Starting /dee2/code/volunteer_pipeline.sh SRR8096896 current disk space = 1542402859008 free memory = 1593951744 SRR8096896 SRAfilesize b5d5920926e660cdff722d1dce469c65 SRR8096896.sra SRR8096896.sra file validated SRR8096896 is paired end SRR8096896 is conventional basespace SRR8096896 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.985 34.0 33.0 34.0 32.0 34.0 2 33.17375 34.0 33.0 34.0 32.0 34.0 3 33.16275 34.0 33.0 34.0 31.0 34.0 4 33.369 34.0 33.0 34.0 33.0 34.0 5 33.38025 34.0 33.0 34.0 33.0 34.0 6 36.8255 38.0 37.0 38.0 35.0 38.0 7 37.20475 38.0 38.0 38.0 36.0 38.0 8 37.24725 38.0 38.0 38.0 36.0 38.0 9 37.3675 38.0 38.0 38.0 37.0 38.0 10-14 37.378499999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.4249 38.0 38.0 38.0 37.0 38.0 20-24 37.324799999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.265550000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.1041 38.0 38.0 38.0 36.8 38.0 35-39 36.99475 38.0 38.0 38.0 36.4 38.0 40-44 36.7739 38.0 38.0 38.0 35.4 38.0 45-49 36.885949999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.88175 38.0 38.0 38.0 36.0 38.0 55-59 36.7838 38.0 38.0 38.0 35.8 38.0 60-64 36.5845 38.0 38.0 38.0 34.8 38.0 65-69 36.17355 38.0 38.0 38.0 33.6 38.0 70-74 35.905899999999995 38.0 38.0 38.0 32.8 38.0 75-79 34.5227 38.0 38.0 38.0 26.2 38.0 80-84 34.503049999999995 38.0 38.0 38.0 26.4 38.0 85-89 34.40245 38.0 38.0 38.0 25.8 38.0 90-94 33.594100000000005 38.0 35.6 38.0 22.2 38.0 95-99 34.23414999999999 38.0 37.6 38.0 24.6 38.0 100-104 33.90125 38.0 37.0 38.0 15.0 38.0 105-109 33.675700000000006 38.0 37.0 38.0 15.0 38.0 110-114 32.8516 38.0 34.4 38.0 14.4 38.0 115-119 33.52135 38.0 36.0 38.0 14.6 38.0 120-124 33.534800000000004 38.0 36.4 38.0 14.4 38.0 125-129 33.265150000000006 38.0 36.0 38.0 13.4 38.0 130-134 33.04735000000001 38.0 35.8 38.0 13.0 38.0 135-139 32.7075 38.0 35.2 38.0 2.0 38.0 140-144 32.47905 38.0 34.8 38.0 2.0 38.0 145-149 32.149800000000006 38.0 35.0 38.0 2.0 38.0 150 28.612 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 5.0 8 4.0 9 2.0 10 4.0 11 4.0 12 7.0 13 8.0 14 8.0 15 13.0 16 13.0 17 17.0 18 61.0 19 123.0 20 11.0 21 12.0 22 23.0 23 19.0 24 22.0 25 10.0 26 20.0 27 27.0 28 30.0 29 40.0 30 34.0 31 61.0 32 53.0 33 82.0 34 116.0 35 171.0 36 448.0 37 2550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.35914203505101 12.869474234894064 9.730578080041852 28.040805650013077 2 24.725 20.075000000000003 32.175 23.025000000000002 3 21.475 19.55 30.45 28.525 4 27.35 23.775 21.275 27.6 5 30.575000000000003 28.499999999999996 23.125 17.8 6 27.0 29.2 22.625 21.175 7 18.425 26.224999999999998 36.975 18.375 8 18.65 26.5 28.325 26.525 9 26.325 19.275000000000002 30.925000000000004 23.474999999999998 10-14 23.57 26.619999999999997 23.805 26.005 15-19 23.56 23.84 26.215 26.384999999999998 20-24 23.035 26.355 25.275 25.335 25-29 22.86 24.224999999999998 25.745 27.169999999999998 30-34 22.81 24.44 26.540000000000003 26.21 35-39 24.825 24.04 26.265 24.87 40-44 22.650000000000002 24.165 26.415 26.77 45-49 24.895 24.02 27.175 23.91 50-54 23.665 22.685 25.290000000000003 28.360000000000003 55-59 23.525 22.685 28.53 25.259999999999998 60-64 24.887488748874887 23.622362236223623 26.45764576457646 25.032503250325032 65-69 22.685370741482966 30.135270541082164 23.356713426853705 23.822645290581164 