Starting /dee2/code/volunteer_pipeline.sh SRR8096905 current disk space = 1508248240128 free memory = 1379661824 SRR8096905 SRAfilesize 745563b0cd1b8d120f19c6630c22c9a7 SRR8096905.sra SRR8096905.sra file validated SRR8096905 is paired end SRR8096905 is conventional basespace SRR8096905 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.15175 34.0 33.0 34.0 31.0 34.0 2 32.90675 34.0 33.0 34.0 29.0 34.0 3 33.05925 34.0 33.0 34.0 32.0 34.0 4 33.21825 34.0 33.0 34.0 32.0 34.0 5 33.30325 34.0 33.0 34.0 33.0 34.0 6 37.14325 38.0 38.0 38.0 36.0 38.0 7 37.37825 38.0 38.0 38.0 37.0 38.0 8 37.50075 38.0 38.0 38.0 37.0 38.0 9 37.56375 38.0 38.0 38.0 38.0 38.0 10-14 37.425399999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.412 38.0 38.0 38.0 37.2 38.0 20-24 37.49765 38.0 38.0 38.0 37.6 38.0 25-29 37.417199999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.34905 38.0 38.0 38.0 37.6 38.0 35-39 37.30105 38.0 38.0 38.0 37.0 38.0 40-44 37.1525 38.0 38.0 38.0 37.0 38.0 45-49 37.12714999999999 38.0 38.0 38.0 36.8 38.0 50-54 37.123000000000005 38.0 38.0 38.0 36.6 38.0 55-59 37.1965 38.0 38.0 38.0 37.0 38.0 60-64 37.11395 38.0 38.0 38.0 36.6 38.0 65-69 36.9593 38.0 38.0 38.0 36.0 38.0 70-74 36.8596 38.0 38.0 38.0 36.0 38.0 75-79 36.4992 38.0 38.0 38.0 35.6 38.0 80-84 36.27824999999999 38.0 38.0 38.0 34.6 38.0 85-89 36.35195 38.0 38.0 38.0 34.8 38.0 90-94 36.09965 38.0 38.0 38.0 34.2 38.0 95-99 36.1 38.0 38.0 38.0 34.2 38.0 100-104 35.73485 38.0 37.6 38.0 32.6 38.0 105-109 35.5438 38.0 37.6 38.0 31.6 38.0 110-114 35.674549999999996 38.0 38.0 38.0 32.8 38.0 115-119 35.5777 38.0 38.0 38.0 32.6 38.0 120-124 35.33125 38.0 37.0 38.0 31.0 38.0 125-129 35.1163 38.0 36.8 38.0 31.0 38.0 130-134 34.59765 38.0 36.0 38.0 27.6 38.0 135-139 34.1815 38.0 35.6 38.0 25.4 38.0 140-144 33.5761 38.0 34.2 38.0 20.4 38.0 145-149 32.59205 38.0 33.0 38.0 9.8 38.0 150 23.78575 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 1.0 9 1.0 10 1.0 11 3.0 12 4.0 13 5.0 14 2.0 15 4.0 16 5.0 17 9.0 18 17.0 19 26.0 20 6.0 21 8.0 22 9.0 23 10.0 24 11.0 25 7.0 26 17.0 27 29.0 28 39.0 29 27.0 30 35.0 31 54.0 32 69.0 33 88.0 34 147.0 35 206.0 36 562.0 37 2596.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.31780231618637 12.146512254241854 8.564503097225963 38.97118233234581 2 23.175 16.975 36.0 23.849999999999998 3 22.475 20.200000000000003 26.200000000000003 31.125000000000004 4 28.1 25.424999999999997 20.375 26.1 5 26.281570392598148 30.23255813953488 23.10577644411103 20.38009502375594 6 21.725 31.075000000000003 25.05 22.15 7 17.299999999999997 23.200000000000003 40.150000000000006 19.35 8 20.875 23.724999999999998 29.425 25.974999999999998 9 21.75 19.075 33.375 25.8 10-14 23.275000000000002 26.51 25.31 24.905 15-19 22.722272227222724 25.257525752575255 26.232623262326232 25.78757875787579 20-24 23.494999999999997 25.0 26.31 25.195 25-29 23.435 25.165 25.564999999999998 25.835 30-34 23.330000000000002 25.255 25.915 25.5 35-39 23.425 24.755 26.775 25.045 40-44 23.45 24.905 25.82 25.825 45-49 23.91 24.805 26.075 25.21 50-54 23.200000000000003 24.67 26.240000000000002 25.89 55-59 23.474999999999998 24.52 26.205000000000002 25.8 60-64 23.630000000000003 24.765 26.25 25.355 65-69 23.205000000000002 26.729999999999997 24.6 25.465 70-74 23.825 25.990000000000002 24.990000000000002 25.195 75-79 23.49 25.5 25.230000000000004 25.779999999999998 80-84 24.29 25.055 25.174999999999997 25.480000000000004 85-89 23.919999999999998 24.72 25.365 25.995 90-94 23.9 25.0 25.6 25.5 95-99 23.645 24.64 25.55 26.165 100-104 24.19 25.055 25.180000000000003 25.575 105-109 23.855 25.814999999999998 24.725 25.605 110-114 23.865 24.73 25.085 26.32 115-119 23.98 25.069999999999997 24.41 26.540000000000003 120-124 23.895 24.52 25.314999999999998 26.27 125-129 24.485 25.255 25.045 25.215 130-134 24.67 25.590000000000003 24.404999999999998 25.335 135-139 24.235 25.040000000000003 24.435000000000002 26.290000000000003 140-144 24.615000000000002 25.095 24.635 25.655 145-149 24.884999999999998 24.765 24.169999999999998 26.179999999999996 150 25.124999999999996 23.95 24.125 26.