Starting /dee2/code/volunteer_pipeline.sh SRR8096901 current disk space = 1515184181248 free memory = 1601281232 SRR8096901 SRAfilesize e427e12eda129d61ef0599cd9e4068ea SRR8096901.sra SRR8096901.sra file validated SRR8096901 is paired end SRR8096901 is conventional basespace SRR8096901 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8605 34.0 33.0 34.0 32.0 34.0 2 33.00575 34.0 33.0 34.0 31.0 34.0 3 33.18275 34.0 33.0 34.0 32.0 34.0 4 33.28125 34.0 33.0 34.0 33.0 34.0 5 33.31325 34.0 33.0 34.0 33.0 34.0 6 37.0345 38.0 38.0 38.0 36.0 38.0 7 37.39725 38.0 38.0 38.0 37.0 38.0 8 37.4915 38.0 38.0 38.0 37.0 38.0 9 37.57175 38.0 38.0 38.0 38.0 38.0 10-14 37.435950000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.43335 38.0 38.0 38.0 37.0 38.0 20-24 37.497499999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.42059999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.34665 38.0 38.0 38.0 37.2 38.0 35-39 37.272499999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.220949999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.15955 38.0 38.0 38.0 36.8 38.0 50-54 37.1083 38.0 38.0 38.0 36.8 38.0 55-59 37.166000000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.125150000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.93845 38.0 38.0 38.0 36.0 38.0 70-74 36.87605 38.0 38.0 38.0 36.0 38.0 75-79 36.58710000000001 38.0 38.0 38.0 35.4 38.0 80-84 36.415 38.0 38.0 38.0 34.8 38.0 85-89 36.446000000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.22160000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.2413 38.0 38.0 38.0 34.4 38.0 100-104 35.8667 38.0 37.8 38.0 33.0 38.0 105-109 35.72825 38.0 37.6 38.0 32.6 38.0 110-114 35.79335 38.0 38.0 38.0 33.2 38.0 115-119 35.604 38.0 37.8 38.0 32.0 38.0 120-124 35.48515 38.0 37.4 38.0 31.4 38.0 125-129 35.2779 38.0 37.2 38.0 31.0 38.0 130-134 34.712149999999994 38.0 36.0 38.0 28.4 38.0 135-139 34.28680000000001 38.0 35.8 38.0 25.8 38.0 140-144 33.6629 38.0 34.6 38.0 21.4 38.0 145-149 32.5769 38.0 33.2 38.0 8.8 38.0 150 23.83725 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 3.0 12 3.0 13 4.0 14 4.0 15 2.0 16 2.0 17 5.0 18 17.0 19 23.0 20 8.0 21 5.0 22 7.0 23 9.0 24 12.0 25 21.0 26 15.0 27 24.0 28 32.0 29 33.0 30 44.0 31 47.0 32 72.0 33 82.0 34 124.0 35 233.0 36 520.0 37 2643.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.90641430073607 11.724500525762355 7.3869610935856995 41.98212407991588 2 22.75 18.325 36.35 22.575 3 21.25 22.725 25.35 30.675 4 26.950000000000003 28.15 21.05 23.849999999999998 5 27.656914228557138 31.43285821455364 22.13053263315829 18.779694923730933 6 21.05 32.824999999999996 24.825 21.3 7 16.975 22.25 41.25 19.525000000000002 8 20.45 22.225 30.349999999999998 26.974999999999998 9 21.25 21.175 33.324999999999996 24.25 10-14 22.745 26.56 25.480000000000004 25.215 15-19 22.941147057352868 25.441272063603183 25.961298064903243 25.656282814140706 20-24 23.185 26.085 25.669999999999998 25.06 25-29 22.935 25.775 25.845000000000002 25.445 30-34 22.375 25.665 26.155 25.805 35-39 22.675 25.365 26.419999999999998 25.540000000000003 40-44 22.855 24.895 27.165 25.085 45-49 23.35 25.53 26.090000000000003 25.03 50-54 22.71 25.424999999999997 26.22 25.645 55-59 22.665 25.235000000000003 26.71 25.39 60-64 23.225 25.21 25.865 25.7 65-69 23.74 26.150000000000002 25.715 24.395 70-74 23.155 26.27 25.41 25.165 75-79 23.325000000000003 25.465 25.564999999999998 25.645 80-84 22.86 25.53 26.26 25.35 85-89 23.34 25.39 25.775 25.495 90-94 24.005000000000003 25.169999999999998 25.929999999999996 24.895 95-99 23.34 25.25 26.015 25.395 100-104 23.45 25.775 25.305 25.47 105-109 23.505000000000003 25.985000000000003 24.955 25.555 110-114 23.425 26.229999999999997 25.055 25.290000000000003 115-119 23.535 25.169999999999998 25.41 25.885 120-124 23.54 25.369999999999997 25.61 25.480000000000004 125-129 23.72 25.8 25.215 25.264999999999997 130-134 24.01 25.465 25.355 25.169999999999998 135-139 24.15 25.47 24.97 25.41 140-144 23.635 25.36 25.369999999999997 25.635 145-149 23.549999999999997 25.314999999999998 25.465 25.669999999999998 150 23.65 25.2 25.35 25.