Starting /dee2/code/volunteer_pipeline.sh SRR8096903 current disk space = 1539996946432 free memory = 1607453932 SRR8096903 SRAfilesize 7c815938f91e9d8a6e422e8f2a5bd18e SRR8096903.sra SRR8096903.sra file validated SRR8096903 is paired end SRR8096903 is conventional basespace SRR8096903 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5005 34.0 33.0 34.0 32.0 34.0 2 32.99425 34.0 33.0 34.0 30.0 34.0 3 33.17475 34.0 33.0 34.0 32.0 34.0 4 33.2725 34.0 33.0 34.0 32.0 34.0 5 33.34925 34.0 33.0 34.0 33.0 34.0 6 37.19975 38.0 38.0 38.0 36.0 38.0 7 37.35625 38.0 38.0 38.0 37.0 38.0 8 37.44825 38.0 38.0 38.0 37.0 38.0 9 37.55025 38.0 38.0 38.0 38.0 38.0 10-14 37.431450000000005 38.0 38.0 38.0 37.4 38.0 15-19 37.429249999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.48625 38.0 38.0 38.0 37.8 38.0 25-29 37.376250000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.2957 38.0 38.0 38.0 37.0 38.0 35-39 37.26775 38.0 38.0 38.0 37.0 38.0 40-44 37.1576 38.0 38.0 38.0 36.8 38.0 45-49 37.146100000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.10535 38.0 38.0 38.0 36.4 38.0 55-59 37.16795 38.0 38.0 38.0 37.0 38.0 60-64 37.090450000000004 38.0 38.0 38.0 36.4 38.0 65-69 36.9358 38.0 38.0 38.0 36.0 38.0 70-74 36.8714 38.0 38.0 38.0 35.8 38.0 75-79 36.60594999999999 38.0 38.0 38.0 35.4 38.0 80-84 36.45885 38.0 38.0 38.0 34.6 38.0 85-89 36.49245 38.0 38.0 38.0 34.8 38.0 90-94 36.22865 38.0 38.0 38.0 33.8 38.0 95-99 36.220600000000005 38.0 38.0 38.0 34.0 38.0 100-104 35.769600000000004 38.0 37.6 38.0 32.2 38.0 105-109 35.546499999999995 38.0 37.0 38.0 31.2 38.0 110-114 35.51785 38.0 37.0 38.0 31.4 38.0 115-119 35.31845 38.0 36.4 38.0 30.6 38.0 120-124 35.067449999999994 38.0 36.0 38.0 30.6 38.0 125-129 34.698449999999994 38.0 35.6 38.0 28.2 38.0 130-134 33.853 38.0 33.2 38.0 23.0 38.0 135-139 33.280699999999996 38.0 33.0 38.0 19.4 38.0 140-144 32.44155 38.0 33.0 38.0 14.2 38.0 145-149 30.590549999999997 37.4 30.0 38.0 6.0 38.0 150 20.84625 27.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 0.0 9 2.0 10 6.0 11 0.0 12 1.0 13 4.0 14 2.0 15 4.0 16 2.0 17 8.0 18 10.0 19 17.0 20 10.0 21 8.0 22 14.0 23 12.0 24 10.0 25 19.0 26 24.0 27 22.0 28 28.0 29 33.0 30 33.0 31 58.0 32 71.0 33 111.0 34 158.0 35 350.0 36 890.0 37 2090.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.23093276640978 11.719372840818496 8.184958809460536 42.86473558331119 2 23.150000000000002 17.125 37.625 22.1 3 22.45 20.25 26.150000000000002 31.15 4 27.500000000000004 27.750000000000004 21.4 23.35 5 26.325 31.275 22.975 19.425 6 19.75 33.275 24.9 22.075 7 16.8 22.650000000000002 41.699999999999996 18.85 8 19.6 22.775000000000002 31.55 26.075 9 20.625 19.900000000000002 33.050000000000004 26.424999999999997 10-14 22.925 26.72 24.865000000000002 25.490000000000002 15-19 22.845 25.430000000000003 25.555 26.169999999999998 20-24 23.285 25.919999999999998 25.47 25.324999999999996 25-29 23.085 25.335 26.11 25.47 30-34 22.84 25.39 25.874999999999996 25.895000000000003 35-39 22.36 25.19 26.63 25.82 40-44 22.88 25.445 25.990000000000002 25.685000000000002 45-49 22.715 25.715 25.580000000000002 25.990000000000002 50-54 23.21 26.015 25.205 25.569999999999997 55-59 23.24 25.019999999999996 26.185000000000002 25.555 60-64 23.01 25.290000000000003 25.825 25.874999999999996 65-69 23.25 26.040000000000003 25.355 25.355 70-74 23.605 26.145000000000003 25.085 25.165 75-79 23.225 25.91 25.385 25.480000000000004 80-84 23.580000000000002 25.105 25.895000000000003 25.419999999999998 85-89 22.95 25.53 25.424999999999997 26.095000000000002 90-94 24.335 25.82 25.03 24.815 95-99 23.72 25.119999999999997 25.374999999999996 25.785000000000004 100-104 23.849999999999998 26.22 24.82 25.11 105-109 23.035 25.974999999999998 25.865 25.124999999999996 110-114 23.305 26.095000000000002 24.834999999999997 25.765 115-119 24.169999999999998 25.319999999999997 25.25 25.259999999999998 120-124 23.36 25.619999999999997 25.0 26.02 125-129 23.26 25.865 25.419999999999998 25.455 130-134 23.73 26.095000000000002 24.37 25.805 135-139 24.205 26.075 24.075 25.645 140-144 23.835 24.95 25.130000000000003 26.085 145-149 24.075 25.61 24.485 25.83 150 25.0 25.874999999999996 25.124999999999996 24.