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.5 2 4.0 3 3.5 4 0.5 5 2.0 6 2.0 7 0.5 8 1.0 9 0.5 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 1.5 27 2.5 28 2.0 29 5.0 30 8.5 31 14.0 32 16.5 33 23.0 34 30.0 35 42.0 36 63.5 37 78.0 38 89.5 39 105.5 40 126.5 41 147.5 42 162.5 43 174.0 44 178.0 45 172.5 46 183.5 47 187.5 48 170.0 49 153.5 50 145.5 51 127.5 52 114.5 53 117.5 54 106.5 55 98.5 56 102.0 57 99.5 58 94.0 59 95.0 60 95.5 61 82.5 62 74.5 63 66.5 64 66.5 65 68.0 66 56.5 67 52.5 68 43.0 69 31.5 70 24.5 71 18.0 72 15.5 73 14.5 74 12.0 75 8.0 76 2.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.175 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12548815412653 94.22500000000001 2 1.4839885446498307 2.85 3 0.2863837542306691 0.8250000000000001 4 0.02603488674824265 0.1 5 0.02603488674824265 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02603488674824265 0.42500000000000004 >50 0.02603488674824265 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGATCTCGTATGC 58 1.4500000000000002 TruSeq Adapter, Index 21 (98% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 17 0.42500000000000004 No Hit ATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 21 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9874999999999998 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.7750000000000004 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAGA 10 0.0069827023 143.9375 9 AACAGCA 10 0.0069827023 143.9375 7 >>END_MODULE SRR8096905 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096905_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3025 33.0 32.0 33.0 27.0 34.0 2 31.33075 33.0 32.0 33.0 27.0 34.0 3 31.6895 33.0 32.0 34.0 28.0 34.0 4 31.51225 33.0 33.0 34.0 28.0 34.0 5 28.9465 33.0 27.0 33.0 15.0 34.0 6 34.8625 38.0 35.0 38.0 28.0 38.0 7 35.50825 38.0 37.0 38.0 29.0 38.0 8 35.843 38.0 37.0 38.0 31.0 38.0 9 35.856 38.0 38.0 38.0 31.0 38.0 10-14 35.9108 38.0 38.0 38.0 32.2 38.0 15-19 35.68814999999999 38.0 37.8 38.0 30.2 38.0 20-24 35.6984 38.0 38.0 38.0 30.8 38.0 25-29 35.47105 38.0 37.2 38.0 29.4 38.0 30-34 35.32745 38.0 37.0 38.0 28.8 38.0 35-39 35.2358 38.0 37.0 38.0 28.6 38.0 40-44 35.183499999999995 38.0 37.0 38.0 28.4 38.0 45-49 34.960950000000004 38.0 36.8 38.0 27.6 38.0 50-54 34.830200000000005 38.0 36.2 38.0 27.2 38.0 55-59 34.5241 38.0 36.0 38.0 25.8 38.0 60-64 34.289300000000004 38.0 35.6 38.0 25.0 38.0 65-69 34.007 38.0 34.6 38.0 22.4 38.0 70-74 33.60289999999999 38.0 34.2 38.0 17.2 38.0 75-79 33.21365 38.0 34.0 38.0 15.0 38.0 80-84 33.0039 38.0 34.0 38.0 15.0 38.0 85-89 32.4799 38.0 33.2 38.0 15.0 38.0 90-94 32.044799999999995 37.8 31.8 38.0 14.8 38.0 95-99 31.34515 37.0 29.8 38.0 14.2 38.0 100-104 30.9923 37.0 28.8 38.0 13.2 38.0 105-109 30.3973 36.0 27.0 38.0 13.0 38.0 110-114 29.91445 36.0 25.6 38.0 13.0 38.0 115-119 28.86875 35.0 23.0 38.0 4.2 38.0 120-124 28.071350000000002 34.0 19.8 38.0 2.0 38.0 125-129 27.0409 33.2 14.8 38.0 2.0 38.0 130-134 25.8228 32.4 13.6 38.0 2.0 38.0 135-139 23.772399999999998 29.8 10.2 37.6 2.0 38.0 140-144 21.9842 29.0 2.0 36.0 2.0 38.0 145-149 18.6867 17.2 2.0 34.4 2.0 38.0 150 12.74375 2.0 2.0 31.