Starting /dee2/code/volunteer_pipeline.sh SRR8096897 current disk space = 1542134272000 free memory = 1600798604 SRR8096897 SRAfilesize 65e764d30782df701a25ac6551c8c08c SRR8096897.sra SRR8096897.sra file validated SRR8096897 is paired end SRR8096897 is conventional basespace SRR8096897 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4415 34.0 33.0 34.0 32.0 34.0 2 33.14525 34.0 33.0 34.0 32.0 34.0 3 33.1625 34.0 33.0 34.0 31.0 34.0 4 33.40175 34.0 33.0 34.0 33.0 34.0 5 33.44575 34.0 33.0 34.0 33.0 34.0 6 36.987 38.0 37.0 38.0 36.0 38.0 7 37.311 38.0 38.0 38.0 37.0 38.0 8 37.30525 38.0 38.0 38.0 37.0 38.0 9 37.4345 38.0 38.0 38.0 37.0 38.0 10-14 37.484249999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.518150000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.449549999999995 38.0 38.0 38.0 37.6 38.0 25-29 37.43615 38.0 38.0 38.0 37.8 38.0 30-34 37.4065 38.0 38.0 38.0 37.6 38.0 35-39 37.3268 38.0 38.0 38.0 37.0 38.0 40-44 37.1991 38.0 38.0 38.0 37.0 38.0 45-49 37.219550000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2351 38.0 38.0 38.0 37.0 38.0 55-59 37.22185 38.0 38.0 38.0 37.0 38.0 60-64 37.15065 38.0 38.0 38.0 36.6 38.0 65-69 36.73535 38.0 38.0 38.0 35.4 38.0 70-74 36.7758 38.0 38.0 38.0 35.6 38.0 75-79 36.490500000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.51185 38.0 38.0 38.0 35.0 38.0 85-89 36.436099999999996 38.0 38.0 38.0 35.0 38.0 90-94 35.72239999999999 38.0 37.2 38.0 29.6 38.0 95-99 36.3115 38.0 38.0 38.0 34.8 38.0 100-104 36.1195 38.0 38.0 38.0 34.0 38.0 105-109 35.884699999999995 38.0 38.0 38.0 33.6 38.0 110-114 35.439 38.0 37.4 38.0 31.2 38.0 115-119 35.7915 38.0 38.0 38.0 33.6 38.0 120-124 35.72285 38.0 38.0 38.0 33.0 38.0 125-129 35.4521 38.0 38.0 38.0 32.2 38.0 130-134 35.273 38.0 38.0 38.0 31.8 38.0 135-139 34.99665 38.0 37.4 38.0 30.4 38.0 140-144 34.65685 38.0 36.2 38.0 28.0 38.0 145-149 34.385000000000005 38.0 36.0 38.0 28.2 38.0 150 30.4385 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 3.0 8 1.0 9 0.0 10 2.0 11 1.0 12 0.0 13 2.0 14 1.0 15 0.0 16 5.0 17 10.0 18 9.0 19 28.0 20 4.0 21 7.0 22 7.0 23 16.0 24 14.0 25 19.0 26 8.0 27 23.0 28 24.0 29 42.0 30 42.0 31 55.0 32 50.0 33 69.0 34 96.0 35 145.0 36 445.0 37 2870.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.693333333333335 10.613333333333333 8.426666666666668 42.266666666666666 2 22.45 17.925 36.875 22.75 3 21.9 19.05 27.925 31.125000000000004 4 26.05 26.200000000000003 21.125 26.625 5 28.549999999999997 29.75 23.3 18.4 6 23.175 31.025000000000002 23.75 22.05 7 17.275 24.05 39.550000000000004 19.125 8 20.150000000000002 23.875 28.975 27.0 9 22.7 20.575 31.6 25.124999999999996 10-14 23.185 26.855 24.625 25.335 15-19 23.13 25.06 25.679999999999996 26.13 20-24 22.62 25.56 26.6 25.22 25-29 23.74 25.03 25.885 25.345000000000002 30-34 22.650000000000002 25.564999999999998 25.95 25.835 35-39 23.745 25.235000000000003 25.81 25.21 40-44 23.205000000000002 24.759999999999998 25.929999999999996 26.105 45-49 23.78 25.3 25.755 25.165 50-54 23.095 24.25 25.935000000000002 26.72 55-59 23.275000000000002 24.86 26.229999999999997 25.635 60-64 23.27116355817791 25.246262313115658 25.52127606380319 25.961298064903243 65-69 22.61104983455329 27.11821919181791 24.9323172565928 