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 5.5 2 3.0 3 1.5 4 0.0 5 0.0 6 1.5 7 2.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 2.5 27 2.5 28 7.0 29 7.0 30 6.5 31 15.0 32 20.0 33 26.5 34 35.5 35 44.5 36 58.5 37 69.5 38 89.0 39 116.0 40 140.5 41 155.5 42 164.5 43 175.5 44 185.5 45 190.5 46 180.0 47 188.5 48 189.0 49 170.5 50 161.0 51 140.5 52 128.0 53 115.5 54 104.0 55 104.0 56 102.0 57 96.5 58 83.5 59 75.0 60 79.5 61 79.0 62 65.5 63 61.5 64 63.0 65 62.5 66 54.5 67 37.5 68 29.0 69 29.5 70 26.0 71 12.5 72 9.0 73 8.0 74 2.5 75 1.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61182519280206 95.89999999999999 2 1.1568123393316194 2.25 3 0.17994858611825193 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051413881748071974 1.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAAATCTCGTATGC 43 1.075 TruSeq Adapter, Index 19 (98% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.35 0.0 0.0 0.0 0.0 132-133 2.5999999999999996 0.0 0.0 0.0 0.0 134-135 2.85 0.0 0.0 0.0 0.0 136-137 3.0125 0.0 0.0 0.0 0.0 138 3.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8096901 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096901_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0595 33.0 32.0 33.0 27.0 34.0 2 31.328 33.0 32.0 33.0 27.0 34.0 3 31.59925 33.0 32.0 33.0 27.0 34.0 4 31.41625 33.0 33.0 34.0 28.0 34.0 5 28.58225 33.0 27.0 33.0 15.0 34.0 6 34.64175 38.0 34.0 38.0 28.0 38.0 7 35.3435 38.0 36.0 38.0 29.0 38.0 8 35.76525 38.0 37.0 38.0 31.0 38.0 9 35.7755 38.0 37.0 38.0 31.0 38.0 10-14 35.81035000000001 38.0 37.6 38.0 31.2 38.0 15-19 35.70805 38.0 37.2 38.0 30.6 38.0 20-24 35.6919 38.0 37.6 38.0 30.6 38.0 25-29 35.42625 38.0 37.0 38.0 29.0 38.0 30-34 35.287699999999994 38.0 37.0 38.0 28.8 38.0 35-39 35.199200000000005 38.0 37.0 38.0 28.6 38.0 40-44 35.03914999999999 38.0 36.4 38.0 27.8 38.0 45-49 34.93770000000001 38.0 36.0 38.0 27.6 38.0 50-54 34.77085 38.0 36.0 38.0 27.0 38.0 55-59 34.53285 38.0 35.6 38.0 26.0 38.0 60-64 34.2808 38.0 35.0 38.0 24.8 38.0 65-69 33.9555 38.0 34.6 38.0 21.0 38.0 70-74 33.47924999999999 38.0 34.2 38.0 15.6 38.0 75-79 33.0882 38.0 33.8 38.0 15.0 38.0 80-84 32.76165 38.0 33.2 38.0 15.0 38.0 85-89 32.2479 38.0 32.0 38.0 15.0 38.0 90-94 31.907549999999997 37.2 31.2 38.0 15.0 38.0 95-99 31.038 36.6 28.6 38.0 14.2 38.0 100-104 30.707849999999997 36.6 27.8 38.0 13.2 38.0 105-109 29.989449999999998 35.6 25.4 38.0 13.0 38.0 110-114 29.411400000000004 35.2 23.6 38.0 10.8 38.0 115-119 28.466950000000004 35.0 20.6 38.0 2.0 38.0 120-124 27.398000000000003 33.6 16.2 38.0 2.0 38.0 125-129 26.300400000000003 32.6 14.6 38.0 2.0 38.0 130-134 25.195 31.2 13.2 37.8 2.0 38.0 135-139 23.2465 29.4 7.8 37.4 2.0 38.0 140-144 21.127900000000004 25.2 2.0 35.2 2.0 38.0 145-149 18.0313 15.4 2.0 33.8 2.0 38.0 150 12.27525 2.0 2.0 31.