70-74 22.575 29.630000000000003 23.955000000000002 23.84 75-79 23.465 27.555000000000003 24.05 24.93 80-84 23.919999999999998 25.35 25.235000000000003 25.495 85-89 24.595 25.290000000000003 24.490000000000002 25.624999999999996 90-94 24.169999999999998 24.09 25.369999999999997 26.369999999999997 95-99 23.724999999999998 24.23 25.935000000000002 26.11 100-104 23.91 26.56 24.115000000000002 25.415 105-109 23.41 26.884999999999998 24.745 24.959999999999997 110-114 23.68 26.57 24.025 25.724999999999998 115-119 23.96 26.400000000000002 24.16 25.480000000000004 120-124 24.099999999999998 26.055 23.94 25.905 125-129 23.62 27.315 23.52 25.545 130-134 24.235 27.42 23.255 25.09 135-139 24.415 27.07 22.900000000000002 25.615 140-144 24.265 26.625 23.235 25.874999999999996 145-149 24.395 26.275 23.275000000000002 26.055 150 24.474999999999998 27.150000000000002 22.05 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 24.0 1 17.0 2 6.0 3 4.0 4 7.0 5 5.5 6 2.5 7 2.5 8 1.5 9 1.0 10 3.0 11 3.0 12 1.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 2.0 27 3.0 28 3.5 29 5.5 30 7.0 31 8.0 32 13.0 33 21.0 34 28.5 35 41.0 36 50.0 37 64.0 38 89.0 39 104.5 40 120.0 41 139.5 42 151.0 43 163.5 44 182.0 45 175.5 46 168.5 47 181.5 48 164.5 49 136.5 50 142.5 51 126.5 52 105.0 53 103.0 54 89.5 55 86.0 56 95.5 57 94.5 58 92.5 59 108.5 60 107.0 61 98.0 62 84.5 63 66.5 64 64.0 65 69.5 66 68.5 67 64.0 68 55.0 69 41.0 70 38.5 71 34.0 72 22.5 73 15.5 74 12.5 75 7.0 76 4.5 77 3.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.2 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.80250347705146 87.9 2 1.9193324061196104 3.45 3 0.11126564673157163 0.3 4 0.027816411682892908 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.11126564673157163 2.475 >50 0.0 0.0 >100 0.027816411682892908 5.775 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 231 5.775 TruSeq Adapter, Index 3 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 35 0.8750000000000001 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATG 35 0.8750000000000001 TruSeq Adapter, Index 3 (100% over 49bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC 18 0.44999999999999996 TruSeq Adapter, Index 3 (100% over 50bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 3 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.875 0.0 0.0 0.0 0.0 2 0.875 0.0 0.0 0.0 0.0 3 0.875 0.0 0.0 0.0 0.0 4 0.875 0.0 0.0 0.0 0.0 5 0.875 0.0 0.0 0.0 0.0 6 0.875 0.0 0.0 0.0 0.0 7 0.875 0.0 0.0 0.0 0.0 8 0.875 0.0 0.0 0.0 0.0 9 0.875 0.0 0.0 0.0 0.0 10-11 0.875 0.0 0.0 0.0 0.0 12-13 0.875 0.0 0.0 0.0 0.0 14-15 0.875 0.0 0.0 0.0 0.0 16-17 0.875 0.0 0.0 0.0 0.0 18-19 0.9 0.0 0.0 0.0 0.0 20-21 0.9 0.0 0.0 0.0 0.0 22-23 0.9 0.0 0.0 0.0 0.0 24-25 0.9 0.0 0.0 0.0 0.0 26-27 0.9 0.0 0.0 0.0 0.0 28-29 0.9 0.0 0.0 0.0 0.0 30-31 0.9 0.0 0.0 0.0 0.0 32-33 0.9 0.0 0.0 0.0 0.0 34-35 0.9 0.0 0.0 0.0 0.0 36-37 0.9 0.0 0.0 0.0 0.0 38-39 0.9 0.0 0.0 0.0 0.0 40-41 0.9 0.0 0.0 0.0 0.0 42-43 0.9 0.0 0.0 0.0 0.0 44-45 0.9 0.0 0.0 0.0 0.0 46-47 0.9 0.0 0.0 0.0 0.0 48-49 0.9 0.0 0.0 0.0 0.0 50-51 0.9 0.0 0.0 0.0 0.0 52-53 0.9 0.0 0.0 0.0 0.0 54-55 0.9 0.0 0.0 0.0 0.0 56-57 0.9 0.0 0.0 0.0 0.0 58-59 0.9125000000000001 0.0 0.0 0.0 0.0 60-61 0.95 0.0 0.0 0.0 0.0 62-63 0.95 0.0 0.0 0.0 0.0 64-65 0.95 0.0 0.0 0.0 0.0 66-67 0.95 0.0 0.0 0.0 0.0 68-69 0.95 0.0 