25.338413717035994 70-74 22.785 27.060000000000002 24.755 25.4 75-79 23.945 25.380000000000003 24.895 25.779999999999998 80-84 23.34 24.55 25.77 26.340000000000003 85-89 24.051202560128008 25.496274813740687 25.161258062903148 25.29126456322816 90-94 23.94218265479644 25.117535260578173 24.802440732219665 26.137841352405722 95-99 23.594437775110045 25.42016806722689 25.140056022408963 25.845338135254103 100-104 24.17620881044052 25.656282814140706 24.64123206160308 25.526276313815693 105-109 23.705000000000002 25.295 25.45 25.55 110-114 23.745 25.39 25.5 25.365 115-119 24.044999999999998 24.845 25.145 25.965 120-124 23.522352235223522 24.577457745774577 25.432543254325434 26.467646764676466 125-129 23.56824888711049 25.633971890161554 25.33386685339869 25.463912369329268 130-134 23.687106131839553 26.678003401020305 24.7074122236671 24.927478243473043 135-139 24.309723889555823 26.250500200080033 23.989595838335333 25.45018007202881 140-144 24.312156078039017 25.90295147573787 24.157078539269637 25.627813906953477 145-149 23.85215564669401 25.692707812343702 24.5223567070121 25.932779833950185 150 23.925 26.174999999999997 24.9 25.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 4.0 2 2.0 3 2.0 4 1.5 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 1.5 27 3.5 28 3.5 29 7.0 30 13.0 31 13.0 32 17.0 33 25.0 34 30.0 35 34.5 36 50.5 37 74.5 38 86.0 39 94.5 40 115.5 41 142.5 42 158.5 43 177.5 44 179.5 45 177.5 46 179.0 47 184.5 48 200.5 49 178.0 50 159.0 51 145.0 52 121.5 53 108.5 54 97.5 55 93.5 56 100.0 57 105.0 58 100.0 59 94.5 60 101.5 61 103.5 62 91.0 63 79.0 64 63.0 65 54.0 66 45.0 67 41.5 68 37.5 69 27.0 70 21.0 71 14.5 72 9.0 73 7.5 74 5.5 75 1.0 76 2.0 77 2.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.27 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.03 95-99 0.04 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.034999999999999996 130-134 0.03 135-139 0.04 140-144 0.05 145-149 0.03 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11073209131462 93.475 2 1.574389923904487 3.0 3 0.18367882445552347 0.525 4 0.05247966413014957 0.2 5 0.026239832065074783 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026239832065074783 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.026239832065074783 2.475 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 99 2.475 TruSeq Adapter, Index 5 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit NATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 5 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.65 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGCTG 10 0.0070063258 143.775 8 ACAACCA 10 0.0070063258 143.775 8 AAAAAAA 85 1.1876378E-5 15.299734 65-69 >>END_MODULE SRR8096897 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096897_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0275 33.0 33.0 34.0 30.0 34.0 2 32.317 33.0 33.0 34.0 31.0 34.0 3 31.9485 33.0 33.0 34.0 28.0 34.0 4 31.9895 33.0 33.0 34.0 30.0 34.0 5 32.01025 33.0 33.0 34.0 30.0 34.0 6 36.10775 38.0 38.0 38.0 33.0 38.0 7 36.05925 38.0 38.0 38.0 33.0 38.0 8 36.25875 38.0 38.0 38.0 33.0 38.0 9 36.221 38.0 38.0 38.0 33.0 38.0 10-14 36.126400000000004 38.0 38.0 38.0 33.2 38.0 15-19 35.966750000000005 38.0 38.0 38.0 32.6 38.0 20-24 