Starting /dee2/code/volunteer_pipeline.sh SRR8096895 current disk space = 1542365777920 free memory = 1591662776 SRR8096895 SRAfilesize c7bc4ce88ce204e2160fd7ad12c325bd SRR8096895.sra SRR8096895.sra file validated SRR8096895 is paired end SRR8096895 is conventional basespace SRR8096895 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096895_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46075 34.0 33.0 34.0 32.0 34.0 2 33.234 34.0 33.0 34.0 32.0 34.0 3 33.26825 34.0 33.0 34.0 32.0 34.0 4 33.26725 34.0 33.0 34.0 33.0 34.0 5 33.29725 34.0 33.0 34.0 33.0 34.0 6 37.11625 38.0 38.0 38.0 36.0 38.0 7 37.30675 38.0 38.0 38.0 37.0 38.0 8 37.41825 38.0 38.0 38.0 37.0 38.0 9 37.39825 38.0 38.0 38.0 37.0 38.0 10-14 37.39125 38.0 38.0 38.0 37.0 38.0 15-19 37.39594999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.3867 38.0 38.0 38.0 37.0 38.0 25-29 37.346700000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.2745 38.0 38.0 38.0 37.0 38.0 35-39 37.15835 38.0 38.0 38.0 37.0 38.0 40-44 37.05970000000001 38.0 38.0 38.0 36.6 38.0 45-49 37.04935 38.0 38.0 38.0 36.8 38.0 50-54 37.0449 38.0 38.0 38.0 36.4 38.0 55-59 36.95495 38.0 38.0 38.0 36.2 38.0 60-64 36.8464 38.0 38.0 38.0 36.0 38.0 65-69 36.68065 38.0 38.0 38.0 35.4 38.0 70-74 36.559749999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.289300000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.21065 38.0 38.0 38.0 34.4 38.0 85-89 36.18245 38.0 38.0 38.0 34.4 38.0 90-94 36.032799999999995 38.0 38.0 38.0 34.0 38.0 95-99 35.87474999999999 38.0 38.0 38.0 33.8 38.0 100-104 35.78060000000001 38.0 38.0 38.0 33.4 38.0 105-109 35.621500000000005 38.0 38.0 38.0 33.0 38.0 110-114 35.5573 38.0 38.0 38.0 32.4 38.0 115-119 35.31725 38.0 37.8 38.0 31.0 38.0 120-124 35.16 38.0 36.8 38.0 29.8 38.0 125-129 34.975649999999995 38.0 36.4 38.0 30.0 38.0 130-134 34.616 38.0 35.8 38.0 27.4 38.0 135-139 32.2669 37.0 28.4 38.0 21.2 38.0 140-144 32.6772 37.0 30.6 38.0 20.6 38.0 145-149 31.537150000000004 37.2 30.8 38.0 8.6 38.0 150 20.9965 26.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 5.0 8 3.0 9 2.0 10 4.0 11 3.0 12 5.0 13 7.0 14 3.0 15 5.0 16 4.0 17 3.0 18 25.0 19 24.0 20 4.0 21 11.0 22 5.0 23 14.0 24 9.0 25 14.0 26 19.0 27 25.0 28 36.0 29 37.0 30 43.0 31 47.0 32 72.0 33 99.0 34 129.0 35 257.0 36 735.0 37 2349.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.52185089974293 12.827763496143959 6.349614395886889 37.300771208226216 2 20.95 16.55 39.7 22.8 3 20.625 19.650000000000002 28.349999999999998 31.374999999999996 4 25.724999999999998 27.375 21.95 24.95 5 26.875 32.25 22.75 18.125 6 21.025 32.675 24.95 21.349999999999998 7 16.05 23.25 42.5 18.2 8 18.65 23.25 30.9 27.200000000000003 9 20.125 20.05 34.125 25.7 10-14 21.91 26.88 26.229999999999997 24.98 15-19 21.865000000000002 26.245 26.705000000000002 25.185000000000002 20-24 22.634999999999998 26.075 26.279999999999998 25.009999999999998 25-29 22.759999999999998 26.090000000000003 25.900000000000002 25.25 30-34 21.955 26.0 26.945000000000004 25.1 35-39 23.0 25.995 26.43 24.575 40-44 21.975 26.009999999999998 26.88 25.135 45-49 22.64 25.285000000000004 27.1 24.975 50-54 22.34 24.955 26.979999999999997 25.724999999999998 55-59 22.689999999999998 25.5 26.5 25.31 60-64 22.455 25.919999999999998 26.045 25.580000000000002 65-69 22.655 26.55 26.36 24.435000000000002 70-74 22.27 26.515 26.290000000000003 24.925 75-79 22.49 25.835 26.185000000000002 25.490000000000002 80-84 22.63 26.169999999999998 25.835 25.365 85-89 23.16 25.645 26.029999999999998 25.165 90-94 23.21 25.480000000000004 26.095000000000002 25.215 95-99 22.865 25.779999999999998 25.900000000000002 25.455 100-104 22.735 26.245 26.119999999999997 24.9 