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 5.0 2 3.5 3 1.5 4 1.5 5 1.5 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 2.5 27 6.0 28 8.0 29 7.0 30 6.0 31 9.0 32 15.0 33 20.0 34 27.0 35 42.0 36 60.5 37 75.5 38 81.0 39 101.5 40 136.5 41 155.5 42 164.0 43 183.0 44 186.5 45 186.5 46 198.5 47 188.0 48 174.5 49 168.5 50 150.5 51 136.0 52 124.5 53 111.5 54 104.5 55 98.0 56 104.0 57 102.0 58 90.5 59 95.0 60 97.5 61 84.0 62 73.0 63 69.0 64 65.5 65 52.0 66 46.0 67 43.0 68 34.0 69 24.5 70 20.0 71 18.0 72 10.5 73 7.5 74 5.5 75 2.5 76 1.0 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.43469335386195 95.89999999999999 2 1.3600205286117526 2.65 3 0.12830382345393893 0.375 4 0.025660764690787787 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051321529381575574 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGATCTCGTATGC 28 0.7000000000000001 TruSeq Adapter, Index 22 (98% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.025 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138 2.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCAC 10 0.0069845165 143.925 6 >>END_MODULE SRR8096903 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096903_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.64875 33.0 31.0 33.0 25.0 34.0 2 31.00425 33.0 32.0 33.0 27.0 34.0 3 31.36075 33.0 32.0 33.0 27.0 34.0 4 31.243 33.0 31.0 33.0 28.0 34.0 5 28.2985 33.0 27.0 33.0 15.0 34.0 6 34.42075 38.0 33.0 38.0 28.0 38.0 7 35.086 38.0 36.0 38.0 29.0 38.0 8 35.5005 38.0 37.0 38.0 29.0 38.0 9 35.642 38.0 37.0 38.0 29.0 38.0 10-14 35.68535 38.0 37.0 38.0 30.6 38.0 15-19 35.596799999999995 38.0 37.0 38.0 30.2 38.0 20-24 35.570499999999996 38.0 37.0 38.0 29.0 38.0 25-29 35.3351 38.0 37.0 38.0 28.8 38.0 30-34 35.02455 38.0 36.0 38.0 27.8 38.0 35-39 34.90555 38.0 36.0 38.0 27.2 38.0 40-44 34.8303 38.0 36.0 38.0 27.4 38.0 45-49 34.73309999999999 38.0 36.0 38.0 27.0 38.0 50-54 34.50535 38.0 35.4 38.0 25.8 38.0 55-59 34.2004 38.0 34.8 38.0 25.0 38.0 60-64 34.0154 38.0 34.4 38.0 19.4 38.0 65-69 33.73315 38.0 34.0 38.0 19.0 38.0 70-74 33.217349999999996 38.0 33.6 38.0 15.6 38.0 75-79 32.91105 38.0 33.2 38.0 15.0 38.0 80-84 32.5391 37.8 32.2 38.0 15.0 38.0 85-89 31.942700000000002 37.0 30.8 38.0 15.0 38.0 90-94 31.678250000000002 37.0 30.6 38.0 15.0 38.0 95-99 30.749000000000002 36.2 27.8 38.0 14.2 38.0 100-104 30.221600000000002 36.0 26.2 38.0 13.0 38.0 105-109 29.455399999999997 35.0 24.0 38.0 13.0 38.0 110-114 28.969299999999997 34.8 23.0 38.0 8.6 38.0 115-119 27.85965 34.0 17.4 38.0 2.0 38.0 120-124 26.94475 33.4 15.0 38.0 2.0 38.0 125-129 25.828500000000002 31.8 13.8 38.0 2.0 38.0 130-134 24.24645 31.0 13.0 36.8 2.0 38.0 135-139 22.1522 27.4 4.2 35.8 2.0 38.0 140-144 20.168300000000002 23.2 2.0 33.4 2.0 38.0 145-149 16.75235 10.2 2.0 33.0 2.0 38.0 150 11.02475 2.0 2.0 25.