36.048249999999996 38.0 38.0 38.0 33.2 38.0 25-29 36.06825 38.0 38.0 38.0 33.2 38.0 30-34 35.91615 38.0 38.0 38.0 32.2 38.0 35-39 35.86275 38.0 38.0 38.0 32.2 38.0 40-44 36.0311 38.0 38.0 38.0 33.2 38.0 45-49 35.8368 38.0 38.0 38.0 32.6 38.0 50-54 35.82145 38.0 38.0 38.0 32.4 38.0 55-59 35.74675 38.0 38.0 38.0 31.8 38.0 60-64 35.7404 38.0 38.0 38.0 31.8 38.0 65-69 35.741249999999994 38.0 38.0 38.0 32.4 38.0 70-74 35.450750000000006 38.0 38.0 38.0 31.6 38.0 75-79 35.32115 38.0 38.0 38.0 31.4 38.0 80-84 35.2672 38.0 37.8 38.0 31.2 38.0 85-89 35.2526 38.0 38.0 38.0 30.8 38.0 90-94 35.087950000000006 38.0 38.0 38.0 30.4 38.0 95-99 34.975049999999996 38.0 37.4 38.0 29.4 38.0 100-104 34.835950000000004 38.0 37.0 38.0 28.6 38.0 105-109 34.6928 38.0 36.8 38.0 27.2 38.0 110-114 34.6115 38.0 36.6 38.0 27.6 38.0 115-119 34.43685 38.0 36.2 38.0 25.8 38.0 120-124 34.23780000000001 38.0 36.0 38.0 23.4 38.0 125-129 34.0589 38.0 35.2 38.0 23.6 38.0 130-134 33.8096 38.0 35.2 38.0 21.8 38.0 135-139 33.572900000000004 38.0 35.0 38.0 18.4 38.0 140-144 33.30865 38.0 35.0 38.0 14.2 38.0 145-149 32.6605 38.0 34.6 38.0 9.0 38.0 150 25.882 34.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 9.0 4 10.0 5 4.0 6 10.0 7 8.0 8 7.0 9 3.0 10 2.0 11 9.0 12 17.0 13 9.0 14 12.0 15 12.0 16 10.0 17 28.0 18 12.0 19 12.0 20 3.0 21 9.0 22 13.0 23 20.0 24 16.0 25 18.0 26 41.0 27 39.0 28 38.0 29 56.0 30 59.0 31 57.0 32 78.0 33 87.0 34 137.0 35 247.0 36 561.0 37 2335.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.16116116116116 14.73973973973974 10.335335335335335 38.76376376376376 2 26.997245179063363 24.94365138993238 29.72702228900576 18.332081141998497 3 23.271543086172343 24.649298597194388 28.2064128256513 23.872745490981963 4 25.93984962406015 28.92230576441103 18.847117794486216 26.29072681704261 5 30.64394888499123 30.593836131295415 19.017790027562015 19.74442495615134 6 23.653219744424955 34.05161613630669 19.669255825607618 22.62590829366074 7 22.419839679358716 18.862725450901806 33.94288577154308 24.774549098196395 8 22.475570032573287 24.30468554247056 24.7557003257329 28.46404409922325 9 26.259082936607363 21.473314958656978 24.906038586820344 27.36156351791531 10-14 26.94235588972431 24.411027568922307 22.646616541353385 26.0 15-19 26.753285843282832 24.280124410554834 23.923949031804955 25.04264071435738 20-24 27.111422986316473 25.85835296476367 23.236930479675205 23.79329356924465 25-29 26.28837582010317 25.457004056693545 23.674062202634346 24.58055792056894 30-34 27.08208208208208 25.18018018018018 23.723723723723726 24.014014014014016 35-39 25.390390390390387 24.754754754754753 24.414414414414416 25.440440440440444 40-44 27.337337337337335 24.034034034034036 23.923923923923923 24.704704704704707 45-49 26.344786136431935 24.696984874286287 23.454873284583794 25.503355704697988 50-54 25.97936078549243 25.0626189760545 24.62679090271516 24.331229335737902 55-59 25.454545454545453 25.073879288755325 24.663160530929126 24.8084147257701 60-64 25.20170383362566 26.66499624154347 23.973941368078176 24.159358556752693 65-69 25.735773376786163 26.80872399097518 23.414389571321134 24.041113060917525 70-74 25.65311136739708 25.938925938925937 23.351551922980494 25.056410770696484 75-79 25.4865569823435 