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 10.0 4 5.0 5 7.0 6 8.0 7 6.0 8 5.0 9 4.0 10 11.0 11 10.0 12 21.0 13 18.0 14 21.0 15 36.0 16 36.0 17 27.0 18 28.0 19 24.0 20 42.0 21 45.0 22 41.0 23 61.0 24 50.0 25 93.0 26 63.0 27 97.0 28 123.0 29 167.0 30 190.0 31 228.0 32 304.0 33 332.0 34 466.0 35 533.0 36 573.0 37 279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.92269076305221 15.737951807228914 10.190763052208835 37.148594377510044 2 28.227021597187342 23.0286288297338 31.215469613259668 17.528879959819186 3 23.080795368738986 24.79234835137176 27.73722627737226 24.38963000251699 4 27.20865844450038 29.927007299270077 18.65089353133652 24.21344072489303 5 28.675730110775426 32.93051359516616 19.98992950654582 18.40382678751259 6 22.375690607734807 35.38422903063787 20.165745856353592 22.074334505273733 7 22.093899071051972 17.976399698719558 36.48004017072559 23.449661059502887 8 22.01305220883534 22.264056224899598 25.100401606425706 30.622489959839356 9 23.92668842580969 22.1943258850113 27.06502636203866 26.813959327140346 10-14 25.928901385820446 25.461940148624223 23.21249246836714 25.39666599718819 15-19 26.349349801676958 24.77782798614249 24.79289049555656 24.07993171662399 20-24 26.836370939398503 25.71170356981473 23.35191042827735 24.100015062509414 25-29 26.393212169896575 25.348930615523646 23.611808414499446 24.64604880008033 30-34 26.375502008032132 25.03012048192771 24.69879518072289 23.895582329317268 35-39 25.446787148594378 25.737951807228914 24.412650602409638 24.402610441767067 40-44 26.83734939759036 24.48293172690763 24.779116465863453 23.900602409638555 45-49 25.448064661880615 25.30749535619258 24.333550881068327 24.910889100858476 50-54 25.675268601265188 25.589918666532785 24.37493724269505 24.35987548950698 55-59 25.819569255484716 25.046438074200513 24.710075807018423 24.42391686329635 60-64 24.8506151142355 26.537785588752193 24.28822495606327 24.323374340949034 65-69 25.22219432588501 26.648255084107458 24.142606075822247 23.98694451418529 70-74 25.90007532011047 25.890032638714537 24.19281948280191 24.017072558373084 75-79 24.870700477027366 25.92016068290233 24.554356013055486 24.654782827014813 80-84 25.864925935224704 25.895053979412502 24.584484057243284 23.65553602811951 85-89 26.153768894691908 25.300055240295283 24.682368302114195 23.863807562898607 90-94 25.862501883191886 25.385426605734946 24.220358559734848 24.53171295133832 95-99 25.94154865923471 25.710555388169126 24.2241639047906 24.123732047805564 100-104 25.633944263118252 25.583730856138587 24.720060256088374 24.062264624654784 105-109 25.695490609621373 25.579993974088584 24.063472933614545 24.661042482675505 110-114 25.51343208636706 26.387145367813208 23.86141099673613 24.238011549083605 115-119 25.531060111484962 26.01315723396776 23.713152212122736 24.742630442424545 120-124 25.89263295334706 26.1688344297695 23.863807562898607 24.07472505398483 125-129 26.085864925935226 26.16118503640472 23.87647501883003 23.87647501883003 130-134 25.645274681128853 25.65531786682736 24.595761775635232 24.103645676408554 135-139 26.034344245832497 25.672825868648324 24.31211086563567 23.980719019883512 140-144 26.22514561156859 26.355693914440653 23.237597911227155 24.181562562763606 145-149 26.275497355829764 26.537396121883656 23.772349534122387 23.41475698816419 150 26.581325301204817 25.552208835341368 23.694779116465863 24.17168674698795 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 8.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 1.0 25 0.5 26 2.0 27 4.5 28 7.0 29 7.5 30 11.5 31 11.5 32 11.0 33 20.5 34 28.5 35 32.5 36 44.0 37 61.0 38 66.0 39 90.5 40 117.0 41 133.5 42 149.0 43 165.0 44 178.0 45 178.5 46 184.0 47 173.5 48 160.0 49 159.0 50 156.0 51 148.5 52 130.5 53 113.0 54 106.0 55 93.5 56 95.0 57 95.5 58 96.5 59 100.5 60 104.0 61 102.5 62 80.5 63 75.5 64 84.0 65 75.5 66 63.0 67 55.5 68 49.0 69 43.5 70 32.5 71 24.0 72 21.0 73 17.0 74 8.5 75 4.5 76 3.0 77 1.