997 25.124999999999996 25.990000000000002 25.89 35-39 23.135 25.405 26.11 25.35 40-44 22.975 25.169999999999998 26.205000000000002 25.650000000000002 45-49 23.150000000000002 25.085 26.340000000000003 25.424999999999997 50-54 22.7 25.72 25.52 26.06 55-59 23.415 24.515 25.715 26.355 60-64 23.599999999999998 25.06 25.305 26.035000000000004 65-69 23.285 26.075 25.290000000000003 25.35 70-74 23.48 25.575 25.215 25.729999999999997 75-79 23.330000000000002 25.8 25.21 25.66 80-84 23.565 25.305 25.16 25.97 85-89 23.845 24.740000000000002 25.72 25.695 90-94 23.39 25.25 25.435000000000002 25.924999999999997 95-99 23.485 24.94 25.779999999999998 25.795 100-104 23.580000000000002 25.855 25.505 25.06 105-109 23.615 24.990000000000002 25.95 25.445 110-114 23.835 25.2 25.405 25.56 115-119 23.45 25.8 24.915000000000003 25.835 120-124 23.895 24.83 25.619999999999997 25.655 125-129 24.095 24.775 25.05 26.08 130-134 24.285 25.195 24.875 25.645 135-139 24.62 24.6 25.28 25.5 140-144 23.400000000000002 25.840000000000003 24.815 25.945 145-149 23.755000000000003 24.725 25.575 25.945 150 22.15 25.2 24.65 28.000000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.5 2 1.5 3 1.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 1.0 12 1.5 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 3.0 27 6.5 28 6.5 29 7.0 30 10.0 31 17.5 32 21.0 33 25.5 34 28.5 35 34.5 36 46.0 37 59.0 38 69.5 39 86.5 40 115.5 41 144.0 42 164.5 43 178.5 44 183.5 45 184.0 46 202.5 47 201.0 48 185.5 49 178.5 50 168.0 51 156.0 52 141.0 53 116.5 54 105.5 55 105.5 56 101.0 57 102.5 58 93.0 59 82.0 60 80.0 61 82.5 62 84.0 63 76.5 64 68.0 65 59.5 66 41.5 67 34.0 68 31.5 69 25.0 70 23.5 71 18.5 72 11.0 73 6.0 74 5.0 75 3.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.64795918367348 96.675 2 1.096938775510204 2.15 3 0.12755102040816327 0.375 4 0.05102040816326531 0.2 5 0.025510204081632654 0.125 6 0.0 0.0 7 0.025510204081632654 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025510204081632654 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATCTCGTATGC 12 0.3 TruSeq Adapter, Index 7 (97% over 36bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTACA 10 0.0069808904 143.95 6 AAAAAAA 30 0.0015062337 23.991667 60-64 >>END_MODULE SRR8096894 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096894_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.34325 33.0 32.0 33.0 27.0 34.0 2 31.5005 33.0 32.0 34.0 27.0 34.0 3 31.451 33.0 31.0 34.0 28.0 34.0 4 31.237 33.0 31.0 34.0 28.0 34.0 5 31.324 33.0 32.0 34.0 27.0 34.0 6 35.179 38.0 37.0 38.0 28.0 38.0 7 35.273 38.0 37.0 38.0 29.0 38.0 8 35.3675 38.0 37.0 38.0 29.0 38.0 9 35.35475 38.0 37.0 38.0 29.0 38.0 10-14 35.37095000000001 38.0 37.0 38.0 29.0 38.0 15-19 35.07925 38.0 36.8 38.0 28.0 38.0 20-24 35.0789 38.0 36.8 38.0 27.8 38.0 25-29 34.93835 38.0 36.4 38.0 27.4 38.0 30-34 34.614549999999994 38.0 36.0 38.0 25.8 38.0 35-39 34.5065 38.0 36.0 38.0 25.0 38.0 40-44 34.50595 38.0 35.6 38.0 25.8 38.0 45-49 34.25215 38.0 35.2 38.0 24.8 38.0 50-54 34.098150000000004 38.0 34.8 38.0 22.6 38.0 55-59 33.9116 38.0 34.2 38.0 19.2 38.0 60-64 33.6653 38.0 34.0 38.0 16.0 38.0 65-69 33.48885 38.0 34.0 38.0 16.0 38.0 70-74 33.05884999999999 38.0 33.2 38.0 16.0 38.0 75-79 32.6947 38.0 32.8 38.0 15.2 38.0 80-84 32.40185 37.6 32.0 38.0 15.0 38.0 85-89 31.8091 37.0 30.0 38.0 15.0 38.0 90-94 31.702949999999998 37.0 30.0 38.0 15.0 38.0 95-99 31.004550000000002 36.8 28.2 38.0 14.4 38.0 100-104 30.5388 36.0 27.2 38.0 13.2 38.0 105-109 29.84865 35.6 24.6 38.0 13.0 38.0 110-114 29.13075 35.0 23.0 38.0 10.8 38.0 115-119 28.31495 34.6 20.2 38.0 2.0 38.0 120-124 27.5685 34.0 16.2 38.0 2.0 38.0 125-129 26.782549999999997 34.0 14.8 38.0 2.0 38.0 130-134 25.57755 32.8 14.0 38.0 2.0 38.0 135-139 23.9546 31.4 13.0 36.8 2.0 38.0 140-144 22.48295 29.6 2.0 36.0 2.0 38.0 145-149 19.58665 21.8 2.0 35.8 2.0 38.0 150 13.853 2.0 2.0 31.