25.03511235955056 23.931581059390048 25.54674959871589 80-84 26.25902889245586 25.045144462279296 24.147271268057786 24.548555377207062 85-89 26.260346124905944 25.3925257085528 23.812390268372212 24.53473789816905 90-94 25.945810336176617 24.821876567987957 24.545910687405918 24.686402408429505 95-99 25.861290807883258 25.404944586530263 24.18634973170854 24.54741487387794 100-104 26.025268224205355 24.78191116013236 23.964704702697283 25.228115912965006 105-109 25.781210814064302 25.374931032753175 23.644480112353918 25.199378040828613 110-114 25.316011235955056 25.35112359550562 24.30276886035313 25.030096308186195 115-119 25.859214289298077 25.513019918719582 24.384125232050575 24.243640559931766 120-124 25.607185869128863 26.149136892814127 24.182055399437978 24.06162183861903 125-129 26.090881733373454 26.246363727555423 23.98936703781723 23.673387501253888 130-134 26.569782009521425 26.32422951641193 23.91881733901278 23.187171135053873 135-139 26.815950305580603 26.27993187055405 23.40446849013125 23.499649333734098 140-144 26.472800200551518 26.45274504888443 23.7152168463274 23.35923790423665 145-149 27.178277454326437 26.24472997390082 23.67998393896808 22.897008632804656 150 25.488232348522782 27.916875312969452 23.209814722083124 23.38507761642464 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 1.5 26 2.0 27 4.5 28 7.0 29 6.0 30 6.5 31 10.5 32 13.5 33 16.5 34 20.5 35 27.5 36 37.0 37 45.5 38 60.0 39 81.0 40 101.0 41 120.0 42 132.5 43 137.0 44 153.0 45 165.0 46 166.0 47 163.0 48 171.0 49 173.0 50 154.5 51 142.0 52 131.5 53 123.5 54 121.5 55 123.5 56 108.5 57 106.0 58 129.5 59 134.0 60 117.5 61 109.5 62 112.0 63 96.5 64 78.5 65 79.0 66 75.0 67 59.0 68 42.0 69 32.0 70 30.0 71 23.5 72 11.5 73 10.0 74 7.5 75 2.5 76 2.0 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.17500000000000002 3 0.2 4 0.25 5 0.22499999999999998 6 0.22499999999999998 7 0.2 8 0.22499999999999998 9 0.22499999999999998 10-14 0.25 15-19 0.33 20-24 0.245 25-29 0.165 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.16999999999999998 50-54 0.19 55-59 0.17500000000000002 60-64 0.22499999999999998 65-69 0.27499999999999997 70-74 0.28500000000000003 75-79 0.32 80-84 0.32 85-89 0.325 90-94 0.35000000000000003 95-99 0.295 100-104 0.27 105-109 0.315 110-114 0.32 115-119 0.345 120-124 0.36 125-129 0.31 130-134 0.22499999999999998 135-139 0.19 140-144 0.27499999999999997 145-149 0.38 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 97.99531372038531 94.1 2 1.614162978391044 3.1 3 0.18224420723769852 0.525 4 0.1041395469929706 0.4 5 0.0520697734964853 0.25 6 0.0 0.0 7 0.02603488674824265 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02603488674824265 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 58 1.4500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 7 0.17500000000000002 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit GTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5249999999999999 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.675 0.0 0.0 0.0 0.0 124-125 1.825 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.4 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138 3.