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.44999999999999996 3 0.675 4 0.675 5 0.7000000000000001 6 0.44999999999999996 7 0.42500000000000004 8 0.4 9 0.42500000000000004 10-14 0.42 15-19 0.415 20-24 0.415 25-29 0.41000000000000003 30-34 0.4 35-39 0.4 40-44 0.4 45-49 0.40499999999999997 50-54 0.41000000000000003 55-59 0.40499999999999997 60-64 0.42500000000000004 65-69 0.42500000000000004 70-74 0.42500000000000004 75-79 0.42500000000000004 80-84 0.42500000000000004 85-89 0.43499999999999994 90-94 0.43499999999999994 95-99 0.43 100-104 0.42500000000000004 105-109 0.43 110-114 0.42500000000000004 115-119 0.43499999999999994 120-124 0.43499999999999994 125-129 0.42500000000000004 130-134 0.43 135-139 0.42 140-144 0.42 145-149 0.7250000000000001 150 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6919723005899 96.2 2 1.128494485765581 2.1999999999999997 3 0.07694280584765324 0.22499999999999998 4 0.025647601949217745 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025647601949217745 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05129520389843549 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 28 0.7000000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.5750000000000002 0.0 0.0 0.0 0.0 132-133 1.7 0.0 0.0 0.0 0.0 134-135 1.8250000000000002 0.0 0.0 0.0 0.0 136-137 1.95 0.0 0.0 0.0 0.0 138 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTCT 10 0.0067269662 145.72151 3 >>END_MODULE Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967298 spots for SRR8096901.sra Written 1967298 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra Read 1967285 spots for SRR8096901.sra Written 1967285 spots for SRR8096901.sra SRR ids: ['SRR8096901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lwz3ii6z SRR8096901.sra spots: 39345713 blocks: [[1, 1967285], [1967286, 3934570], [3934571, 5901855], [5901856, 7869140], [7869141, 9836425], [9836426, 11803710], [11803711, 13770995], [13770996, 15738280], [15738281, 17705565], [17705566, 19672850], [19672851, 21640135], [21640136, 23607420], [23607421, 25574705], [25574706, 27541990], [27541991, 29509275], [29509276, 31476560], [31476561, 33443845], [33443846, 35411130], [35411131, 37378415], [37378416, 39345713]] SRR8096901 file size 13234423 SRR8096901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096901 SRR8096901_1.fastq SRR8096901_2.fastq Input file: SRR8096901_1.fastq Paired file: SRR8096901_2.fastq trimmed: SRR8096901-trimmed-pair1.fastq, SRR8096901-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:53:06 2024 >> started Thu Dec 12 02:53:50 2024 >> done (44.352s) 39345713 read pairs processed; of these: 94030 ( 0.24%) short read pairs filtered out after trimming by size control 913994 ( 2.32%) empty read pairs filtered out after trimming by size control 38337689 (97.44%) read pairs available; of these: 22519129 (58.74%) trimmed read pairs available after processing 15818560 (41.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 58 0.00% 20 40 0.00% 21 60 0.00% 22 76 0.00% 23 91 0.00% 24 123 0.00% 25 87 0.00% 26 76 0.00% 27 87 0.00% 28 71 0.00% 29 87 0.00% 30 147 0.00% 31 99 0.00% 32 159 0.00% 33 91 0.00% 34 142 0.00% 35 181 0.00% 36 158 0.00% 37 145 0.00% 38 169 0.00% 39 264 0.00% 40 363 0.00% 41 340 0.00% 42 322 0.00% 43 357 0.00% 44 337 0.00% 45 492 0.00% 46 726 0.00% 47 654 0.00% 48 659 0.00% 49 622 0.00% 50 647 0.00% 51 740 0.00% 52 801 0.00% 53 858 0.00% 54 959 0.00% 55 859 0.00% 56 983 0.00% 57 939 0.00% 58 1312 0.00% 59 1304 0.00% 60 1184 0.00% 61 3402 0.01% 62 1599 0.00% 63 999 0.00% 64 1155 0.00% 65 1167 0.00% 66 1245 0.00% 67 1394 0.00% 68 1606 0.00% 69 2110 0.01% 70 2439 0.01% 71 2399 0.01% 72 2342 0.01% 73 2394 0.01% 74 2652 0.01% 75 2851 0.01% 76 3097 