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 14.0 4 7.0 5 9.0 6 4.0 7 9.0 8 14.0 9 15.0 10 13.0 11 12.0 12 16.0 13 13.0 14 19.0 15 24.0 16 16.0 17 27.0 18 33.0 19 34.0 20 28.0 21 37.0 22 39.0 23 47.0 24 58.0 25 61.0 26 87.0 27 108.0 28 113.0 29 135.0 30 168.0 31 229.0 32 282.0 33 332.0 34 415.0 35 558.0 36 687.0 37 305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.61410996736129 17.42405222194326 9.465227215666584 34.49661059502887 2 28.230266465560582 23.40372046254399 29.61287078934138 18.753142282554048 3 24.081529944640163 23.50276799194766 28.10770005032713 24.308002013085055 4 26.270759939607448 29.768495218922997 17.815802717664823 26.144942123804732 5 29.959718026183285 32.477341389728096 18.07653575025176 19.486404833836858 6 23.981900452488688 34.11261940673705 18.753142282554048 23.15233785822021 7 22.537688442211053 19.849246231155778 34.12060301507538 23.492462311557787 8 22.462311557788944 22.587939698492463 25.201005025125628 29.748743718592962 9 26.20603015075377 20.85427135678392 24.87437185929648 28.065326633165828 10-14 26.893120948696048 24.737450379377922 22.250138184010854 26.11929048791518 15-19 26.63685241947641 24.536455454499773 23.662127531279836 25.164564594743982 20-24 27.23344387498744 25.364284996482766 23.26399356848558 24.138277560044216 25-29 26.637861736334408 25.38183279742765 22.970257234726688 25.010048231511256 30-34 26.52835685939619 25.29261063947355 23.68011252323303 24.49891997789722 35-39 26.335091685506157 24.772670183371012 23.59708615925647 25.295151971866364 40-44 27.461322081575247 24.161141249748844 23.618645770544504 24.758890898131405 45-49 26.822406430545087 24.400904295403166 23.793016829942225 24.98367244410952 50-54 26.439553813687066 24.696010451210935 23.55039694503065 25.314038790071347 55-59 26.783561093247588 24.703577170418008 24.045418006430868 24.467443729903536 60-64 25.89204945220625 25.58046034777365 23.575233691828323 24.952256508191777 65-69 25.714860043218252 25.649530127142068 23.373033820795015 25.26257600884467 70-74 26.105527638190956 24.78391959798995 23.869346733668344 25.241206030150753 75-79 26.344356216705194 24.716051864508994 24.012463564177306 24.927128354608502 80-84 26.565483968238013 24.726103125942306 23.58025932254498 25.1281535832747 85-89 26.299386749773802 25.233738815723335 23.288428671961395 25.178445762541468 90-94 26.541999698386366 25.21992660734932 23.726939124315084 24.511134569949228 95-99 26.184851987736845 25.25506357742373 23.76740212092275 24.79268231391667 100-104 26.713567839195978 25.381909547738697 23.21608040201005 24.688442211055275 105-109 25.600683623202976 25.796722629938674 23.58500050266412 25.01759324419423 110-114 26.112088464438298 25.08670520231214 23.327469213370193 25.47373711987937 115-119 26.09569762766385 25.512665862484923 23.240852432649778 25.15078407720145 120-124 26.120828307197424 25.628266988339366 23.0448331322879 25.206071572175308 125-129 26.29780390974421 25.895773656967684 22.955927433539376 24.850494999748733 130-134 26.672362667738852 25.83806604010655 23.06880434236317 24.420766949791425 135-139 26.72998643147897 25.92090054776622 22.965978189858788 24.383134830896026 140-144 27.16216895321373 26.478717523493643 21.885521885521886 24.473591637770742 145-149 26.797583081571 26.364551863041292 22.784491440080565 24.05337361530715 150 28.359708615925648 25.872896257221807 22.07987942727958 23.687515699572973 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 17.0 1 9.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 2.0 27 2.0 28 3.0 29 4.5 30 4.5 31 5.5 32 7.0 33 11.0 34 20.5 35 27.5 36 38.5 37 45.5 38 58.0 39 81.5 40 97.0 41 109.5 42 125.0 43 150.5 44 163.0 45 171.0 46 183.5 47 173.0 48 151.5 49 141.0 50 136.0 51 136.0 52 124.5 53 109.5 54 103.5 55 109.5 56 116.0 57 116.5 58 119.5 59 117.5 60 121.5 61 122.5 62 104.0 63 91.0 64 92.0 65 86.5 66 82.0 67 72.0 68 66.0 69 54.0 70 35.0 71 28.5 72 23.0 73 13.0 74 7.0 75 5.5 76 2.5 77 1.