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCATC 10 0.0071353805 142.9 1 TCATCGT 10 0.0071353805 142.9 3 AAAAAAA 100 8.425448E-4 11.518388 60-64 >>END_MODULE Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250043 spots for SRR8096897.sra Written 2250043 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra Read 2250040 spots for SRR8096897.sra Written 2250040 spots for SRR8096897.sra SRR ids: ['SRR8096897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_005e4lm4 SRR8096897.sra spots: 45000803 blocks: [[1, 2250040], [2250041, 4500080], [4500081, 6750120], [6750121, 9000160], [9000161, 11250200], [11250201, 13500240], [13500241, 15750280], [15750281, 18000320], [18000321, 20250360], [20250361, 22500400], [22500401, 24750440], [24750441, 27000480], [27000481, 29250520], [29250521, 31500560], [31500561, 33750600], [33750601, 36000640], [36000641, 38250680], [38250681, 40500720], [40500721, 42750760], [42750761, 45000803]] SRR8096897 file size 15139702 SRR8096897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096897 SRR8096897_1.fastq SRR8096897_2.fastq Input file: SRR8096897_1.fastq Paired file: SRR8096897_2.fastq trimmed: SRR8096897-trimmed-pair1.fastq, SRR8096897-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:54:36 2024 >> started Sat Dec 7 15:55:31 2024 >> done (55.264s) 45000803 read pairs processed; of these: 75508 ( 0.17%) short read pairs filtered out after trimming by size control 1659617 ( 3.69%) empty read pairs filtered out after trimming by size control 43265678 (96.14%) read pairs available; of these: 13844472 (32.00%) trimmed read pairs available after processing 29421206 (68.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 205 0.00% 19 326 0.00% 20 631 0.00% 21 195 0.00% 22 619 0.00% 23 167 0.00% 24 270 0.00% 25 310 0.00% 26 411 0.00% 27 706 0.00% 28 709 0.00% 29 1111 0.00% 30 382 0.00% 31 277 0.00% 32 264 0.00% 33 251 0.00% 34 261 0.00% 35 384 0.00% 36 423 0.00% 37 385 0.00% 38 577 0.00% 39 1128 0.00% 40 3618 0.01% 41 4733 0.01% 42 3211 0.01% 43 2371 0.01% 44 2252 0.01% 45 2043 0.00% 46 4528 0.01% 47 8920 0.02% 48 2896 0.01% 49 3596 0.01% 50 2597 0.01% 51 3619 0.01% 52 2822 0.01% 53 1655 0.00% 54 2009 0.00% 55 2154 0.00% 56 2931 0.01% 57 3654 0.01% 58 4069 0.01% 59 5252 0.01% 60 5372 0.01% 61 6933 0.02% 62 11794 0.03% 63 4109 0.01% 64 1695 0.00% 65 1807 0.00% 66 1804 0.00% 67 1672 0.00% 68 1819 0.00% 69 2794 0.01% 70 2693 0.01% 71 2354 0.01% 72 2406 0.01% 73 3103 0.01% 74 2707 0.01% 75 2945 0.01% 76 3016 0.01% 77 3532 0.01% 78 3840 0.01% 79 4326 0.01% 80 4492 0.01% 81 5092 0.01% 82 5632 0.01% 83 6812 0.02% 84 10436 0.02% 85 11526 0.03% 86 13250 0.03% 87 14160 0.03% 88 14508 0.03% 89 15135 0.03% 90 15093 0.03% 91 15350 0.04% 92 15390 0.04% 93 15674 0.04% 94 17263 0.04% 95 18432 0.04% 96 20691 0.05% 97 24702 0.06% 98 24660 0.06% 99 23502 0.05% 100 25518 0.06% 101 27244 0.06% 102 28853 0.07% 103 31129 0.07% 104 35059 0.08% 105 36046 0.08% 106 37040 0.09% 107 39407 0.09% 108 39358 0.09% 109 39871 0.09% 110 41084 0.09% 111 42236 0.10% 112 42997 0.10% 113 45082 0.10% 114 45798 0.11% 115 48620 0.11% 116 50046 0.12% 117 51881 0.12% 118 53555 0.12% 119 55097 0.13% 120 56710 0.13% 121 58994 0.14% 122 61002 0.14% 123 62440 0.14% 124 65052 0.15% 125 68636 0.16% 126 71909 0.17% 127 74797 0.17% 128 77996 0.18% 129 80305 0.19% 130 83857 0.19% 131 