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 5.0 4 8.0 5 6.0 6 6.0 7 7.0 8 7.0 9 10.0 10 11.0 11 6.0 12 15.0 13 11.0 14 21.0 15 24.0 16 38.0 17 37.0 18 33.0 19 40.0 20 42.0 21 60.0 22 62.0 23 65.0 24 74.0 25 74.0 26 89.0 27 109.0 28 132.0 29 164.0 30 206.0 31 258.0 32 315.0 33 366.0 34 428.0 35 521.0 36 541.0 37 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.88073164620396 16.91305437233776 8.218491606113757 38.987722375344525 2 25.589563472152534 23.1058705469142 32.237832413447066 19.066733567486203 3 22.615461847389557 25.426706827309236 28.162650602409638 23.795180722891565 4 26.430722891566266 31.72690763052209 18.247991967871485 23.59437751004016 5 26.93273092369478 33.032128514056225 20.281124497991968 19.75401606425703 6 22.202709483191168 34.470647265429 20.47165077772203 22.854992473657802 7 21.193880110358666 16.904941058439928 37.020316027088036 24.88086280411337 8 21.76529588766299 22.818455366098295 26.654964894684053 28.761283851554666 9 24.303987960872835 21.695510408828696 26.36067218459995 27.63982944569852 10-14 26.305492851768246 25.046400802608478 23.25558063707048 25.3925257085528 15-19 25.415057430907357 24.77805086020966 24.527260871746 25.279630837136978 20-24 26.23131708295717 25.293409569665965 23.93921155582305 24.536061791553816 25-29 25.900110319927787 25.34851068097483 24.09988968007221 24.651489319025174 30-34 25.938737654785182 25.337143430089736 24.184087832756806 24.540031082368277 35-39 25.45873859420435 25.27825127845182 24.425950065175975 24.837060062167854 40-44 25.919799498746865 24.74185463659148 24.345864661654133 24.992481203007518 45-49 25.987765744083436 24.6690734055355 24.734255916566386 24.60890493381468 50-54 26.208625877632898 24.819458375125375 24.368104312938815 24.60381143430291 55-59 26.269869127011987 24.66529609386752 24.715439001153285 24.349395777967207 60-64 25.55059449154668 25.836552450709878 23.905082024783024 24.70777103296042 65-69 25.33487182059901 25.936888576732052 24.000401344504088 24.72783825816485 70-74 25.953241019466184 25.48665462572747 24.583584186233193 23.97652016857315 75-79 25.01505117399157 25.496688741721858 24.79931768011238 24.688942404174192 80-84 25.7451078775715 25.33868539889614 24.22478675363773 24.691419969894632 85-89 25.765178123432015 25.258404415454088 24.701455092824887 24.27496236828901 90-94 25.9144046962019 26.536551101299484 23.134815112136874 24.414229090361747 95-99 26.204093919325704 25.5769616696769 24.11198073449729 24.1069636765001 100-104 26.020868867261964 25.594461723688173 24.661382562456104 23.723286846593762 105-109 25.768902714364554 25.543123777030758 24.278761727961466 24.40921178064322 110-114 25.198193677872556 26.05117912694431 24.475664826894132 24.27496236828901 115-119 25.72002007024586 26.171600602107375 23.49724034119418 24.611138986452584 120-124 25.462846821534292 26.902814710752093 24.248657869650295 23.385680598063317 125-129 25.14675630926697 27.30419948823441 23.902463499071796 23.64658070342682 130-134 26.516481862425366 26.636897295670064 23.5562691284933 23.29035171341127 135-139 25.3975420115375 26.812139453222976 23.967895660897916 23.82242287434161 140-144 26.003210272873194 27.01645264847512 23.24438202247191 23.735955056179776 145-149 25.05026135906715 27.633695215118614 23.381584238037796 23.93445918777644 150 24.918525946352467 27.92679869641514 23.08849335673101 24.066182000501378 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 2.0 25 2.5 26 3.5 27 4.0 28 5.0 29 9.0 30 9.0 31 9.5 32 17.5 33 23.5 34 30.0 35 43.5 36 46.5 37 55.5 38 71.0 39 79.0 40 94.5 41 112.5 42 138.5 43 162.5 44 164.5 45 163.0 46 179.0 47 173.0 48 149.5 49 156.0 50 162.5 51 151.0 52 134.5 53 111.0 54 97.0 55 109.0 56 105.0 57 97.0 58 116.0 59 130.5 60 117.5 61 101.0 62 99.5 63 84.0 64 71.0 65 69.5 66 66.0 67 60.0 68 50.5 69 47.5 70 38.5 71 21.5 72 14.0 73 9.0 74 6.0 75 5.5 76 2.