0.0 0.0 0.0 70-71 0.95 0.0 0.0 0.0 0.0 72-73 0.95 0.0 0.0 0.0 0.0 74-75 0.95 0.0 0.0 0.0 0.0 76-77 0.95 0.0 0.0 0.0 0.0 78-79 0.975 0.0 0.0 0.0 0.0 80-81 0.975 0.0 0.0 0.0 0.0 82-83 0.975 0.0 0.0 0.0 0.0 84-85 0.9875 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.2874999999999996 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.575 0.0 0.0 0.0 0.0 132-133 3.8 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.575 0.0 0.0 0.0 0.0 138 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 35 1.6061495E-7 109.66667 1 TCGGAAG 40 5.2976793E-7 89.96094 3 ATCGGAA 40 5.2976793E-7 89.96094 2 AAGAGCA 50 1.9987729E-6 71.96876 7 GAGCACA 50 1.9987729E-6 71.96876 9 CGGAAGA 50 1.9987729E-6 71.96876 4 AGAGCAC 50 1.9987729E-6 71.96876 8 GGAAGAG 50 1.9987729E-6 71.96876 5 GAAGAGC 55 3.5215035E-6 65.42614 6 CATCTCG 40 3.109416E-4 21.590624 35-39 TCTCGTA 40 3.109416E-4 21.590624 40-44 AGGCATC 40 3.109416E-4 21.590624 35-39 GCATCTC 40 3.109416E-4 21.590624 35-39 TTGAAAA 35 0.0036906316 20.562502 60-64 GTCACTT 45 6.8837026E-4 19.191668 25-29 GGCATCT 45 6.8837026E-4 19.191668 35-39 ATGCCGT 45 6.8837026E-4 19.191668 45-49 GCCGTCT 45 6.8837026E-4 19.191668 45-49 CTCCAGT 40 0.007986708 17.992188 20-24 TGCTTGA 40 0.007986708 17.992188 55-59 >>END_MODULE SRR8096896 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096896_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0265 33.0 33.0 34.0 30.0 34.0 2 32.176 33.0 33.0 34.0 30.0 34.0 3 31.77175 33.0 33.0 34.0 27.0 34.0 4 31.9435 33.0 33.0 34.0 30.0 34.0 5 32.03575 33.0 33.0 34.0 31.0 34.0 6 35.9905 38.0 38.0 38.0 31.0 38.0 7 36.08425 38.0 38.0 38.0 33.0 38.0 8 36.12925 38.0 38.0 38.0 33.0 38.0 9 36.07 38.0 38.0 38.0 33.0 38.0 10-14 35.96755 38.0 38.0 38.0 32.2 38.0 15-19 35.7063 38.0 38.0 38.0 29.8 38.0 20-24 35.89435 38.0 38.0 38.0 32.2 38.0 25-29 35.877300000000005 38.0 38.0 38.0 32.2 38.0 30-34 35.7899 38.0 38.0 38.0 31.4 38.0 35-39 35.63245 38.0 38.0 38.0 30.0 38.0 40-44 35.748450000000005 38.0 38.0 38.0 31.4 38.0 45-49 35.57895 38.0 37.8 38.0 29.8 38.0 50-54 35.57405 38.0 37.6 38.0 29.8 38.0 55-59 35.6056 38.0 37.8 38.0 30.2 38.0 60-64 35.66875 38.0 37.6 38.0 31.6 38.0 65-69 34.99594999999999 38.0 37.6 38.0 25.8 38.0 70-74 33.793949999999995 38.0 37.0 38.0 15.6 38.0 75-79 33.6349 38.0 36.8 38.0 15.0 38.0 80-84 33.482 38.0 36.4 38.0 15.0 38.0 85-89 33.41335 38.0 36.0 38.0 15.0 38.0 90-94 33.256800000000005 38.0 36.0 38.0 14.0 38.0 95-99 33.132450000000006 38.0 35.8 38.0 13.4 38.0 100-104 32.9623 38.0 35.0 38.0 13.0 38.0 105-109 32.725049999999996 38.0 35.0 38.0 13.0 38.0 110-114 32.7145 38.0 35.0 38.0 13.0 38.0 115-119 32.46495 38.0 34.8 38.0 13.0 38.0 120-124 32.3362 38.0 34.4 38.0 10.8 38.0 125-129 32.05085 38.0 34.0 38.0 2.0 38.0 130-134 31.9241 38.0 34.0 38.0 2.0 38.0 135-139 31.653550000000003 38.0 33.6 38.0 2.0 38.0 140-144 31.28095 38.0 33.0 38.0 2.0 38.0 145-149 30.30175 38.0 31.6 38.0 2.0 38.0 150 23.62475 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 13.0 4 9.0 5 2.0 6 5.0 7 7.0 8 1.0 9 1.0 10 15.0 11 12.0 12 10.0 13 14.0 14 25.0 15 35.0 16 43.0 17 126.0 18 25.0 19 12.0 20 15.0 21 7.0 22 12.0 23 15.0 24 16.0 25 28.0 26 19.0 27 38.0 28 45.0 29 49.0 30 57.0 31 94.0 32 93.0 33 121.0 34 154.0 35 253.0 36 586.0 37 2022.