Starting /dee2/code/volunteer_pipeline.sh SRR8096904 current disk space = 1539730825216 free memory = 1417950460 SRR8096904 SRAfilesize a9e2b52db36b1cd2b98bcca9575752de SRR8096904.sra SRR8096904.sra file validated SRR8096904 is paired end SRR8096904 is conventional basespace SRR8096904 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47375 34.0 33.0 34.0 32.0 34.0 2 33.08075 34.0 33.0 34.0 32.0 34.0 3 33.1135 34.0 33.0 34.0 31.0 34.0 4 33.303 34.0 33.0 34.0 33.0 34.0 5 33.429 34.0 33.0 34.0 33.0 34.0 6 37.03 38.0 37.0 38.0 36.0 38.0 7 37.29825 38.0 38.0 38.0 37.0 38.0 8 37.31 38.0 38.0 38.0 37.0 38.0 9 37.449 38.0 38.0 38.0 37.0 38.0 10-14 37.43874999999999 38.0 38.0 38.0 37.2 38.0 15-19 37.454750000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.4279 38.0 38.0 38.0 37.2 38.0 25-29 37.414500000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.360499999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.2912 38.0 38.0 38.0 37.0 38.0 40-44 37.156850000000006 38.0 38.0 38.0 36.8 38.0 45-49 37.0995 38.0 38.0 38.0 36.6 38.0 50-54 37.11585 38.0 38.0 38.0 36.4 38.0 55-59 37.113899999999994 38.0 38.0 38.0 36.6 38.0 60-64 36.871449999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.478249999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.42385 38.0 38.0 38.0 34.8 38.0 75-79 35.56595 38.0 38.0 38.0 32.4 38.0 80-84 35.596999999999994 38.0 38.0 38.0 33.2 38.0 85-89 35.5555 38.0 38.0 38.0 33.0 38.0 90-94 34.8401 38.0 36.6 38.0 27.6 38.0 95-99 35.395849999999996 38.0 38.0 38.0 32.6 38.0 100-104 35.04825 38.0 38.0 38.0 29.6 38.0 105-109 34.87585 38.0 38.0 38.0 28.4 38.0 110-114 34.3914 38.0 36.8 38.0 24.4 38.0 115-119 34.63965 38.0 38.0 38.0 27.4 38.0 120-124 34.6577 38.0 38.0 38.0 29.2 38.0 125-129 34.194 38.0 37.2 38.0 23.2 38.0 130-134 34.074400000000004 38.0 36.8 38.0 22.6 38.0 135-139 33.82315 38.0 36.0 38.0 19.6 38.0 140-144 33.61585 38.0 35.8 38.0 15.6 38.0 145-149 33.242149999999995 38.0 36.0 38.0 8.8 38.0 150 29.784 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 2.0 9 1.0 10 3.0 11 0.0 12 2.0 13 4.0 14 3.0 15 2.0 16 7.0 17 7.0 18 41.0 19 86.0 20 12.0 21 17.0 22 12.0 23 15.0 24 16.0 25 19.0 26 25.0 27 27.0 28 43.0 29 31.0 30 36.0 31 37.0 32 46.0 33 68.0 34 94.0 35 162.0 36 379.0 37 2799.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.985596158975724 13.336889837289945 7.22859429181115 33.44891971192318 2 22.900000000000002 21.25 33.5 22.35 3 21.45 21.425 28.499999999999996 28.625 4 27.3 25.324999999999996 20.325 27.05 5 29.4 29.875 21.725 19.0 6 24.625 31.574999999999996 23.425 20.375 7 19.275000000000002 25.724999999999998 37.4 17.599999999999998 8 20.025000000000002 25.924999999999997 27.925 26.125 9 24.175 20.325 31.35 24.15 10-14 23.255 27.474999999999998 23.330000000000002 25.94 15-19 23.225 25.069999999999997 25.35 26.355 20-24 22.58 26.445 25.130000000000003 25.845000000000002 25-29 23.36 24.79 24.945 26.905 30-34 22.25 25.275 25.080000000000002 27.395000000000003 35-39 24.36 25.245 26.340000000000003 24.055 40-44 22.195 24.45 26.82 26.534999999999997 45-49 24.240000000000002 25.419999999999998 26.305 24.035 50-54 22.945 23.845 25.019999999999996 28.189999999999998 55-59 23.645 23.485 27.445000000000004 25.424999999999997 60-64 23.945 24.610000000000003 25.525 25.919999999999998 65-69 22.081307333700938 29.956388791418114 23.615218807960296 