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 51.0 3 7.0 4 5.0 5 9.0 6 6.0 7 9.0 8 5.0 9 7.0 10 8.0 11 19.0 12 12.0 13 22.0 14 25.0 15 20.0 16 30.0 17 24.0 18 32.0 19 44.0 20 42.0 21 43.0 22 55.0 23 71.0 24 85.0 25 69.0 26 101.0 27 102.0 28 126.0 29 143.0 30 158.0 31 215.0 32 229.0 33 298.0 34 433.0 35 563.0 36 602.0 37 330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.51305220883534 16.06425702811245 10.491967871485944 38.93072289156627 2 26.466884915638378 22.28657768823974 33.11508436162176 18.131453034500126 3 22.493702770780857 25.138539042821158 27.279596977329973 25.088161209068012 4 26.347607052896727 30.503778337531486 18.89168765743073 24.256926952141058 5 27.872983870967744 32.66129032258064 19.556451612903224 19.909274193548388 6 21.344072489302793 35.08683614397181 21.822300528567833 21.746790838157565 7 22.082494969818914 17.655935613682093 35.085513078470825 25.176056338028168 8 23.345911949685537 22.264150943396228 25.333333333333336 29.056603773584904 9 24.9685692733216 20.69399044505909 26.904702036711086 27.432738244908222 10-14 26.293016703562085 24.622660495069432 23.15355202253975 25.930770778828737 15-19 25.99526901202879 25.184961497810658 24.198500176153807 24.621269314006746 20-24 25.932075471698113 25.831446540880503 24.130817610062895 24.10566037735849 25-29 25.66656605292283 25.66656605292283 23.71969010966898 24.947177784485362 30-34 26.04082864038616 25.211182622687044 24.07481898632341 24.67316975060338 35-39 25.846200271588792 25.16722828547 24.387667856963237 24.598903585977972 40-44 26.381416863592943 24.697068731459602 24.40545024888129 24.516064156066168 45-49 26.318700658721777 24.97108663951325 23.809523809523807 24.900688892241163 50-54 25.52463388858135 25.187459111267675 24.402395450656737 24.88551154949424 55-59 25.993360828890456 25.94306407806056 24.11226234785233 23.95131274519666 60-64 25.63999396469346 25.816023738872403 23.633254539053464 24.910727757380677 65-69 25.82251735587081 25.79233323271959 24.031592715564944 24.353556695844652 70-74 25.64515317671915 25.579757533075103 24.634035917299663 24.141053372906082 75-79 26.017200623648346 24.92581602373887 24.654227229291354 24.40275612332143 80-84 25.53298471440064 25.64863234111022 24.346339501206756 24.47204344328238 85-89 26.167002012072434 25.51810865191147 24.517102615694164 23.79778672032193 90-94 25.304234134567032 25.7618425022629 24.348788092125112 24.585135271044955 95-99 26.20988026964483 25.742026360800885 24.05171546433243 23.996377905221852 100-104 25.868570566644877 25.51158932073005 24.39539443913721 24.224445673487857 105-109 25.96782302664656 25.746606334841626 24.087481146304675 24.19808949220714 110-114 25.88087459160593 26.303091228951995 23.523498366423727 24.292535813018347 115-119 25.730229752149214 25.529133779096075 24.37283193404052 24.367804534714192 120-124 26.343842711318956 25.52421179665108 24.252023935234075 23.879921556795896 125-129 25.788282625094293 26.05481518732713 23.404576313804377 24.752325873774204 130-134 26.486703865681392 25.501432664756447 24.018498969486753 23.993364500075405 135-139 25.668341708542712 26.14572864321608 24.271356783919597 23.91457286432161 140-144 26.36605841250691 26.38616598803599 23.375056552556174 23.87271904690092 145-149 26.34018540910923 26.622329705763804 23.024989923417976 24.01249496170899 150 26.370035193564608 27.149321266968325 22.473604826546005 24.007038712921066 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 18.0 1 10.5 2 1.