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.4472236118059 19.93496748374187 9.579789894947474 26.038019009504755 2 28.16408204102051 26.96348174087044 25.887943971985994 18.98449224612306 3 22.736368184092047 23.56178089044522 31.165582791395696 22.536268134067033 4 26.54490868151113 26.720040030022517 18.43882912184138 28.29622216662497 5 32.491245622811405 29.139569784892444 17.483741870935468 20.885442721360683 6 28.139069534767387 31.190595297648827 18.234117058529264 22.436218109054526 7 22.611305652826413 21.83591795897949 32.96648324162081 22.586293146573286 8 21.785892946473236 26.713356678339167 22.861430715357677 28.639319659829916 9 29.464732366183092 20.485242621310658 22.586293146573286 27.463731865932967 10-14 27.889522665866107 24.497148003602522 21.319923946762735 26.293405383768636 15-19 27.49161535766131 22.666065975872254 23.917505130900533 25.9248135355659 20-24 29.041781336002003 25.369026770077557 21.396047035276457 24.193144858643983 25-29 27.263631815907953 27.093546773386695 21.050525262631314 24.592296148074038 30-34 27.87336200860258 23.947184155246575 24.18225467640292 23.997199159747925 35-39 25.10504201680672 23.159263705482193 24.51480592236895 27.220888355342137 40-44 30.52263065766442 22.495623905976494 22.310577644411104 24.671167791947987 45-49 27.04352176088044 22.061030515257627 22.501250625312657 28.394197098549274 50-54 25.722861430715362 23.791895947973988 24.09704852426213 26.388194097048522 55-59 24.972486243121562 25.63781890945473 24.12206103051526 25.267633816908454 60-64 24.91870528790835 29.321126619640804 21.541848016409023 24.218320076041824 65-69 24.25561727468348 28.899564629935444 21.973677625982084 24.871140469398988 70-74 25.57930033531855 27.170812271658072 22.126019718732795 25.12386767429058 75-79 25.683251576734406 26.389027930723795 21.753929322254482 26.173791170287313 80-84 26.559215136650316 26.073681049154068 22.36460106116728 25.00250275302833 85-89 26.155078340091105 26.465435250538118 22.335686038944786 25.043800370425988 90-94 25.56195244055069 25.30162703379224 23.34918648310388 25.78723404255319 95-99 26.336336336336334 25.5005005005005 22.907907907907905 25.255255255255253 100-104 26.8464771817454 25.545436349079264 22.693154523618894 24.914931945556447 105-109 25.50678212122729 26.412733370038538 22.658791731317883 25.42169277741629 110-114 25.464283926515492 26.885918806627622 22.225559393302298 25.42423787355459 115-119 26.192740926157697 26.33291614518148 22.53316645807259 24.941176470588236 120-124 25.386733416770962 26.29787234042553 23.2540675844806 25.0613266583229 125-129 25.92092092092092 27.26226226226226 22.167167167167168 24.64964964964965 130-134 26.303151575787894 26.853426713356676 22.266133066533268 24.577288644322163 135-139 25.63781890945473 27.41370685342671 22.40120060030015 24.54727363681841 140-144 25.968371534380942 26.919227304574118 23.0307276548894 24.08167350615554 145-149 25.885299273729025 26.98722764838467 22.81993488605059 24.30753819183571 150 26.21310655327664 28.38919459729865 21.210605302651324 24.187093546773387 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 2.0 28 1.5 29 2.5 30 4.5 31 5.5 32 11.0 33 21.5 34 28.5 35 35.5 36 49.0 37 54.0 38 65.0 39 83.0 40 94.5 41 112.5 42 122.0 43 140.0 44 138.5 45 143.5 46 161.5 47 159.5 48 159.5 49 144.5 50 132.0 51 121.0 52 115.5 53 98.5 54 87.5 55 102.5 56 101.5 57 99.5 58 118.5 59 123.5 60 123.0 61 125.5 62 113.5 63 102.0 64 98.5 65 101.0 66 83.5 67 71.0 68 72.0 69 64.5 70 58.0 71 45.5 72 33.5 73 24.5 74 14.0 75 8.5 76 6.0 77 3.5 78 1.