87898 0.20% 132 90928 0.21% 133 95431 0.22% 134 101141 0.23% 135 105534 0.24% 136 112246 0.26% 137 118348 0.27% 138 124931 0.29% 139 135177 0.31% 140 144651 0.33% 141 157887 0.36% 142 175766 0.41% 143 200990 0.46% 144 237596 0.55% 145 293290 0.68% 146 381112 0.88% 147 591906 1.37% 148 1108831 2.56% 149 7561747 17.48% 150 29421206 68.00% 43265678 reads passed initial QC criterion=sequence-density sequence-density=1.95 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=13 prefix-density=2.01 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=14.51 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.8 sequence=GGATTGACTAATGGTACACACGATTCACGATTCTTCCGTCATTCATTCACTCGTGCACCTCATGCTTAATTACATTGCGCGGGGTTCACTCCACCATGGTACAAATCAACACATAACTAGACAAAGGTACAAGTTGATCTACGGCGTACAAGTACACATGCATGCATACATCGATCGTCCGATGGATGGACCGATATATACTACAGCTAGCTGCTAATTCTCATTTAGCTCCCGGGGGCGAAGTTGGTAGCAAAGGCCCATGCATTGTTGTTGACTGGGTCGGCGACGTGGTCGAAGAGGTTCTC criterion=sequence-density sequence-density=1.55 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=15 prefix-density=1.68 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=53.36 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.0 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR8096897 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:56:13 Started mapping on | Dec 07 15:56:14 Finished on | Dec 07 16:02:19 Mapping speed, Million of reads per hour | 426.73 Number of input reads | 43265678 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 41176043 Uniquely mapped reads % | 95.17% Average mapped length | 294.32 Number of splices: Total | 42493665 Number of splices: Annotated (sjdb) | 40218912 Number of splices: GT/AG | 41928026 Number of splices: GC/AG | 472224 Number of splices: AT/AC | 10840 Number of splices: Non-canonical | 82575 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 629171 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 30426 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1527306 1527306 1527306 N_multimapping 629171 629171 629171 N_noFeature 1520372 39813857 1848214 N_ambiguous 1211525 4612 180568 UnstrandedReadsAssigned:38444146 PositiveStrandReadsAssigned:1357574 NegativeStrandReadsAssigned:39147261 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8096897 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096897-trimmed-pair1.fastq SRR8096897-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,265,678 reads, 39,118,753 reads pseudoaligned [quant] estimated average fragment length: 282.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR8096897.ke.tsv 35125 SRR8096897.se.tsv 88098 total ==> SRR8096897.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 655.34 0 0 PNS24247 1044 762.755 78.064 3.4534 PNS24249 1928 1646.76 27.3516 0.560448 PNS24246 1044 762.755 78.064 3.4534 PNS24248 1044 762.755 78.064 3.4534 PNS24244 1471 1189.76 322.457 9.14524 PNS24243 293 82.597 0 0 KQK14069 1603 1321.76 3999.21 102.095 KQK14071 474 215.976 85.1598 13.3049 ==> SRR8096897.se.tsv <== BRADI_1g14170v3 4852 BRADI_1g53295v3 913 BRADI_1g59795v3 455 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 826 BRADI_1g74790v3 76 BRADI_1g09890v3 0 BRADI_1g77505v3 462 BRADI_1g48960v3 0 SRR8096897 completed mapping pipeline successfully