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.5499999999999999 3 0.65 4 0.65 5 0.7000000000000001 6 0.5499999999999999 7 0.5 8 0.5 9 0.5 10-14 0.49500000000000005 15-19 0.49500000000000005 20-24 0.49 25-29 0.48 30-34 0.46499999999999997 35-39 0.475 40-44 0.45999999999999996 45-49 0.475 50-54 0.49 55-59 0.48 60-64 0.51 65-69 0.505 70-74 0.5 75-79 0.51 80-84 0.51 85-89 0.53 90-94 0.5349999999999999 95-99 0.515 100-104 0.5 105-109 0.53 110-114 0.525 115-119 0.52 120-124 0.52 125-129 0.505 130-134 0.515 135-139 0.505 140-144 0.505 145-149 0.7000000000000001 150 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.38004628439188 95.65 2 1.3885317562355362 2.7 3 0.1285677552069941 0.375 4 0.05142710208279763 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05142710208279763 1.075 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 26 0.65 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAGG 10 0.006970298 144.0 8 ACCTTCA 10 0.006970298 144.0 6 >>END_MODULE Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204805 spots for SRR8096905.sra Written 2204805 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra Read 2204802 spots for SRR8096905.sra Written 2204802 spots for SRR8096905.sra SRR ids: ['SRR8096905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qwen911z SRR8096905.sra spots: 44096043 blocks: [[1, 2204802], [2204803, 4409604], [4409605, 6614406], [6614407, 8819208], [8819209, 11024010], [11024011, 13228812], [13228813, 15433614], [15433615, 17638416], [17638417, 19843218], [19843219, 22048020], [22048021, 24252822], [24252823, 26457624], [26457625, 28662426], [28662427, 30867228], [30867229, 33072030], [33072031, 35276832], [35276833, 37481634], [37481635, 39686436], [39686437, 41891238], [41891239, 44096043]] SRR8096905 file size 14834876 SRR8096905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096905 SRR8096905_1.fastq SRR8096905_2.fastq Input file: SRR8096905_1.fastq Paired file: SRR8096905_2.fastq trimmed: SRR8096905-trimmed-pair1.fastq, SRR8096905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Dec 8 13:27:08 2024 >> started Sun Dec 8 13:32:34 2024 >> done (326.345s) 44096043 read pairs processed; of these: 128647 ( 0.29%) short read pairs filtered out after trimming by size control 1215338 ( 2.76%) empty read pairs filtered out after trimming by size control 42752058 (96.95%) read pairs available; of these: 26005423 (60.83%) trimmed read pairs available after processing 16746635 (39.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 73 0.00% 19 601 0.00% 20 817 0.00% 21 106 0.00% 22 186 0.00% 23 93 0.00% 24 165 0.00% 25 90 0.00% 26 96 0.00% 27 126 0.00% 28 121 0.00% 29 160 0.00% 30 155 0.00% 31 145 0.00% 32 166 0.00% 33 160 0.00% 34 246 0.00% 35 387 0.00% 36 240 0.00% 37 257 0.00% 38 282 0.00% 39 385 0.00% 40 558 0.00% 41 460 0.00% 42 473 0.00% 43 519 0.00% 44 613 0.00% 45 882 0.00% 46 1002 0.00% 47 952 0.00% 48 1017 0.00% 49 1154 0.00% 50 1235 0.00% 51 1247 0.00% 52 1225 0.00% 53 1357 0.00% 54 1525 0.00% 55 1592 0.00% 56 1707 0.00% 57 1632 0.00% 58 2405 0.01% 59 3337 0.01% 60 2669 0.01% 61 8978 0.02% 62 3120 0.01% 63 1935 0.00% 64 2109 0.00% 65 2249 0.01% 66 2294 0.01% 67 2563 0.01% 68 3103 0.01% 69 4467 0.01% 70 4314 0.01% 71 3561 0.01% 72 3801 0.01% 73 4596 0.01% 74 4354 0.01% 75 4726 0.01% 76 5132 0.01% 77 5640 0.01% 78 6178 0.01% 79 6965 0.02% 80 7599 0.02% 81 8279 0.02% 82 10077 0.02% 83 12333 0.03% 84 18507 0.04% 85 20422 0.05% 86 23366 0.05% 87 25682 0.06% 88 25952 0.06% 89 26332 