24.34708506692065 70-74 23.315 29.29 23.01 24.385 75-79 23.064999999999998 26.685 24.25 26.0 80-84 23.71 25.85 24.75 25.69 85-89 23.785 25.685000000000002 24.54 25.990000000000002 90-94 24.05 24.945 24.69 26.314999999999998 95-99 23.98 25.195 24.59 26.235000000000003 100-104 23.765 26.44 24.685000000000002 25.11 105-109 24.365000000000002 26.33 24.34 24.965 110-114 23.575 26.875 23.77 25.779999999999998 115-119 23.494999999999997 25.645 24.925 25.935000000000002 120-124 24.2 25.395 24.09 26.314999999999998 125-129 23.695 27.615000000000002 23.41 25.28 130-134 23.945 27.865000000000002 23.005 25.185000000000002 135-139 24.282428242824285 27.29272927292729 23.15231523152315 25.272527252725276 140-144 24.122412241224122 26.092609260926093 23.637363736373636 26.147614761476145 145-149 24.125 25.985000000000003 23.82 26.07 150 24.525 26.650000000000002 22.900000000000002 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 4.5 2 3.0 3 2.0 4 1.5 5 1.0 6 0.5 7 2.0 8 2.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 3.5 26 3.0 27 4.0 28 7.0 29 5.5 30 8.0 31 14.0 32 17.0 33 22.5 34 27.5 35 34.5 36 51.5 37 66.0 38 80.5 39 109.0 40 130.5 41 131.5 42 134.0 43 171.5 44 191.0 45 182.5 46 181.0 47 176.5 48 192.0 49 192.0 50 159.0 51 138.0 52 123.0 53 105.5 54 97.0 55 89.5 56 92.0 57 102.5 58 98.5 59 92.5 60 98.5 61 93.5 62 82.0 63 75.5 64 73.5 65 67.0 66 53.0 67 51.5 68 44.5 69 26.5 70 21.0 71 15.5 72 9.0 73 8.5 74 7.0 75 6.5 76 5.0 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.255 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.89559989068051 89.55 2 1.5304728067778082 2.8000000000000003 3 0.32795845859524464 0.8999999999999999 4 0.05465974309920743 0.2 5 0.0 0.0 6 0.05465974309920743 0.3 7 0.0 0.0 8 0.027329871549603715 0.2 9 0.0 0.0 >10 0.08198961464881116 1.375 >50 0.0 0.0 >100 0.027329871549603715 4.675 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 187 4.675 TruSeq Adapter, Index 2 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG 22 0.5499999999999999 TruSeq Adapter, Index 2 (100% over 49bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCC 22 0.5499999999999999 TruSeq Adapter, Index 2 (100% over 50bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 2 (98% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 6 0.15 No Hit NGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG 6 0.15 TruSeq Adapter, Index 2 (100% over 49bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.55 0.0 0.0 0.0 0.0 2 0.55 0.0 0.0 0.0 0.0 3 0.55 0.0 0.0 0.0 0.0 4 0.55 0.0 0.0 0.0 0.0 5 0.55 0.0 0.0 0.0 0.0 6 0.55 0.0 0.0 0.0 0.0 7 0.55 0.0 0.0 0.0 0.0 8 0.55 0.0 0.0 0.0 0.0 9 0.55 0.0 0.0 0.0 0.0 10-11 0.55 0.0 0.0 0.0 0.0 12-13 0.55 0.0 0.0 0.0 0.0 14-15 0.5625 0.0 0.0 0.0 0.0 16-17 0.575 0.0 0.0 0.0 0.0 18-19 0.575 0.0 0.0 0.0 0.0 20-21 0.575 0.0 0.0 0.0 0.0 22-23 0.575 0.0 0.0 0.0 0.0 24-25 0.575 0.0 0.0 0.0 0.0 26-27 0.575 0.0 0.0 0.0 0.0 28-29 0.575 0.0 0.0 0.0 0.0 30-31 0.575 0.0 0.0 0.0 0.0 32-33 0.575 0.0 0.0 0.0 0.0 34-35 0.575 0.0 0.0 0.0 0.0 36-37 0.575 0.0 0.0 0.0 0.0 38-39 0.575 0.0 0.0 0.0 0.0 40-41 0.575 0.0 0.0 0.0 0.0 42-43 0.575 0.0 0.0 0.0 0.0 44-45 0.575 0.0 0.0 0.0 0.0 46-47 0.575 0.0 0.0 0.0 0.0 48-49 0.575 0.0 0.0 0.0 0.0 50-51 0.575 0.0 0.0 0.0 0.0 52-53 0.575 0.0 0.0 0.0 0.0 54-55 0.575 0.0 0.0 0.0 0.0 56-57 0.5874999999999999 0.0 