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.0 24 4.0 25 3.0 26 2.5 27 2.0 28 3.0 29 8.0 30 12.0 31 12.0 32 12.0 33 16.0 34 25.0 35 30.5 36 42.5 37 61.5 38 73.5 39 80.0 40 103.0 41 126.0 42 140.5 43 138.0 44 156.0 45 187.0 46 175.0 47 157.0 48 152.0 49 161.5 50 164.5 51 152.0 52 135.0 53 121.5 54 115.0 55 117.5 56 110.5 57 106.5 58 118.5 59 112.5 60 104.0 61 100.0 62 93.5 63 79.0 64 70.0 65 71.0 66 63.5 67 57.5 68 49.5 69 39.0 70 38.0 71 29.0 72 14.5 73 9.0 74 5.0 75 4.5 76 3.0 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.7250000000000001 3 0.75 4 0.75 5 0.8 6 0.675 7 0.6 8 0.625 9 0.575 10-14 0.62 15-19 0.655 20-24 0.625 25-29 0.61 30-34 0.5599999999999999 35-39 0.585 40-44 0.555 45-49 0.565 50-54 0.645 55-59 0.59 60-64 0.585 65-69 0.61 70-74 0.605 75-79 0.585 80-84 0.5599999999999999 85-89 0.6 90-94 0.5700000000000001 95-99 0.61 100-104 0.555 105-109 0.5499999999999999 110-114 0.525 115-119 0.545 120-124 0.565 125-129 0.575 130-134 0.5349999999999999 135-139 0.5 140-144 0.5349999999999999 145-149 0.76 150 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82712901580825 96.89999999999999 2 0.9433962264150944 1.8499999999999999 3 0.10198878123406425 0.3 4 0.025497195308516064 0.1 5 0.025497195308516064 0.125 6 0.025497195308516064 0.15 7 0.025497195308516064 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 7 0.17500000000000002 No Hit CATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCA 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138 2.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTCAG 10 0.0067269662 145.72151 5 GGATGCC 10 0.0069881454 143.9 6 >>END_MODULE Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365987 spots for SRR8096894.sra Written 2365987 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra Read 2365969 spots for SRR8096894.sra Written 2365969 spots for SRR8096894.sra SRR ids: ['SRR8096894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_884sm580 SRR8096894.sra spots: 47319398 blocks: [[1, 2365969], [2365970, 4731938], [4731939, 7097907], [7097908, 9463876], [9463877, 11829845], [11829846, 14195814], [14195815, 16561783], [16561784, 18927752], [18927753, 21293721], [21293722, 23659690], [23659691, 26025659], [26025660, 28391628], [28391629, 30757597], [30757598, 33123566], [33123567, 35489535], [35489536, 37855504], [37855505, 40221473], [40221474, 42587442], [42587443, 44953411], [44953412, 47319398]] SRR8096894 file size 15920870 SRR8096894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096894 SRR8096894_1.fastq SRR8096894_2.fastq Input file: SRR8096894_1.fastq Paired file: SRR8096894_2.fastq trimmed: SRR8096894-trimmed-pair1.fastq, SRR8096894-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:10:06 2024 >> started Sat Dec 7 15:10:56 2024 >> done (49.735s) 47319398 read pairs processed; of these: 170724 ( 0.36%) short read pairs filtered out after trimming by size control 947188 ( 2.00%) empty read pairs filtered out after trimming by size control 46201486 (97.64%) read pairs available; of these: 24596134 (53.24%) trimmed read pairs available after processing 21605352 (46.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 50 0.00% 19 90 0.00% 20 70 0.00% 21 87 0.00% 22 63 0.00% 23 85 0.00% 24 198 0.00% 25 173 0.00% 26 171 0.00% 27 357 0.00% 28 326 0.00% 29 224 0.00% 30 293 0.00% 31 139 0.00% 32 172 0.00% 33 133 0.00% 34 183 0.00% 35 216 0.00% 36 134 0.00% 37 202 0.00% 38 200 0.00% 39 374 0.00% 40 377 0.00% 41 372 0.00% 42 332 0.00% 43 401 0.00% 44 389 0.00% 45 505 0.00% 46 622 0.00% 47 626 0.00% 48 550 0.00% 49 715 0.00% 50 684 0.00% 51 700 0.00% 52 710 0.00% 53 812 0.00% 54 830 0.00% 55 841 0.00% 56 980 0.00% 57 1047 0.00% 58 1226 0.00% 59 1222 0.00% 60 1251 0.00% 61 2226 0.00% 62 1567 0.00% 63 1287 0.00% 64 1393 0.00% 65 1491 0.00% 66 1636 0.00% 67 1827 0.00% 68 2035 0.00% 69 2402 0.01% 70 2514 0.01% 