105-109 22.84 25.85 25.97 25.34 110-114 22.634999999999998 25.545 26.43 25.39 115-119 23.525 25.665 25.56 25.25 120-124 23.66 25.674999999999997 25.369999999999997 25.295 125-129 23.435 25.929999999999996 25.69 24.945 130-134 24.044999999999998 26.174999999999997 24.58 25.2 135-139 23.494999999999997 26.0 25.455 25.05 140-144 23.07 25.995 24.62 26.314999999999998 145-149 23.755000000000003 26.0 25.55 24.695 150 21.825 25.724999999999998 24.0 28.449999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 8.0 2 4.5 3 4.5 4 4.0 5 3.5 6 3.5 7 2.5 8 2.0 9 1.5 10 1.0 11 0.5 12 1.5 13 2.5 14 1.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 1.5 26 2.0 27 4.5 28 5.5 29 7.0 30 12.5 31 15.5 32 17.0 33 26.5 34 38.5 35 52.5 36 65.5 37 71.5 38 91.0 39 119.5 40 142.0 41 154.0 42 164.5 43 182.5 44 188.5 45 180.0 46 183.0 47 208.5 48 199.5 49 176.5 50 158.0 51 138.0 52 135.5 53 115.5 54 92.0 55 92.0 56 100.0 57 92.0 58 76.0 59 79.5 60 79.5 61 66.0 62 60.5 63 59.0 64 56.5 65 51.5 66 43.5 67 34.5 68 32.0 69 23.5 70 17.0 71 13.5 72 7.0 73 5.0 74 5.0 75 3.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54884685151593 95.075 2 1.1920186576833378 2.3 3 0.15548069448043533 0.44999999999999996 4 0.051826898160145116 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025913449080072558 0.5 >50 0.025913449080072558 1.4749999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC 59 1.4749999999999999 TruSeq Adapter, Index 1 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 20 0.5 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.0375 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATAA 10 0.0069754543 143.9875 5 >>END_MODULE SRR8096895 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096895_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.462 33.0 32.0 34.0 27.0 34.0 2 31.61075 33.0 32.0 34.0 28.0 34.0 3 31.5065 33.0 33.0 34.0 28.0 34.0 4 31.35575 33.0 33.0 34.0 28.0 34.0 5 31.47925 33.0 33.0 34.0 28.0 34.0 6 35.33075 38.0 37.0 38.0 29.0 38.0 7 35.363 38.0 37.0 38.0 29.0 38.0 8 35.41875 38.0 37.0 38.0 29.0 38.0 9 35.519 38.0 37.0 38.0 29.0 38.0 10-14 35.425399999999996 38.0 37.4 38.0 29.4 38.0 15-19 35.1644 38.0 37.0 38.0 28.2 38.0 20-24 35.178749999999994 38.0 37.0 38.0 28.2 38.0 25-29 35.05145 38.0 37.0 38.0 28.0 38.0 30-34 34.7769 38.0 36.8 38.0 26.2 38.0 35-39 34.63435 38.0 36.4 38.0 26.2 38.0 40-44 34.554950000000005 38.0 36.2 38.0 26.2 38.0 45-49 34.384550000000004 38.0 36.0 38.0 25.6 38.0 50-54 34.1237 38.0 35.4 38.0 22.8 38.0 55-59 34.0082 38.0 35.2 38.0 19.4 38.0 60-64 33.947950000000006 38.0 35.2 38.0 19.2 38.0 65-69 33.76795 38.0 35.0 38.0 16.0 38.0 70-74 33.2852 38.0 34.2 38.0 16.0 38.0 75-79 32.9556 38.0 34.0 38.0 15.2 38.0 80-84 32.63125 38.0 33.6 38.0 15.0 38.0 85-89 32.22765 38.0 32.4 38.0 15.0 38.0 90-94 32.08345 37.8 32.0 38.0 15.0 38.0 95-99 31.409 37.2 29.8 38.0 14.2 38.0 100-104 31.123450000000002 37.0 29.0 38.0 13.8 38.0 105-109 30.6058 36.2 27.4 38.0 13.0 38.0 110-114 29.952199999999998 36.0 25.4 38.0 13.0 38.0 115-119 29.4664 35.6 24.2 38.0 8.6 38.0 120-124 28.6903 35.0 22.2 38.0 2.0 38.0 125-129 27.7599 34.4 16.2 38.0 2.0 38.0 130-134 26.79275 33.8 14.6 38.0 2.0 38.0 135-139 25.311950000000003 32.2 13.4 38.0 2.0 38.0 140-144 23.9193 31.8 8.6 37.8 2.0 38.0 145-149 20.975950000000005 28.2 2.0 36.0 2.0 38.0 150 14.72925 2.0 2.0 31.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 73.0 3 9.0 4 9.0 5 6.0 6 11.0 7 12.0 8 14.0 9 9.0 10 9.0 11 11.0 12 11.0 13 11.0 14 20.0 15 16.0 16 24.0 17 28.0 18 33.0 19 22.0 20 31.0 21 31.0 22 44.0 23 40.0 24 53.0 25 74.0 26 77.0 27 87.0 28 99.0 29 110.0 30 159.0 31 205.0 32 227.0 33 300.0 34 395.0 35 568.0 36 697.0 37 475.