0.0 0.0 0.0 58-59 0.625 0.0 0.0 0.0 0.0 60-61 0.675 0.0 0.0 0.0 0.0 62-63 0.725 0.0 0.0 0.0 0.0 64-65 0.725 0.0 0.0 0.0 0.0 66-67 0.725 0.0 0.0 0.0 0.0 68-69 0.75 0.0 0.0 0.0 0.0 70-71 0.8125 0.0 0.0 0.0 0.0 72-73 0.825 0.0 0.0 0.0 0.0 74-75 0.8374999999999999 0.0 0.0 0.0 0.0 76-77 0.8875 0.0 0.0 0.0 0.0 78-79 0.9 0.0 0.0 0.0 0.0 80-81 0.9 0.0 0.0 0.0 0.0 82-83 0.9624999999999999 0.0 0.0 0.0 0.0 84-85 0.975 0.0 0.0 0.0 0.0 86-87 0.9875 0.0 0.0 0.0 0.0 88-89 1.0750000000000002 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.2 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.85 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.237500000000001 0.0 0.0 0.0 0.0 130-131 4.6625 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.487500000000001 0.0 0.0 0.0 0.0 138 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTG 10 0.0069772652 143.975 2 GGGCATT 20 3.3302308E-4 110.75001 1 GATCGGA 45 9.607735E-5 65.62963 1 TCGGAAG 45 1.0926476E-4 63.988895 3 AGAGCAC 45 1.0926476E-4 63.988895 8 ATCGGAA 45 1.0926476E-4 63.988895 2 GGAAGAG 45 1.0926476E-4 63.988895 5 AAGAGCA 50 1.8404023E-4 57.59 7 GAAGAGC 55 2.9479602E-4 52.35455 6 GAGCACA 55 2.9479602E-4 52.35455 9 CGGAAGA 65 6.7230524E-4 44.3 4 ATGCCGT 40 0.007974719 17.996876 45-49 TCGTATG 40 0.007974719 17.996876 40-44 GTCACCG 50 0.0013945919 17.277 25-29 CACGTCT 60 0.0047087013 14.3975 10-14 AAAAAAA 325 5.9158992E-8 7.974 65-69 >>END_MODULE SRR8096904 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096904_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.77275 33.0 33.0 34.0 27.0 34.0 2 32.174 33.0 33.0 34.0 31.0 34.0 3 31.74075 33.0 33.0 34.0 27.0 34.0 4 31.83925 33.0 33.0 34.0 28.0 34.0 5 31.8885 33.0 33.0 34.0 30.0 34.0 6 36.00925 38.0 38.0 38.0 33.0 38.0 7 36.0675 38.0 38.0 38.0 33.0 38.0 8 36.1405 38.0 38.0 38.0 34.0 38.0 9 36.0385 38.0 38.0 38.0 33.0 38.0 10-14 35.82915 38.0 38.0 38.0 31.4 38.0 15-19 35.632 38.0 38.0 38.0 29.8 38.0 20-24 35.834649999999996 38.0 38.0 38.0 31.8 38.0 25-29 35.794650000000004 38.0 38.0 38.0 31.0 38.0 30-34 35.535000000000004 38.0 38.0 38.0 29.4 38.0 35-39 35.41705 38.0 38.0 38.0 28.6 38.0 40-44 35.5843 38.0 38.0 38.0 30.8 38.0 45-49 35.4901 38.0 38.0 38.0 30.0 38.0 50-54 35.41245 38.0 38.0 38.0 29.6 38.0 55-59 35.34895 38.0 38.0 38.0 28.8 38.0 60-64 35.503 38.0 38.0 38.0 30.4 38.0 65-69 35.15755 38.0 37.8 38.0 29.8 38.0 70-74 34.34994999999999 38.0 37.4 38.0 25.2 38.0 75-79 34.148199999999996 38.0 37.0 38.0 22.4 38.0 80-84 34.05985 38.0 37.0 38.0 19.2 38.0 85-89 34.08095 38.0 37.0 38.0 23.8 38.0 90-94 33.926399999999994 38.0 37.0 38.0 18.4 38.0 95-99 33.7682 38.0 36.4 38.0 15.0 38.0 100-104 33.6468 38.0 36.0 38.0 15.0 38.0 105-109 33.46875 38.0 36.0 38.0 14.8 38.0 110-114 33.30505 38.0 35.6 38.0 14.2 38.0 115-119 33.2051 38.0 35.2 38.0 14.0 38.0 120-124 33.04485000000001 38.0 35.0 38.0 13.4 38.0 125-129 32.73045 38.0 35.0 38.0 13.0 38.0 130-134 32.49325 38.0 34.6 38.0 13.0 38.0 135-139 32.203799999999994 38.0 34.0 38.0 4.2 38.0 140-144 31.744350000000004 38.0 34.0 38.0 2.0 38.0 145-149 31.0057 38.0 33.4 38.0 2.0 38.0 150 24.42575 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 16.0 4 5.0 5 3.0 6 18.0 7 10.0 8 6.0 9 3.0 10 2.0 11 7.0 12 21.0 13 9.0 14 18.0 15 20.0 16 36.0 17 77.0 18 17.0 19 16.0 20 14.0 21 8.0 22 14.0 23 15.0 24 20.0 25 24.0 26 31.0 27 46.0 28 41.0 29 47.0 30 62.0 31 68.0 32 85.0 33 100.0 34 127.0 35 247.0 36 530.0 37 2205.