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.35000000000000003 3 0.4 4 0.4 5 0.4 6 0.35000000000000003 7 0.325 8 0.3 9 0.325 10-14 0.325 15-19 0.315 20-24 0.31 25-29 0.29 30-34 0.265 35-39 0.27 40-44 0.25 45-49 0.27999999999999997 50-54 0.3 55-59 0.28500000000000003 60-64 0.335 65-69 0.335 70-74 0.33999999999999997 75-79 0.33999999999999997 80-84 0.35000000000000003 85-89 0.35000000000000003 90-94 0.345 95-99 0.33999999999999997 100-104 0.33 105-109 0.345 110-114 0.35000000000000003 115-119 0.35000000000000003 120-124 0.345 125-129 0.345 130-134 0.345 135-139 0.325 140-144 0.32 145-149 0.52 150 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61786536984899 96.325 2 1.0749936012285641 2.1 3 0.2047606859482979 0.6 4 0.0 0.0 5 0.02559508574353724 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02559508574353724 0.22499999999999998 >10 0.05119017148707448 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 15 0.375 Illumina Single End PCR Primer 1 (100% over 50bp) CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 10 0.25 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0750000000000002 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.3125 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGAC 10 0.0069827023 143.9375 7 >>END_MODULE Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950680 spots for SRR8096903.sra Written 1950680 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra Read 1950664 spots for SRR8096903.sra Written 1950664 spots for SRR8096903.sra SRR ids: ['SRR8096903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3tpvfutn SRR8096903.sra spots: 39013296 blocks: [[1, 1950664], [1950665, 3901328], [3901329, 5851992], [5851993, 7802656], [7802657, 9753320], [9753321, 11703984], [11703985, 13654648], [13654649, 15605312], [15605313, 17555976], [17555977, 19506640], [19506641, 21457304], [21457305, 23407968], [23407969, 25358632], [25358633, 27309296], [27309297, 29259960], [29259961, 31210624], [31210625, 33161288], [33161289, 35111952], [35111953, 37062616], [37062617, 39013296]] SRR8096903 file size 13122427 SRR8096903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096903 SRR8096903_1.fastq SRR8096903_2.fastq Input file: SRR8096903_1.fastq Paired file: SRR8096903_2.fastq trimmed: SRR8096903-trimmed-pair1.fastq, SRR8096903-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:57:23 2024 >> started Sat Dec 7 19:59:15 2024 >> done (111.950s) 39013296 read pairs processed; of these: 119793 ( 0.31%) short read pairs filtered out after trimming by size control 778956 ( 2.00%) empty read pairs filtered out after trimming by size control 38114547 (97.70%) read pairs available; of these: 24638726 (64.64%) trimmed read pairs available after processing 13475821 (35.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 78 0.00% 19 372 0.00% 20 394 0.00% 21 94 0.00% 22 489 0.00% 23 89 0.00% 24 165 0.00% 25 128 0.00% 26 121 0.00% 27 116 0.00% 28 115 0.00% 29 104 0.00% 30 311 0.00% 31 121 0.00% 32 149 0.00% 33 138 0.00% 34 240 0.00% 35 197 0.00% 36 164 0.00% 37 207 0.00% 38 216 0.00% 39 279 0.00% 40 356 0.00% 41 368 0.00% 42 337 0.00% 43 370 0.00% 44 440 0.00% 45 626 0.00% 46 685 0.00% 47 699 0.00% 48 753 0.00% 49 776 0.00% 50 821 0.00% 51 876 0.00% 52 950 0.00% 53 967 0.00% 54 1138 0.00% 55 1180 0.00% 56 1306 0.00% 57 1337 0.00% 58 1716 0.00% 59 1795 0.00% 60 1658 0.00% 61 3861 0.01% 62 2180 0.01% 63 1648 0.00% 64 1642 0.00% 65 1693 0.00% 66 1903 0.00% 67 2115 0.01% 68 2302 0.01% 69 2740 0.01% 70 2907 0.01% 71 2988 0.01% 72 3140 0.01% 73 3643 0.01% 74 3836 0.01% 75 4050 0.01% 76 4318 0.01% 77 4777 0.01% 78 5279 0.01% 79 5840 0.02% 80 6219 0.02% 81 7198 0.02% 82 8305 0.02% 83 10468 0.03% 84 16335 0.04% 85 17487 0.05% 86 19488 0.05% 87 20852 0.05% 88 21099 0.06% 89 21366 0.06% 90 21041 0.06% 91 21542 0.06% 92 22199 