71 2552 0.01% 72 2806 0.01% 73 3259 0.01% 74 3380 0.01% 75 3826 0.01% 76 4241 0.01% 77 4677 0.01% 78 5214 0.01% 79 5772 0.01% 80 6545 0.01% 81 7421 0.02% 82 9002 0.02% 83 11935 0.03% 84 22619 0.05% 85 23922 0.05% 86 25332 0.05% 87 27121 0.06% 88 27325 0.06% 89 27690 0.06% 90 27966 0.06% 91 28209 0.06% 92 29319 0.06% 93 29985 0.06% 94 31985 0.07% 95 33643 0.07% 96 35621 0.08% 97 38225 0.08% 98 41402 0.09% 99 44030 0.10% 100 44843 0.10% 101 47575 0.10% 102 49444 0.11% 103 51765 0.11% 104 55019 0.12% 105 58018 0.13% 106 63057 0.14% 107 67288 0.15% 108 69928 0.15% 109 69955 0.15% 110 71451 0.15% 111 74553 0.16% 112 78299 0.17% 113 82102 0.18% 114 85307 0.18% 115 89055 0.19% 116 93054 0.20% 117 98015 0.21% 118 101509 0.22% 119 107359 0.23% 120 112326 0.24% 121 117368 0.25% 122 123995 0.27% 123 130315 0.28% 124 136008 0.29% 125 140850 0.30% 126 148023 0.32% 127 154723 0.33% 128 162698 0.35% 129 171309 0.37% 130 177985 0.39% 131 187923 0.41% 132 200197 0.43% 133 211545 0.46% 134 225728 0.49% 135 239898 0.52% 136 258356 0.56% 137 278766 0.60% 138 296109 0.64% 139 322847 0.70% 140 353305 0.76% 141 391319 0.85% 142 437172 0.95% 143 501110 1.08% 144 596227 1.29% 145 737195 1.60% 146 968236 2.10% 147 1371483 2.97% 148 2576159 5.58% 149 10806829 23.39% 150 21605352 46.76% 46201486 reads passed initial QC criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=16 prefix-density=1.22 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=37.78 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.4 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=15 prefix-density=0.90 prefix-fanout=2.9 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=48.49 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8096894 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:11:39 Started mapping on | Dec 07 15:11:39 Finished on | Dec 07 15:16:56 Mapping speed, Million of reads per hour | 524.69 Number of input reads | 46201486 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 44570198 Uniquely mapped reads % | 96.47% Average mapped length | 290.69 Number of splices: Total | 46409609 Number of splices: Annotated (sjdb) | 43851143 Number of splices: GT/AG | 45793710 Number of splices: GC/AG | 538783 Number of splices: AT/AC | 13977 Number of splices: Non-canonical | 63139 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 560308 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 17473 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1236289 1236289 1236289 N_multimapping 560308 560308 560308 N_noFeature 1684746 43191118 2021684 N_ambiguous 1234851 5336 197024 UnstrandedReadsAssigned:41650601 PositiveStrandReadsAssigned:1373744 NegativeStrandReadsAssigned:42351490 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096894 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096894-trimmed-pair1.fastq SRR8096894-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,201,486 reads, 42,426,590 reads pseudoaligned [quant] estimated average fragment length: 283.408 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR8096894.ke.tsv 35125 SRR8096894.se.tsv 88098 total ==> SRR8096894.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.11 0 0 PNS24247 1044 761.592 144.314 6.10059 PNS24249 1928 1645.59 70.2113 1.37364 PNS24246 1044 761.592 144.314 6.10059 PNS24248 1044 761.592 144.314 6.10059 PNS24244 1471 1188.59 331.848 8.98862 PNS24243 293 81.3155 0 0 KQK14069 1603 1320.59 11173.5 272.4 KQK14071 474 214.904 214.013 32.0614 ==> SRR8096894.se.tsv <== BRADI_1g14170v3 13426 BRADI_1g53295v3 68 BRADI_1g59795v3 2160 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 592 BRADI_1g74790v3 168 BRADI_1g09890v3 0 BRADI_1g77505v3 621 BRADI_1g48960v3 0 SRR8096894 completed mapping pipeline successfully