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.82494365138994 18.83295767593288 8.214375156523916 30.12772351615327 2 27.605210420841686 27.25450901803607 27.805611222444888 17.334669338677354 3 25.739348370927317 22.406015037593985 28.62155388471178 23.233082706766915 4 24.329069475796338 29.79683972911964 17.431652871833457 28.442437923250562 5 30.900426385753697 31.928768497617256 17.205919237521947 19.964885879107097 6 28.91173520561685 32.44734202607823 17.276830491474424 21.36409227683049 7 22.525682786269105 22.049611626158857 31.57103482836382 23.853670759208217 8 22.291875626880643 26.68004012036108 21.489468405215646 29.538615847542626 9 27.90872617853561 20.762286860581742 24.448345035105316 26.880641925777333 10-14 28.002407946222537 24.90719373933982 21.315340624059395 25.77505769037825 15-19 27.419192933145954 23.25838185103393 23.890784982935152 25.431640232884963 20-24 28.658842411475575 25.719731166616512 22.188785234226103 23.432641187681813 25-29 26.875093942582296 26.349015481737563 22.145398066035373 24.63049250964477 30-34 27.79112846700711 24.046260138179633 23.750876138980676 24.411735255832582 35-39 26.006610576923077 23.993389423076923 24.173677884615387 25.826322115384613 40-44 29.159991990388466 23.0126151381658 23.508209851822187 24.319183019623548 45-49 26.896482613488327 23.083475298126068 23.198717306343323 26.82132478204229 50-54 26.102425335738626 24.584084986971337 23.8474644217278 25.466025255562236 55-59 25.52242545727888 25.30192934101729 24.520170383362565 24.65547481834127 60-64 24.838272905069957 28.363672834862847 22.571586179228724 24.226468080838472 65-69 25.215690208667734 27.834069020866774 22.62239165329053 24.32784911717496 70-74 26.27565099593598 26.45627414580302 22.868897697054837 24.39917716120616 75-79 26.66733577558087 26.065137752797714 22.477041200381393 24.790485271240026 80-84 26.3525042657834 25.74023888387032 23.697681421258658 24.209575429087625 85-89 26.904929223973497 26.53850015058729 22.65334805742395 23.90322256801526 90-94 26.773432401224962 25.3777800090366 23.475074049902105 24.373713539836338 95-99 26.28594369448487 25.583379334571184 23.470667937973605 24.660009032970343 100-104 26.3081322430141 25.786384387698792 23.282998043445545 24.62248532584157 105-109 25.844331811110553 25.974808049380236 23.33015506599087 24.85070507351834 110-114 25.831869510664994 26.419071518193228 23.558343789209534 24.190715181932244 115-119 25.96515889351875 26.321602490084846 23.35960640594407 24.353632210452332 120-124 25.627636071500305 26.887929303072905 23.3329985940952 24.151436031331595 125-129 25.65736651947009 27.303291850662387 23.47952629466078 23.559815335206743 130-134 26.241099187644167 27.43957476682379 22.440076221041018 23.879249824491026 135-139 25.781719783523755 27.194828622970533 24.158147925435962 22.865303668069753 140-144 25.914221218961625 27.208427389014293 23.30574366691748 23.571607725106595 145-149 26.49422400803616 27.348066298342545 22.81767955801105 23.340030135610245 150 25.97695390781563 27.90581162324649 22.74549098196393 23.371743486973948 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 2.0 24 1.0 25 2.0 26 2.0 27 1.0 28 3.0 29 3.5 30 4.0 31 6.5 32 8.5 33 13.0 34 17.5 35 27.0 36 40.5 37 51.0 38 53.5 39 62.0 40 88.5 41 112.5 42 137.5 43 147.5 44 160.0 45 169.0 46 162.0 47 159.0 48 150.0 49 151.5 50 156.0 51 142.5 52 128.5 53 118.0 54 114.5 55 125.0 56 115.0 57 103.0 58 121.0 59 128.5 60 116.0 61 109.5 62 113.5 63 109.5 64 93.0 65 84.5 66 73.0 67 62.5 68 52.5 69 48.5 70 47.0 71 29.5 72 18.0 73 14.5 74 10.5 75 6.5 76 3.0 77 2.