0.06% 90 26094 0.06% 91 26505 0.06% 92 26727 0.06% 93 27736 0.06% 94 29413 0.07% 95 30985 0.07% 96 33622 0.08% 97 36689 0.09% 98 39067 0.09% 99 41278 0.10% 100 42726 0.10% 101 45913 0.11% 102 48726 0.11% 103 52342 0.12% 104 55960 0.13% 105 60098 0.14% 106 60943 0.14% 107 62767 0.15% 108 69124 0.16% 109 67314 0.16% 110 69040 0.16% 111 71400 0.17% 112 74023 0.17% 113 76933 0.18% 114 80818 0.19% 115 84841 0.20% 116 88019 0.21% 117 92429 0.22% 118 96403 0.23% 119 101000 0.24% 120 105607 0.25% 121 112060 0.26% 122 117680 0.28% 123 122592 0.29% 124 129348 0.30% 125 136682 0.32% 126 147132 0.34% 127 153327 0.36% 128 162336 0.38% 129 171778 0.40% 130 181280 0.42% 131 193868 0.45% 132 205607 0.48% 133 220781 0.52% 134 235476 0.55% 135 250544 0.59% 136 272990 0.64% 137 292827 0.68% 138 317845 0.74% 139 346674 0.81% 140 379253 0.89% 141 423537 0.99% 142 472101 1.10% 143 534519 1.25% 144 641370 1.50% 145 784777 1.84% 146 1050031 2.46% 147 1553822 3.63% 148 2989233 6.99% 149 11290159 26.41% 150 16746635 39.17% 42752058 reads passed initial QC criterion=sequence-density sequence-density=1.67 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=14 prefix-density=1.72 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.49 sequence-density-rank=12 fanout-score=9.92 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=4.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.22 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=12 prefix-density=1.35 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=14.59 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.9 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR8096905 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 08 13:37:10 Started mapping on | Dec 08 13:37:11 Finished on | Dec 08 14:21:09 Mapping speed, Million of reads per hour | 58.34 Number of input reads | 42752058 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 41138907 Uniquely mapped reads % | 96.23% Average mapped length | 290.10 Number of splices: Total | 40210323 Number of splices: Annotated (sjdb) | 37980268 Number of splices: GT/AG | 39674357 Number of splices: GC/AG | 465611 Number of splices: AT/AC | 11085 Number of splices: Non-canonical | 59270 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440935 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 15014 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1322314 1322314 1322314 N_multimapping 440935 440935 440935 N_noFeature 1358564 39815568 1682543 N_ambiguous 1173999 4689 178887 UnstrandedReadsAssigned:38606344 PositiveStrandReadsAssigned:1318650 NegativeStrandReadsAssigned:39277477 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096905 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096905-trimmed-pair1.fastq SRR8096905-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,752,058 reads, 39,273,397 reads pseudoaligned [quant] estimated average fragment length: 268.667 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52973 SRR8096905.ke.tsv 35125 SRR8096905.se.tsv 88098 total ==> SRR8096905.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.734 0 0 PNS24247 1044 776.333 94.0327 4.05359 PNS24249 1928 1660.33 40.7249 0.820869 PNS24246 1044 776.333 94.0327 4.05359 PNS24248 1044 776.333 94.0327 4.05359 PNS24244 1471 1203.33 358.177 9.9614 PNS24243 293 84.5371 0 0 KQK14069 1603 1335.33 11690.2 292.982 KQK14071 474 223.652 262.641 39.3005 ==> SRR8096905.se.tsv <== BRADI_1g14170v3 13918 BRADI_1g53295v3 70 BRADI_1g59795v3 1832 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 841 BRADI_1g74790v3 188 BRADI_1g09890v3 0 BRADI_1g77505v3 566 BRADI_1g48960v3 0 SRR8096905 completed mapping pipeline successfully