0.01% 77 3579 0.01% 78 3777 0.01% 79 4276 0.01% 80 4664 0.01% 81 5280 0.01% 82 6458 0.02% 83 8275 0.02% 84 13624 0.04% 85 14733 0.04% 86 16994 0.04% 87 18097 0.05% 88 18251 0.05% 89 18402 0.05% 90 18557 0.05% 91 18828 0.05% 92 19248 0.05% 93 19786 0.05% 94 20878 0.05% 95 22416 0.06% 96 23923 0.06% 97 25824 0.07% 98 28166 0.07% 99 29631 0.08% 100 31385 0.08% 101 33121 0.09% 102 35320 0.09% 103 37788 0.10% 104 40148 0.10% 105 44515 0.12% 106 43854 0.11% 107 44981 0.12% 108 50737 0.13% 109 49084 0.13% 110 51056 0.13% 111 52957 0.14% 112 55591 0.15% 113 58750 0.15% 114 62103 0.16% 115 64675 0.17% 116 67572 0.18% 117 70846 0.18% 118 74749 0.19% 119 78448 0.20% 120 82755 0.22% 121 87471 0.23% 122 93059 0.24% 123 98267 0.26% 124 104365 0.27% 125 110757 0.29% 126 119152 0.31% 127 125548 0.33% 128 133036 0.35% 129 140947 0.37% 130 150946 0.39% 131 161164 0.42% 132 173619 0.45% 133 185692 0.48% 134 201168 0.52% 135 215048 0.56% 136 234771 0.61% 137 253309 0.66% 138 273716 0.71% 139 300938 0.78% 140 330457 0.86% 141 371569 0.97% 142 414905 1.08% 143 469903 1.23% 144 564893 1.47% 145 690071 1.80% 146 923235 2.41% 147 1356250 3.54% 148 2617305 6.83% 149 10072700 26.27% 150 15818560 41.26% 38337689 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=36 prefix-density=1.05 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=37.31 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.3 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=14 prefix-density=0.82 prefix-fanout=2.7 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=51.83 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8096901 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:54:31 Started mapping on | Dec 12 02:54:32 Finished on | Dec 12 02:59:57 Mapping speed, Million of reads per hour | 424.66 Number of input reads | 38337689 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 36732930 Uniquely mapped reads % | 95.81% Average mapped length | 291.12 Number of splices: Total | 38256268 Number of splices: Annotated (sjdb) | 36137233 Number of splices: GT/AG | 37747485 Number of splices: GC/AG | 442430 Number of splices: AT/AC | 12569 Number of splices: Non-canonical | 53784 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428952 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 10565 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1287855 1287855 1287855 N_multimapping 428952 428952 428952 N_noFeature 1324599 35579550 1602684 N_ambiguous 1031432 4170 159202 UnstrandedReadsAssigned:34376899 PositiveStrandReadsAssigned:1149210 NegativeStrandReadsAssigned:34971044 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096901 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096901-trimmed-pair1.fastq SRR8096901-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,337,689 reads, 35,009,147 reads pseudoaligned [quant] estimated average fragment length: 278.76 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52973 SRR8096901.ke.tsv 35125 SRR8096901.se.tsv 88098 total ==> SRR8096901.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.744 91.111 5.3831 PNS24247 1044 766.24 65.3849 3.32117 PNS24249 1928 1650.24 60.5744 1.42863 PNS24246 1044 766.24 65.3849 3.32117 PNS24248 1044 766.24 65.3849 3.32117 PNS24244 1471 1193.24 259.16 8.45313 PNS24243 293 79.0664 0 0 KQK14069 1603 1325.24 9972.08 292.866 KQK14071 474 215.571 192.166 34.6946 ==> SRR8096901.se.tsv <== BRADI_1g14170v3 11951 BRADI_1g53295v3 66 BRADI_1g59795v3 1774 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 274 BRADI_1g74790v3 108 BRADI_1g09890v3 0 BRADI_1g77505v3 592 BRADI_1g48960v3 0 SRR8096901 completed mapping pipeline successfully