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.075 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.06999999999999999 15-19 0.11499999999999999 20-24 0.075 25-29 0.05 30-34 0.03 35-39 0.04 40-44 0.025 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.055 65-69 0.08499999999999999 70-74 0.095 75-79 0.11 80-84 0.11 85-89 0.11499999999999999 90-94 0.125 95-99 0.1 100-104 0.08 105-109 0.105 110-114 0.11499999999999999 115-119 0.125 120-124 0.125 125-129 0.1 130-134 0.05 135-139 0.05 140-144 0.09 145-149 0.17500000000000002 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 97.90419161676647 89.925 2 1.6875340228633642 3.1 3 0.24496461622210125 0.675 4 0.05443658138268917 0.2 5 0.027218290691344585 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05443658138268917 0.9249999999999999 >50 0.0 0.0 >100 0.027218290691344585 5.050000000000001 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 202 5.050000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 27 0.675 Illumina Single End PCR Primer 1 (100% over 50bp) CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 10 0.25 No Hit GGCAACTCTCCCGGGTACTACGACGGCAGGTACTGGACAATGTGGAAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.8 0.0 0.0 0.0 0.0 2 0.8 0.0 0.0 0.0 0.0 3 0.8 0.0 0.0 0.0 0.0 4 0.8 0.0 0.0 0.0 0.0 5 0.8 0.0 0.0 0.0 0.0 6 0.8 0.0 0.0 0.0 0.0 7 0.8 0.0 0.0 0.0 0.0 8 0.8 0.0 0.0 0.0 0.0 9 0.8 0.0 0.0 0.0 0.0 10-11 0.8 0.0 0.0 0.0 0.0 12-13 0.8 0.0 0.0 0.0 0.0 14-15 0.8 0.0 0.0 0.0 0.0 16-17 0.8 0.0 0.0 0.0 0.0 18-19 0.825 0.0 0.0 0.0 0.0 20-21 0.825 0.0 0.0 0.0 0.0 22-23 0.825 0.0 0.0 0.0 0.0 24-25 0.825 0.0 0.0 0.0 0.0 26-27 0.825 0.0 0.0 0.0 0.0 28-29 0.825 0.0 0.0 0.0 0.0 30-31 0.825 0.0 0.0 0.0 0.0 32-33 0.825 0.0 0.0 0.0 0.0 34-35 0.825 0.0 0.0 0.0 0.0 36-37 0.825 0.0 0.0 0.0 0.0 38-39 0.825 0.0 0.0 0.0 0.0 40-41 0.825 0.0 0.0 0.0 0.0 42-43 0.825 0.0 0.0 0.0 0.0 44-45 0.825 0.0 0.0 0.0 0.0 46-47 0.825 0.0 0.0 0.0 0.0 48-49 0.825 0.0 0.0 0.0 0.0 50-51 0.825 0.0 0.0 0.0 0.0 52-53 0.825 0.0 0.0 0.0 0.0 54-55 0.825 0.0 0.0 0.0 0.0 56-57 0.825 0.0 0.0 0.0 0.0 58-59 0.8374999999999999 0.0 0.0 0.0 0.0 60-61 0.85 0.0 0.0 0.0 0.0 62-63 0.8625 0.0 0.0 0.0 0.0 64-65 0.875 0.0 0.0 0.0 0.0 66-67 0.875 0.0 0.0 0.0 0.0 68-69 0.875 0.0 0.0 0.0 0.0 70-71 0.875 0.0 0.0 0.0 0.0 72-73 0.875 0.0 0.0 0.0 0.0 74-75 0.875 0.0 0.0 0.0 0.0 76-77 0.875 0.0 0.0 0.0 0.0 78-79 0.9 0.0 0.0 0.0 0.0 80-81 0.925 0.0 0.0 0.0 0.0 82-83 0.925 0.0 0.0 0.0 0.0 84-85 0.9375 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.05 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.025 106-107 1.5 0.0 0.0 0.0 0.025 108-109 1.5625 0.0 0.0 0.0 0.025 110-111 1.7 0.0 0.0 0.0 0.025 112-113 1.8624999999999998 0.0 0.0 0.0 0.025 114-115 2.0125 0.0 0.0 0.0 0.025 116-117 2.125 0.0 0.0 0.0 0.025 118-119 2.2875 0.0 0.0 0.0 0.025 120-121 2.375 0.0 0.0 0.0 0.025 122-123 2.5125 0.0 0.0 0.0 0.025 124-125 2.675 0.0 0.0 0.0 0.025 126-127 2.9 0.0 0.0 0.0 0.025 128-129 3.1625 0.0 0.0 0.0 0.025 130-131 3.4000000000000004 0.0 0.0 0.0 0.025 132-133 3.625 0.0 0.0 0.0 0.025 134-135 3.9875 0.0 0.0 0.0 0.025 136-137 4.3375 0.0 0.0 0.0 0.025 138 