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.25 4 0.325 5 0.325 6 0.3 7 0.22499999999999998 8 0.3 9 0.3 10-14 0.33 15-19 0.38 20-24 0.31 25-29 0.20500000000000002 30-34 0.13 35-39 0.16 40-44 0.12 45-49 0.21 50-54 0.22 55-59 0.22499999999999998 60-64 0.295 65-69 0.32 70-74 0.345 75-79 0.365 80-84 0.37 85-89 0.38999999999999996 90-94 0.40499999999999997 95-99 0.365 100-104 0.335 105-109 0.365 110-114 0.375 115-119 0.40499999999999997 120-124 0.42 125-129 0.36 130-134 0.29 135-139 0.22 140-144 0.325 145-149 0.44999999999999996 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18763326226014 92.10000000000001 2 1.3859275053304905 2.6 3 0.21321961620469082 0.6 4 0.10660980810234541 0.4 5 0.026652452025586353 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.053304904051172705 0.775 >50 0.0 0.0 >100 0.026652452025586353 3.4000000000000004 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 136 3.4000000000000004 Illumina Single End PCR Primer 1 (100% over 50bp) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 19 0.475 Illumina Single End PCR Primer 1 (100% over 50bp) AAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGT 12 0.3 TruSeq Adapter, Index 2 (100% over 50bp) CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.55 0.0 0.0 0.0 0.0 2 0.55 0.0 0.0 0.0 0.0 3 0.55 0.0 0.0 0.0 0.0 4 0.55 0.0 0.0 0.0 0.0 5 0.55 0.0 0.0 0.0 0.0 6 0.55 0.0 0.0 0.0 0.0 7 0.55 0.0 0.0 0.0 0.0 8 0.55 0.0 0.0 0.0 0.0 9 0.55 0.0 0.0 0.0 0.0 10-11 0.55 0.0 0.0 0.0 0.0 12-13 0.55 0.0 0.0 0.0 0.0 14-15 0.5625 0.0 0.0 0.0 0.0 16-17 0.575 0.0 0.0 0.0 0.0 18-19 0.575 0.0 0.0 0.0 0.0 20-21 0.575 0.0 0.0 0.0 0.0 22-23 0.575 0.0 0.0 0.0 0.0 24-25 0.575 0.0 0.0 0.0 0.0 26-27 0.575 0.0 0.0 0.0 0.0 28-29 0.575 0.0 0.0 0.0 0.0 30-31 0.575 0.0 0.0 0.0 0.0 32-33 0.575 0.0 0.0 0.0 0.0 34-35 0.575 0.0 0.0 0.0 0.0 36-37 0.575 0.0 0.0 0.0 0.0 38-39 0.575 0.0 0.0 0.0 0.0 40-41 0.5874999999999999 0.0 0.0 0.0 0.0 42-43 0.6 0.0 0.0 0.0 0.0 44-45 0.6 0.0 0.0 0.0 0.0 46-47 0.6 0.0 0.0 0.0 0.0 48-49 0.6 0.0 0.0 0.0 0.0 50-51 0.6 0.0 0.0 0.0 0.0 52-53 0.6125 0.0 0.0 0.0 0.0 54-55 0.625 0.0 0.0 0.0 0.0 56-57 0.625 0.0 0.0 0.0 0.0 58-59 0.6375 0.0 0.0 0.0 0.0 60-61 0.675 0.0 0.0 0.0 0.0 62-63 0.925 0.0 0.0 0.0 0.0 64-65 0.925 0.0 0.0 0.0 0.0 66-67 0.925 0.0 0.0 0.0 0.0 68-69 0.95 0.0 0.0 0.0 0.0 70-71 1.0125 0.0 0.0 0.0 0.0 72-73 1.025 0.0 0.0 0.0 0.0 74-75 1.0375 0.0 0.0 0.0 0.0 76-77 1.0875 0.0 0.0 0.0 0.0 78-79 1.1 0.0 0.0 0.0 0.0 80-81 1.1 0.0 0.0 0.0 0.0 82-83 1.1625 0.0 0.0 0.0 0.0 84-85 1.175 0.0 0.0 0.0 0.0 86-87 1.1875 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 90-91 1.3375 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.5750000000000002 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.0875000000000004 0.0 0.0 0.0 0.0 108-109 2.1624999999999996 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.35 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.362500000000001 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.55 0.0 0.0 0.0 0.0 138 5.