0.06% 93 23224 0.06% 94 24267 0.06% 95 25919 0.07% 96 27539 0.07% 97 29669 0.08% 98 32189 0.08% 99 33183 0.09% 100 35119 0.09% 101 37331 0.10% 102 39426 0.10% 103 42459 0.11% 104 44963 0.12% 105 48482 0.13% 106 49792 0.13% 107 51439 0.13% 108 56089 0.15% 109 55143 0.14% 110 57907 0.15% 111 59683 0.16% 112 62352 0.16% 113 65524 0.17% 114 68739 0.18% 115 72960 0.19% 116 76848 0.20% 117 81573 0.21% 118 85310 0.22% 119 89666 0.24% 120 94796 0.25% 121 101361 0.27% 122 108833 0.29% 123 113790 0.30% 124 120672 0.32% 125 128390 0.34% 126 138591 0.36% 127 145432 0.38% 128 154158 0.40% 129 164308 0.43% 130 176630 0.46% 131 188338 0.49% 132 202117 0.53% 133 217354 0.57% 134 235287 0.62% 135 251466 0.66% 136 277153 0.73% 137 299264 0.79% 138 324131 0.85% 139 357143 0.94% 140 392929 1.03% 141 440816 1.16% 142 494426 1.30% 143 564080 1.48% 144 674793 1.77% 145 828929 2.17% 146 1107319 2.91% 147 1621123 4.25% 148 2989328 7.84% 149 10051072 26.37% 150 13475821 35.36% 38114547 reads passed initial QC criterion=sequence-density sequence-density=1.81 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=12 prefix-density=1.86 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.48 sequence-density-rank=16 fanout-score=9.99 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=4.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.32 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=13 prefix-density=1.45 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=44.57 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=6.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR8096903 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 20:04:05 Started mapping on | Dec 07 20:04:05 Finished on | Dec 07 20:07:54 Mapping speed, Million of reads per hour | 599.18 Number of input reads | 38114547 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 37120051 Uniquely mapped reads % | 97.39% Average mapped length | 289.75 Number of splices: Total | 38188480 Number of splices: Annotated (sjdb) | 36056554 Number of splices: GT/AG | 37675616 Number of splices: GC/AG | 450030 Number of splices: AT/AC | 10799 Number of splices: Non-canonical | 52035 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376546 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 11233 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.39% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 743495 743495 743495 N_multimapping 376546 376546 376546 N_noFeature 1389206 35982931 1684839 N_ambiguous 997041 4569 158889 UnstrandedReadsAssigned:34733804 PositiveStrandReadsAssigned:1132551 NegativeStrandReadsAssigned:35276323 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR8096903 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096903-trimmed-pair1.fastq SRR8096903-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,114,547 reads, 35,288,976 reads pseudoaligned [quant] estimated average fragment length: 283.826 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR8096903.ke.tsv 35125 SRR8096903.se.tsv 88098 total ==> SRR8096903.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 653.842 0 0 PNS24247 1044 761.174 133.046 6.77249 PNS24249 1928 1645.17 69.0222 1.62557 PNS24246 1044 761.174 133.046 6.77249 PNS24248 1044 761.174 133.046 6.77249 PNS24244 1471 1188.17 242.839 7.91896 PNS24243 293 80.3853 0 0 KQK14069 1603 1320.17 6940.73 203.706 KQK14071 474 214.464 119.927 21.6666 ==> SRR8096903.se.tsv <== BRADI_1g14170v3 8468 BRADI_1g53295v3 70 BRADI_1g59795v3 2036 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 1232 BRADI_1g74790v3 138 BRADI_1g09890v3 0 BRADI_1g77505v3 466 BRADI_1g48960v3 0 SRR8096903 completed mapping pipeline successfully