4.625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATTT 10 0.006973645 144.0 5 GTTTTCG 10 0.006973645 144.0 1 TACCCCG 10 0.006973645 144.0 8 GATCGGA 35 2.3845314E-7 102.85714 1 GAGCGTC 30 1.46121765E-5 96.0 9 TCGGAAG 40 5.2840005E-7 90.0 3 CGGAAGA 40 5.2840005E-7 90.0 4 ATCGGAA 40 5.2840005E-7 90.0 2 AGAGCGT 35 3.1411873E-5 82.28571 8 GGAAGAG 55 3.5124358E-6 65.454544 5 AAGAGCG 45 1.0917089E-4 64.0 7 GAAGAGC 45 1.0917089E-4 64.0 6 GTAGATC 20 0.006139246 28.8 30-34 TGGTCGC 20 0.006139246 28.8 40-44 ATCTCGG 20 0.006139246 28.8 35-39 GTCGCCG 20 0.006139246 28.8 40-44 GTGTAGA 20 0.006139246 28.8 25-29 TCGGTGG 25 5.183459E-4 28.8 35-39 AAGAGTG 20 0.006139246 28.8 25-29 GTATCAT 20 0.006139246 28.8 50-54 >>END_MODULE Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696227 spots for SRR8096896.sra Written 1696227 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra Read 1696215 spots for SRR8096896.sra Written 1696215 spots for SRR8096896.sra SRR ids: ['SRR8096896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cs0sicnc SRR8096896.sra spots: 33924312 blocks: [[1, 1696215], [1696216, 3392430], [3392431, 5088645], [5088646, 6784860], [6784861, 8481075], [8481076, 10177290], [10177291, 11873505], [11873506, 13569720], [13569721, 15265935], [15265936, 16962150], [16962151, 18658365], [18658366, 20354580], [20354581, 22050795], [22050796, 23747010], [23747011, 25443225], [25443226, 27139440], [27139441, 28835655], [28835656, 30531870], [30531871, 32228085], [32228086, 33924312]] SRR8096896 file size 11407877 SRR8096896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096896 SRR8096896_1.fastq SRR8096896_2.fastq Input file: SRR8096896_1.fastq Paired file: SRR8096896_2.fastq trimmed: SRR8096896-trimmed-pair1.fastq, SRR8096896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:33:18 2024 >> started Sat Dec 7 15:33:54 2024 >> done (35.866s) 33924312 read pairs processed; of these: 96705 ( 0.29%) short read pairs filtered out after trimming by size control 2620091 ( 7.72%) empty read pairs filtered out after trimming by size control 31207516 (91.99%) read pairs available; of these: 10727503 (34.37%) trimmed read pairs available after processing 20480013 (65.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 213 0.00% 19 219 0.00% 20 112 0.00% 21 154 0.00% 22 215 0.00% 23 297 0.00% 24 262 0.00% 25 148 0.00% 26 124 0.00% 27 184 0.00% 28 134 0.00% 29 130 0.00% 30 131 0.00% 31 155 0.00% 32 139 0.00% 33 148 0.00% 34 171 0.00% 35 197 0.00% 36 192 0.00% 37 220 0.00% 38 257 0.00% 39 308 0.00% 40 354 0.00% 41 458 0.00% 42 459 0.00% 43 568 0.00% 44 810 0.00% 45 2299 0.01% 46 1851 0.01% 47 1785 0.01% 48 1729 0.01% 49 1657 0.01% 50 1699 0.01% 51 1941 0.01% 52 2061 0.01% 53 2169 0.01% 54 2230 0.01% 55 2444 0.01% 56 3605 0.01% 57 4283 0.01% 58 10028 0.03% 59 5927 0.02% 60 6521 0.02% 61 18901 0.06% 62 20184 0.06% 63 3174 0.01% 64 2231 0.01% 65 2593 0.01% 66 2663 0.01% 67 3186 0.01% 68 3854 0.01% 69 10268 0.03% 70 8674 0.03% 71 4256 0.01% 72 3297 0.01% 73 3228 0.01% 74 2994 0.01% 75 3292 0.01% 76 3540 0.01% 77 3721 0.01% 78 3938 0.01% 79 4130 0.01% 80 4567 0.01% 81 5129 0.02% 82 5717 0.02% 83 6808 0.02% 84 11921 0.04% 85 13782 0.04% 86 19038 0.06% 87 22061 0.07% 88 20995 0.07% 89 20790 0.07% 90 19307 0.06% 91 17644 0.06% 92 16368 0.05% 93 15707 0.05% 94 16417 0.05% 95 17208 0.06% 96 