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAGAA 10 0.0069808904 143.95 2 AGACGGC 10 0.0069808904 143.95 8 GGTGGAC 10 0.0069808904 143.95 8 GTGGACT 10 0.0069808904 143.95 9 AAGAGCG 40 6.1016373E-5 71.975 7 GAAGAGC 45 1.0935876E-4 63.977776 6 GAGCGTC 35 0.0034092173 61.692852 9 CGGAAGA 50 1.841984E-4 57.58 4 GGAAGAG 50 1.841984E-4 57.58 5 TCGGAAG 40 0.0057853833 53.98125 3 ATCGGAA 40 0.0057853833 53.98125 2 GATCGGA 45 0.009218329 47.983334 1 AGAGCGT 45 0.009218329 47.983334 8 AAAAAAA 275 3.3978722E-9 9.422182 60-64 >>END_MODULE Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180973 spots for SRR8096904.sra Written 2180973 spots for SRR8096904.sra Read 2180978 spots for SRR8096904.sra Written 2180978 spots for SRR8096904.sra SRR ids: ['SRR8096904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9tten3er SRR8096904.sra spots: 43619465 blocks: [[1, 2180973], [2180974, 4361946], [4361947, 6542919], [6542920, 8723892], [8723893, 10904865], [10904866, 13085838], [13085839, 15266811], [15266812, 17447784], [17447785, 19628757], [19628758, 21809730], [21809731, 23990703], [23990704, 26171676], [26171677, 28352649], [28352650, 30533622], [30533623, 32714595], [32714596, 34895568], [34895569, 37076541], [37076542, 39257514], [39257515, 41438487], [41438488, 43619465]] SRR8096904 file size 14674310 SRR8096904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096904 SRR8096904_1.fastq SRR8096904_2.fastq Input file: SRR8096904_1.fastq Paired file: SRR8096904_2.fastq trimmed: SRR8096904-trimmed-pair1.fastq, SRR8096904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 20:24:09 2024 >> started Sat Dec 7 20:29:36 2024 >> done (326.658s) 43619465 read pairs processed; of these: 113673 ( 0.26%) short read pairs filtered out after trimming by size control 2852575 ( 6.54%) empty read pairs filtered out after trimming by size control 40653217 (93.20%) read pairs available; of these: 13650080 (33.58%) trimmed read pairs available after processing 27003137 (66.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 217 0.00% 19 303 0.00% 20 106 0.00% 21 172 0.00% 22 200 0.00% 23 207 0.00% 24 296 0.00% 25 244 0.00% 26 293 0.00% 27 752 0.00% 28 561 0.00% 29 233 0.00% 30 369 0.00% 31 381 0.00% 32 462 0.00% 33 189 0.00% 34 560 0.00% 35 562 0.00% 36 401 0.00% 37 443 0.00% 38 487 0.00% 39 694 0.00% 40 985 0.00% 41 879 0.00% 42 848 0.00% 43 862 0.00% 44 1361 0.00% 45 2354 0.01% 46 2240 0.01% 47 2135 0.01% 48 1986 0.00% 49 2323 0.01% 50 2380 0.01% 51 2805 0.01% 52 2875 0.01% 53 3481 0.01% 54 4406 0.01% 55 5250 0.01% 56 8323 0.02% 57 6553 0.02% 58 17629 0.04% 59 17690 0.04% 60 9503 0.02% 61 59998 0.15% 62 12491 0.03% 63 3145 0.01% 64 2545 0.01% 65 3015 0.01% 66 2838 0.01% 67 2992 0.01% 68 3876 0.01% 69 5703 0.01% 70 5366 0.01% 71 3821 0.01% 72 3745 0.01% 73 3999 0.01% 74 4146 0.01% 75 4567 0.01% 76 5062 0.01% 77 5441 0.01% 78 6197 0.02% 79 6838 0.02% 80 7055 0.02% 81 7683 0.02% 82 8449 0.02% 83 9664 0.02% 84 15503 0.04% 85 17447 0.04% 86 21137 0.05% 87 23811 0.06% 88 23351 0.06% 89 23743 0.06% 90 23235 0.06% 91 22802 0.06% 92 22411 0.06% 93 22784 0.06% 94 24540 0.06% 95 25856 0.06% 96 29424 0.07% 97 34350 0.08% 98 34218 0.08% 99 34400 0.08% 100 36869 0.09% 101 39110 0.10% 102 41592 0.10% 103 45025 0.11% 104 49056 0.12% 105 50610 0.12% 106 53024 0.13% 107 55565 0.14% 108 55273 0.14% 109 56093 0.14% 