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.89028370574943 21.79261862917399 8.43585237258348 30.881245292493098 2 27.075447893010345 24.40070653545294 31.4408276558163 17.083017915720415 3 21.711688967432465 24.05958091391063 30.421610704367584 23.80711941428932 4 25.09467306235799 32.012118151981824 18.83362787174956 24.05958091391063 5 28.694114675423087 34.47840363728214 19.095731245263956 17.731750442030815 6 24.564943253467845 34.880201765447666 19.26860025220681 21.28625472887768 7 22.73185483870968 19.329637096774192 35.408266129032256 22.530241935483872 8 21.6338880484115 24.256177508825015 25.365607665153806 28.74432677760968 9 24.571572580645164 21.244959677419356 27.192540322580644 26.990927419354836 10-14 26.482452601855588 26.17991125453812 22.902379991932232 24.43525615167406 15-19 25.84110970996217 25.41235813366961 24.27238335435057 24.474148802017652 20-24 26.367807977409107 26.18123140537542 23.81120467954213 23.63975593767334 25-29 25.79783211494832 26.48853037559869 23.89210990673053 23.821527602722462 30-34 25.810191018597855 25.699309510609343 24.036086890781718 24.45441258001109 35-39 25.582215949188424 25.859461639278152 24.52364149611856 24.03468091541486 40-44 26.906213778158545 24.8047170286751 24.109257672730937 24.17981152043542 45-49 26.450279723804243 24.75681669270702 24.378811551837103 24.41409203165163 50-54 25.975794251134644 25.481593545133634 24.896621280887544 23.645990922844177 55-59 25.6137520794475 25.694409436910824 24.766849826082574 23.92498865755911 60-64 25.010080645161292 26.149193548387096 24.768145161290324 24.07258064516129 65-69 25.434837408621124 26.433072851020924 24.734055961683893 23.39803377867406 70-74 25.32264569469651 26.55777374470659 24.006856221012303 24.11272433958459 75-79 25.209194475249518 26.353463050710758 24.538763988305274 23.898578485734447 80-84 25.39434561306254 26.623998387340624 23.988308219523258 23.993347780073577 85-89 25.56591883035039 25.802873708091756 24.844971010839426 23.786236450718427 90-94 25.371705055188748 26.364598558540397 24.47961292273575 23.784083463535104 95-99 25.999495840685654 25.344088732039328 24.794555079405093 23.861860347869925 100-104 25.681600564430784 26.256110467167264 24.61321372776294 23.44907524063902 105-109 25.424582976364462 27.012044549715263 24.189890641536056 23.373481832384215 110-114 25.78971232807698 26.620988462894857 24.0465514635498 23.542747745478362 115-119 25.821406974400325 26.46643821810119 23.845998790566416 23.86615601693207 120-124 25.042838423546016 27.310754964217317 24.155831065416795 23.490575546819876 125-129 25.505317808357276 27.08805887393518 24.008266545692827 23.39835677201472 130-134 26.014007154733715 26.653902353000454 23.812163047311934 23.519927444953897 135-139 25.58186397984887 26.710327455919398 24.614609571788414 23.093198992443327 140-144 25.73184864211216 27.429838262709726 23.907895399808535 22.930417695369577 145-149 25.417739411378665 27.396637891867332 23.79221565954869 23.39340703720531 150 26.68850806451613 27.016129032258064 23.084677419354836 23.210685483870968 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 21.0 1 15.0 2 4.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.5 14 2.0 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.5 22 3.0 23 3.0 24 2.0 25 1.0 26 0.5 27 4.0 28 5.0 29 5.5 30 10.5 31 13.5 32 14.0 33 13.0 34 20.5 35 35.0 36 52.0 37 64.0 38 86.5 39 103.5 40 115.0 41 136.5 42 149.0 43 161.5 44 158.5 45 167.5 46 177.5 47 167.0 48 179.0 49 185.0 50 168.5 51 153.5 52 131.0 53 114.5 54 113.0 55 103.0 56 94.0 57 95.0 58 98.5 59 114.5 60 111.5 61 88.0 62 72.5 63 75.0 64 77.0 65 58.0 66 47.5 67 46.5 68 44.0 69 37.0 70 24.5 71 17.0 72 14.5 73 12.0 74 9.0 75 5.0 76 2.