19873 0.06% 97 23085 0.07% 98 23481 0.08% 99 23927 0.08% 100 25614 0.08% 101 28018 0.09% 102 29844 0.10% 103 32599 0.10% 104 35171 0.11% 105 37158 0.12% 106 39019 0.13% 107 40804 0.13% 108 40926 0.13% 109 40873 0.13% 110 41317 0.13% 111 41799 0.13% 112 41308 0.13% 113 41476 0.13% 114 42218 0.14% 115 43226 0.14% 116 43784 0.14% 117 45388 0.15% 118 45596 0.15% 119 46953 0.15% 120 48446 0.16% 121 48861 0.16% 122 50152 0.16% 123 51387 0.16% 124 53330 0.17% 125 55170 0.18% 126 57012 0.18% 127 59011 0.19% 128 61150 0.20% 129 63698 0.20% 130 66255 0.21% 131 68773 0.22% 132 72016 0.23% 133 74394 0.24% 134 78655 0.25% 135 83083 0.27% 136 86889 0.28% 137 91394 0.29% 138 97963 0.31% 139 104187 0.33% 140 113112 0.36% 141 122483 0.39% 142 136005 0.44% 143 153522 0.49% 144 181230 0.58% 145 222079 0.71% 146 288503 0.92% 147 444419 1.42% 148 831072 2.66% 149 5589224 17.91% 150 20480013 65.63% 31207516 reads passed initial QC criterion=sequence-density sequence-density=2.40 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=10 prefix-density=2.42 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.41 sequence-density-rank=19 fanout-score=12.38 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.92 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=11 prefix-density=2.09 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=20.95 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.3 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -y GAGTTCAGCAAGGTCGG -o SRR8096896 SRR8096896_1.fastq SRR8096896_2.fastq Input file: SRR8096896_1.fastq Paired file: SRR8096896_2.fastq trimmed: SRR8096896-trimmed-pair1.fastq, SRR8096896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -- paired 3' end adapter sequence (-y): GAGTTCAGCAAGGTCGG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:36:23 2024 >> started Sat Dec 7 15:36:33 2024 >> done (10.065s) 10402505 read pairs processed; of these: 1116 ( 0.01%) short read pairs filtered out after trimming by size control 5630 ( 0.05%) empty read pairs filtered out after trimming by size control 10395759 (99.94%) read pairs available; of these: 1034 ( 0.01%) trimmed read pairs available after processing 10394725 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 67 0.00% 19 69 0.00% 20 41 0.00% 21 58 0.00% 22 78 0.00% 23 103 0.00% 24 98 0.00% 25 55 0.00% 26 37 0.00% 27 64 0.00% 28 49 0.00% 29 41 0.00% 30 51 0.00% 31 55 0.00% 32 50 0.00% 33 50 0.00% 34 64 0.00% 35 60 0.00% 36 60 0.00% 37 75 0.00% 38 99 0.00% 39 109 0.00% 40 119 0.00% 41 147 0.00% 42 159 0.00% 43 195 0.00% 44 275 0.00% 45 754 0.01% 46 601 0.01% 47 577 0.01% 48 591 0.01% 49 589 0.01% 50 519 0.00% 51 688 0.01% 52 677 0.01% 53 731 0.01% 54 718 0.01% 55 795 0.01% 56 1212 0.01% 57 1425 0.01% 58 3269 0.03% 59 1906 0.02% 60 2162 0.02% 61 6222 0.06% 62 6706 0.06% 63 1096 0.01% 64 719 0.01% 65 879 0.01% 66 895 0.01% 67 1040 0.01% 68 1264 0.01% 69 3444 0.03% 70 2910 0.03% 71 1458 0.01% 72 1071 0.01% 73 1057 0.01% 74 974 0.01% 75 1099 0.01% 76 1200 0.01% 77 1303 0.01% 78 1343 0.01% 79 1415 0.01% 80 1552 0.01% 81 1701 0.02% 82 1956 0.02% 83 2266 0.02% 84 3939 0.04% 85 4650 0.04% 86 6359 0.06% 87 7306 0.07% 88 6977 0.07% 89 6966 0.07% 90 6465 0.06% 91 5831 0.06% 92 5500 0.05% 93 5240 0.05% 94 5467 0.05% 95 5760 0.06% 96 6588 0.06% 97 7711 0.07% 98 7829 0.08% 99 8095 0.08% 