110 56724 0.14% 111 57709 0.14% 112 58783 0.14% 113 59857 0.15% 114 61512 0.15% 115 63603 0.16% 116 65639 0.16% 117 68188 0.17% 118 68287 0.17% 119 70204 0.17% 120 72250 0.18% 121 74291 0.18% 122 75633 0.19% 123 78540 0.19% 124 81282 0.20% 125 84574 0.21% 126 88062 0.22% 127 91162 0.22% 128 93303 0.23% 129 96766 0.24% 130 99092 0.24% 131 102711 0.25% 132 106498 0.26% 133 109723 0.27% 134 115673 0.28% 135 120275 0.30% 136 125656 0.31% 137 130826 0.32% 138 138570 0.34% 139 147504 0.36% 140 155468 0.38% 141 166397 0.41% 142 181553 0.45% 143 202863 0.50% 144 234460 0.58% 145 281355 0.69% 146 357555 0.88% 147 536799 1.32% 148 968907 2.38% 149 6736961 16.57% 150 27003137 66.42% 40653217 reads passed initial QC criterion=sequence-density sequence-density=2.10 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=14 prefix-density=2.14 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.51 sequence-density-rank=18 fanout-score=10.48 fanout-score-rank=1 prefix-density=1.34 prefix-fanout=4.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.78 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=10 prefix-density=1.93 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=18.06 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.0 sequence=CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -y GAGTTCAGCAAGGTCGG -o SRR8096904 SRR8096904_1.fastq SRR8096904_2.fastq Input file: SRR8096904_1.fastq Paired file: SRR8096904_2.fastq trimmed: SRR8096904-trimmed-pair1.fastq, SRR8096904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -- paired 3' end adapter sequence (-y): GAGTTCAGCAAGGTCGG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 20:48:30 2024 >> started Sat Dec 7 20:49:54 2024 >> done (84.656s) 13551072 read pairs processed; of these: 1137 ( 0.01%) short read pairs filtered out after trimming by size control 5017 ( 0.04%) empty read pairs filtered out after trimming by size control 13544918 (99.95%) read pairs available; of these: 1400 ( 0.01%) trimmed read pairs available after processing 13543518 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 79 0.00% 19 109 0.00% 20 34 0.00% 21 47 0.00% 22 62 0.00% 23 63 0.00% 24 74 0.00% 25 91 0.00% 26 110 0.00% 27 238 0.00% 28 194 0.00% 29 83 0.00% 30 132 0.00% 31 133 0.00% 32 140 0.00% 33 70 0.00% 34 171 0.00% 35 190 0.00% 36 129 0.00% 37 127 0.00% 38 159 0.00% 39 255 0.00% 40 329 0.00% 41 297 0.00% 42 276 0.00% 43 314 0.00% 44 461 0.00% 45 792 0.01% 46 724 0.01% 47 719 0.01% 48 635 0.00% 49 773 0.01% 50 783 0.01% 51 949 0.01% 52 988 0.01% 53 1178 0.01% 54 1401 0.01% 55 1754 0.01% 56 2836 0.02% 57 2165 0.02% 58 5819 0.04% 59 5731 0.04% 60 3135 0.02% 61 19845 0.15% 62 4079 0.03% 63 1101 0.01% 64 913 0.01% 65 990 0.01% 66 944 0.01% 67 937 0.01% 68 1291 0.01% 69 1958 0.01% 70 1723 0.01% 71 1278 0.01% 72 1224 0.01% 73 1336 0.01% 74 1420 0.01% 75 1514 0.01% 76 1656 0.01% 77 1873 0.01% 78 2134 0.02% 79 2251 0.02% 80 2304 0.02% 81 2538 0.02% 82 2817 0.02% 83 3216 0.02% 84 5210 0.04% 85 5783 0.04% 86 7173 0.05% 87 7976 0.06% 88 7843 0.06% 89 7947 0.06% 90 7771 0.06% 91 7719 0.06% 92 7405 0.05% 93 7646 0.06% 94 8190 0.06% 95 8720 0.06% 96 9795 0.07% 97 11498 0.08% 98 11446 0.08% 99 11504 0.08% 100 12286 0.09% 101 12903 0.10% 102 13828 0.10% 103 14946 0.11% 104 16299 0.12% 105 16789 0.12% 106 17620 0.13% 107 18557 0.14% 108 18526 