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.9249999999999999 3 0.975 4 0.975 5 1.0250000000000001 6 0.8750000000000001 7 0.8 8 0.8500000000000001 9 0.8 10-14 0.84 15-19 0.8750000000000001 20-24 0.845 25-29 0.8250000000000001 30-34 0.795 35-39 0.8099999999999999 40-44 0.7849999999999999 45-49 0.795 50-54 0.8500000000000001 55-59 0.815 60-64 0.8 65-69 0.8250000000000001 70-74 0.8200000000000001 75-79 0.8099999999999999 80-84 0.7849999999999999 85-89 0.8250000000000001 90-94 0.795 95-99 0.8250000000000001 100-104 0.7849999999999999 105-109 0.7849999999999999 110-114 0.755 115-119 0.7799999999999999 120-124 0.79 125-129 0.8049999999999999 130-134 0.765 135-139 0.75 140-144 0.765 145-149 0.955 150 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34796076406815 95.25 2 1.3164687661331955 2.55 3 0.15487867836861124 0.44999999999999996 4 0.05162622612287042 0.2 5 0.05162622612287042 0.25 6 0.02581311306143521 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05162622612287042 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 29 0.7250000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit CACCTTTCCTGCTGAGCTGAGCACACCTCTCTGTGAACTTTGGGCCTGAG 5 0.125 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.925 0.0 0.0 0.0 0.0 136-137 2.1 0.0 0.0 0.0 0.0 138 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCTG 10 0.0067269662 145.72151 4 >>END_MODULE Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra Read 1552453 spots for SRR8096895.sra Written 1552453 spots for SRR8096895.sra Read 1552440 spots for SRR8096895.sra Written 1552440 spots for SRR8096895.sra SRR ids: ['SRR8096895.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_whe5bq4k SRR8096895.sra spots: 31048813 blocks: [[1, 1552440], [1552441, 3104880], [3104881, 4657320], [4657321, 6209760], [6209761, 7762200], [7762201, 9314640], [9314641, 10867080], [10867081, 12419520], [12419521, 13971960], [13971961, 15524400], [15524401, 17076840], [17076841, 18629280], [18629281, 20181720], [20181721, 21734160], [21734161, 23286600], [23286601, 24839040], [24839041, 26391480], [26391481, 27943920], [27943921, 29496360], [29496361, 31048813]] SRR8096895 file size 10439081 SRR8096895 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096895 SRR8096895_1.fastq SRR8096895_2.fastq Input file: SRR8096895_1.fastq Paired file: SRR8096895_2.fastq trimmed: SRR8096895-trimmed-pair1.fastq, SRR8096895-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:31:14 2024 >> started Sat Dec 7 15:31:52 2024 >> done (37.859s) 31048813 read pairs processed; of these: 136137 ( 0.44%) short read pairs filtered out after trimming by size control 954922 ( 3.08%) empty read pairs filtered out after trimming by size control 29957754 (96.49%) read pairs available; of these: 15539702 (51.87%) trimmed read pairs available after processing 14418052 (48.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 81 0.00% 19 91 0.00% 20 77 0.00% 21 119 0.00% 22 100 0.00% 23 113 0.00% 24 136 0.00% 25 142 0.00% 26 167 0.00% 27 164 0.00% 28 152 0.00% 29 159 0.00% 30 329 0.00% 31 153 0.00% 32 316 0.00% 33 179 0.00% 34 229 0.00% 35 284 0.00% 36 250 0.00% 37 342 0.00% 38 290 0.00% 39 479 0.00% 40 578 0.00% 41 765 0.00% 42 703 0.00% 43 1232 0.00% 44 914 0.00% 45 1262 0.00% 46 1426 0.00% 47 1424 0.00% 48 1531 0.01% 49 1609 0.01% 50 1601 0.01% 51 1704 0.01% 52 1658 0.01% 53 1889 0.01% 54 1669 0.01% 55 2439 0.01% 56 2300 0.01% 57 1837 0.01% 58 2386 0.01% 59 2631 0.01% 60 2019 0.01% 61 4881 0.02% 62 2535 0.01% 63 1672 0.01% 64 1597 0.01% 65 1717 0.01% 66 1890 0.01% 67 1971 0.01% 68 2265 0.01% 69 3088 0.01% 70 3128 0.01% 71 2681 0.01% 72 2689 0.01% 73 2907 0.01% 74 3056 0.01% 75 3337 0.01% 