100 8726 0.08% 101 9241 0.09% 102 9845 0.09% 103 10970 0.11% 104 11678 0.11% 105 12456 0.12% 106 12851 0.12% 107 13541 0.13% 108 13699 0.13% 109 13575 0.13% 110 13922 0.13% 111 13990 0.13% 112 13903 0.13% 113 13691 0.13% 114 14075 0.14% 115 14398 0.14% 116 14649 0.14% 117 15048 0.14% 118 15075 0.15% 119 15629 0.15% 120 16065 0.15% 121 16190 0.16% 122 16598 0.16% 123 17226 0.17% 124 17751 0.17% 125 18400 0.18% 126 18948 0.18% 127 19549 0.19% 128 20550 0.20% 129 21192 0.20% 130 21970 0.21% 131 22915 0.22% 132 24257 0.23% 133 24869 0.24% 134 26075 0.25% 135 27601 0.27% 136 28882 0.28% 137 30496 0.29% 138 32685 0.31% 139 34604 0.33% 140 37555 0.36% 141 40925 0.39% 142 45277 0.44% 143 51174 0.49% 144 60479 0.58% 145 73933 0.71% 146 95948 0.92% 147 147526 1.42% 148 276947 2.66% 149 1861986 17.91% 150 6822429 65.63% criterion=sequence-density sequence-density=2.36 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=11 prefix-density=2.39 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.41 sequence-density-rank=17 fanout-score=12.17 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.89 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=12 prefix-density=2.05 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=18.65 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR8096896 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:37:42 Started mapping on | Dec 07 15:37:42 Finished on | Dec 07 15:42:08 Mapping speed, Million of reads per hour | 422.27 Number of input reads | 31200770 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 29519457 Uniquely mapped reads % | 94.61% Average mapped length | 293.98 Number of splices: Total | 27589108 Number of splices: Annotated (sjdb) | 26166617 Number of splices: GT/AG | 27226883 Number of splices: GC/AG | 296722 Number of splices: AT/AC | 7059 Number of splices: Non-canonical | 58444 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331728 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 8497 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1478085 1478085 1478085 N_multimapping 331728 331728 331728 N_noFeature 784577 28606180 1000731 N_ambiguous 816953 2922 121840 UnstrandedReadsAssigned:27917927 PositiveStrandReadsAssigned:910355 NegativeStrandReadsAssigned:28396886 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096896 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096896-trimmed-pair1.fastq SRR8096896-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,200,770 reads, 28,275,951 reads pseudoaligned [quant] estimated average fragment length: 270.712 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR8096896.ke.tsv 35125 SRR8096896.se.tsv 88098 total ==> SRR8096896.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.707 0 0 PNS24247 1044 774.288 40.5304 2.33278 PNS24249 1928 1658.29 13.2402 0.355818 PNS24246 1044 774.288 40.5304 2.33278 PNS24248 1044 774.288 40.5304 2.33278 PNS24244 1471 1201.29 191.169 7.09193 PNS24243 293 84.357 0 0 KQK14069 1603 1333.29 634.278 21.2007 KQK14071 474 222.244 31.1896 6.25424 ==> SRR8096896.se.tsv <== BRADI_1g14170v3 826 BRADI_1g53295v3 432 BRADI_1g59795v3 308 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 837 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 272 BRADI_1g48960v3 0 SRR8096896 completed mapping pipeline successfully