0.14% 109 18517 0.14% 110 18900 0.14% 111 19319 0.14% 112 19569 0.14% 113 19858 0.15% 114 20522 0.15% 115 20998 0.16% 116 21944 0.16% 117 22533 0.17% 118 22680 0.17% 119 23537 0.17% 120 24079 0.18% 121 24874 0.18% 122 24754 0.18% 123 26177 0.19% 124 26997 0.20% 125 28130 0.21% 126 29430 0.22% 127 30123 0.22% 128 31183 0.23% 129 32439 0.24% 130 33022 0.24% 131 33989 0.25% 132 35697 0.26% 133 36177 0.27% 134 38463 0.28% 135 39757 0.29% 136 41946 0.31% 137 43406 0.32% 138 46250 0.34% 139 49581 0.37% 140 51758 0.38% 141 55428 0.41% 142 60978 0.45% 143 67685 0.50% 144 78282 0.58% 145 93704 0.69% 146 119233 0.88% 147 179376 1.32% 148 322962 2.38% 149 2243490 16.56% 150 8997700 66.43% criterion=sequence-density sequence-density=2.09 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=14 prefix-density=2.15 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.21 sequence-density-rank=24 fanout-score=17.40 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=17.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=sequence-density sequence-density=1.75 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=12 prefix-density=1.90 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=25.61 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.9 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR8096904 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 20:57:06 Started mapping on | Dec 07 20:57:07 Finished on | Dec 07 21:38:21 Mapping speed, Million of reads per hour | 59.15 Number of input reads | 40647063 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 38687404 Uniquely mapped reads % | 95.18% Average mapped length | 292.91 Number of splices: Total | 35981434 Number of splices: Annotated (sjdb) | 34104404 Number of splices: GT/AG | 35495044 Number of splices: GC/AG | 397731 Number of splices: AT/AC | 8619 Number of splices: Non-canonical | 80040 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 635707 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 31269 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1434830 1434830 1434830 N_multimapping 635707 635707 635707 N_noFeature 1154230 37455822 1422739 N_ambiguous 1122623 3652 162814 UnstrandedReadsAssigned:36410551 PositiveStrandReadsAssigned:1227930 NegativeStrandReadsAssigned:37101851 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096904 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096904-trimmed-pair1.fastq SRR8096904-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,647,063 reads, 37,113,135 reads pseudoaligned [quant] estimated average fragment length: 253.173 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,275 rounds 52973 SRR8096904.ke.tsv 35125 SRR8096904.se.tsv 88098 total ==> SRR8096904.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.134 0 0 PNS24247 1044 791.827 78.368 3.39852 PNS24249 1928 1675.83 44.5478 0.912805 PNS24246 1044 791.827 78.368 3.39852 PNS24248 1044 791.827 78.368 3.39852 PNS24244 1471 1218.83 342.348 9.6451 PNS24243 293 88.8431 0 0 KQK14069 1603 1350.83 2257.3 57.3814 KQK14071 474 234.169 38.039 5.57802 ==> SRR8096904.se.tsv <== BRADI_1g14170v3 2709 BRADI_1g53295v3 626 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 856 BRADI_1g74790v3 101 BRADI_1g09890v3 0 BRADI_1g77505v3 470 BRADI_1g48960v3 0 SRR8096904 completed mapping pipeline successfully