76 3528 0.01% 77 4079 0.01% 78 4121 0.01% 79 4624 0.02% 80 5272 0.02% 81 5696 0.02% 82 6832 0.02% 83 8998 0.03% 84 17217 0.06% 85 18844 0.06% 86 21684 0.07% 87 24118 0.08% 88 24184 0.08% 89 23903 0.08% 90 23130 0.08% 91 22345 0.07% 92 21948 0.07% 93 21423 0.07% 94 22031 0.07% 95 23221 0.08% 96 25197 0.08% 97 27221 0.09% 98 29249 0.10% 99 30766 0.10% 100 32131 0.11% 101 33736 0.11% 102 35194 0.12% 103 37564 0.13% 104 39145 0.13% 105 41278 0.14% 106 44585 0.15% 107 46336 0.15% 108 48354 0.16% 109 47365 0.16% 110 47851 0.16% 111 48462 0.16% 112 50674 0.17% 113 51845 0.17% 114 53060 0.18% 115 54121 0.18% 116 55772 0.19% 117 57335 0.19% 118 59219 0.20% 119 62356 0.21% 120 64733 0.22% 121 67409 0.23% 122 70312 0.23% 123 73592 0.25% 124 77331 0.26% 125 79503 0.27% 126 83636 0.28% 127 87495 0.29% 128 92060 0.31% 129 97675 0.33% 130 101785 0.34% 131 107233 0.36% 132 114896 0.38% 133 121610 0.41% 134 129952 0.43% 135 139385 0.47% 136 150045 0.50% 137 162881 0.54% 138 173368 0.58% 139 188224 0.63% 140 207419 0.69% 141 231878 0.77% 142 258825 0.86% 143 298351 1.00% 144 356325 1.19% 145 444754 1.48% 146 589299 1.97% 147 843819 2.82% 148 1616499 5.40% 149 7066051 23.59% 150 14418052 48.13% 29957754 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=33 prefix-density=1.00 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=36.03 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.1 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=20 prefix-density=0.90 prefix-fanout=2.6 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=51.57 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8096895 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:32:37 Started mapping on | Dec 07 15:32:37 Finished on | Dec 07 15:38:10 Mapping speed, Million of reads per hour | 323.87 Number of input reads | 29957754 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 28126491 Uniquely mapped reads % | 93.89% Average mapped length | 291.22 Number of splices: Total | 29123677 Number of splices: Annotated (sjdb) | 27520620 Number of splices: GT/AG | 28734874 Number of splices: GC/AG | 337291 Number of splices: AT/AC | 9159 Number of splices: Non-canonical | 42353 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384499 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 11428 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.49% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1626051 1626051 1626051 N_multimapping 384499 384499 384499 N_noFeature 1032393 27217373 1244655 N_ambiguous 817010 3327 122877 UnstrandedReadsAssigned:26277088 PositiveStrandReadsAssigned:905791 NegativeStrandReadsAssigned:26758959 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096895 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096895-trimmed-pair1.fastq SRR8096895-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,957,754 reads, 26,813,925 reads pseudoaligned [quant] estimated average fragment length: 283.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR8096895.ke.tsv 35125 SRR8096895.se.tsv 88098 total ==> SRR8096895.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.373 0 0 PNS24247 1044 761.829 75.6245 4.98742 PNS24249 1928 1645.83 22.153 0.676267 PNS24246 1044 761.829 75.6245 4.98742 PNS24248 1044 761.829 75.6245 4.98742 PNS24244 1471 1188.83 276.974 11.7055 PNS24243 293 78.9933 0 0 KQK14069 1603 1320.83 7706.96 293.162 KQK14071 474 214.017 126.849 29.7789 ==> SRR8096895.se.tsv <== BRADI_1g14170v3 8985 BRADI_1g53295v3 79 BRADI_1g59795v3 1246 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 255 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 418 BRADI_1g48960v3 1 SRR8096895 completed mapping pipeline successfully