Starting /dee2/code/volunteer_pipeline.sh SRR8096907 current disk space = 1539990433792 free memory = 1421412528 SRR8096907 SRAfilesize a5714c426312a1f798c7da4df58849cc SRR8096907.sra SRR8096907.sra file validated SRR8096907 is paired end SRR8096907 is conventional basespace SRR8096907 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.92325 34.0 33.0 34.0 32.0 34.0 2 33.03075 34.0 33.0 34.0 32.0 34.0 3 33.08475 34.0 33.0 34.0 32.0 34.0 4 33.1615 34.0 33.0 34.0 32.0 34.0 5 33.20975 34.0 33.0 34.0 32.0 34.0 6 36.9895 38.0 37.0 38.0 35.0 38.0 7 37.1695 38.0 38.0 38.0 36.0 38.0 8 37.34025 38.0 38.0 38.0 37.0 38.0 9 37.3845 38.0 38.0 38.0 37.0 38.0 10-14 37.39155 38.0 38.0 38.0 37.0 38.0 15-19 37.26745 38.0 38.0 38.0 36.6 38.0 20-24 37.35785 38.0 38.0 38.0 37.0 38.0 25-29 37.2983 38.0 38.0 38.0 37.0 38.0 30-34 37.239700000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.14145 38.0 38.0 38.0 36.8 38.0 40-44 37.027750000000005 38.0 38.0 38.0 36.4 38.0 45-49 37.02875 38.0 38.0 38.0 36.4 38.0 50-54 37.04775 38.0 38.0 38.0 36.0 38.0 55-59 36.938550000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.713300000000004 38.0 38.0 38.0 35.6 38.0 65-69 36.41705 38.0 38.0 38.0 34.6 38.0 70-74 36.2324 38.0 38.0 38.0 33.2 38.0 75-79 35.55105 38.0 38.0 38.0 32.4 38.0 80-84 35.60645 38.0 38.0 38.0 33.4 38.0 85-89 35.5382 38.0 38.0 38.0 33.2 38.0 90-94 35.45 38.0 38.0 38.0 32.6 38.0 95-99 35.37595 38.0 38.0 38.0 32.6 38.0 100-104 35.024300000000004 38.0 38.0 38.0 30.0 38.0 105-109 34.79085 38.0 38.0 38.0 28.2 38.0 110-114 34.734899999999996 38.0 38.0 38.0 28.2 38.0 115-119 34.63985 38.0 37.6 38.0 28.0 38.0 120-124 34.4505 38.0 37.2 38.0 26.2 38.0 125-129 34.01265 38.0 36.2 38.0 22.6 38.0 130-134 33.646899999999995 38.0 36.0 38.0 14.6 38.0 135-139 33.420649999999995 38.0 35.8 38.0 14.2 38.0 140-144 33.25515 38.0 35.4 38.0 13.2 38.0 145-149 32.4884 38.0 35.0 38.0 4.2 38.0 150 27.50925 35.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 3.0 8 5.0 9 2.0 10 2.0 11 3.0 12 2.0 13 5.0 14 1.0 15 3.0 16 13.0 17 8.0 18 36.0 19 69.0 20 6.0 21 14.0 22 19.0 23 16.0 24 16.0 25 14.0 26 21.0 27 28.0 28 43.0 29 66.0 30 42.0 31 59.0 32 52.0 33 74.0 34 113.0 35 175.0 36 395.0 37 2692.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.12927657351789 12.92765735178898 7.443196657090624 34.49986941760251 2 23.1 21.025 33.725 22.15 3 21.4 20.5 29.95 28.15 4 26.275 25.4 20.5 27.825 5 31.05 29.049999999999997 22.8 17.1 6 25.424999999999997 30.5 22.35 21.725 7 16.975 27.1 36.625 19.3 8 19.025 26.35 28.15 26.474999999999998 9 25.775 19.25 29.925 25.05 10-14 23.085 26.57 24.2 26.145000000000003 15-19 23.275000000000002 24.245 25.805 26.674999999999997 20-24 22.93 26.240000000000002 25.485000000000003 25.345000000000002 25-29 23.205000000000002 24.42 25.645 26.729999999999997 30-34 22.470000000000002 24.529999999999998 25.380000000000003 27.62 35-39 23.005 26.195 25.629999999999995 25.169999999999998 40-44 22.16 24.695 27.11 26.035000000000004 45-49 24.474999999999998 24.55 27.01 23.965 50-54 23.54 23.115 26.08 27.265 55-59 23.185 23.09 28.425 25.3 60-64 23.68 24.740000000000002 26.145000000000003 25.435000000000002 65-69 22.515 29.035 24.465 23.985 70-74 23.11 28.665000000000003 24.05 24.175 75-79 22.48 27.325 24.67 25.525 80-84 23.925 25.385 25.119999999999997 25.569999999999997 85-89 23.035 25.380000000000003 25.380000000000003 26.205000000000002 90-94 23.919999999999998 24.615000000000002 25.330000000000002 26.135 95-99 23.45 25.83 24.125 26.595000000000002 100-104 23.544999999999998 26.31 25.275 24.87 105-109 23.73 25.759999999999998 24.645 25.865 110-114 23.815 25.745 24.615000000000002 25.825 115-119 24.025 24.97 25.590000000000003 25.415 120-124 24.3 24.77 24.759999999999998 26.169999999999998 125-129 23.945 27.355 24.18 24.52 130-134 23.810000000000002 28.415000000000003 23.285 24.490000000000002 135-139 22.78 27.310000000000002 23.78 26.13 140-144 23.565 25.885 24.3 26.25 145-149 23.815 25.505 25.080000000000002 25.6 150 22.75 25.924999999999997 24.425 26.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 15.0 1 12.0 2 4.5 3 1.0 4 2.0 5 3.5 6 3.5 7 1.5 8 0.5 9 1.0 10 1.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 2.0 17 1.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 3.0 27 2.0 28 3.5 29 6.0 30 8.5 31 15.5 32 20.0 33 19.0 34 22.5 35 38.5 36 58.0 37 78.0 38 92.0 39 102.5 40 111.0 41 127.0 42 152.5 43 165.5 44 165.5 45 174.0 46 181.0 47 170.5 48 183.0 49 192.0 50 174.0 51 151.5 52 128.5 53 108.5 54 94.5 55 89.0 56 86.0 57 96.0 58 95.5 59 96.0 60 97.0 61 90.0 62 79.5 63 73.0 64 76.5 65 69.0 66 56.0 67 47.5 68 42.5 69 32.0 70 21.5 71 15.5 72 13.5 73 11.5 74 7.0 75 3.0 76 3.0 77 2.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 97.64254385964912 89.05 2 1.836622807017544 3.35 3 0.3015350877192982 0.8250000000000001 4 0.08223684210526315 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.05482456140350877 0.4 9 0.027412280701754384 0.22499999999999998 >10 0.027412280701754384 0.525 >50 0.0 0.0 >100 0.027412280701754384 5.325 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 213 5.325 TruSeq Adapter, Index 7 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 21 0.525 No Hit ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC 9 0.22499999999999998 TruSeq Adapter, Index 7 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG 8 0.2 TruSeq Adapter, Index 7 (100% over 49bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 8 0.2 TruSeq Adapter, Index 7 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10-11 0.3 0.0 0.0 0.0 0.0 12-13 0.3125 0.0 0.0 0.0 0.0 14-15 0.325 0.0 0.0 0.0 0.0 16-17 0.3375 0.0 0.0 0.0 0.0 18-19 0.35 0.0 0.0 0.0 0.0 20-21 0.35 0.0 0.0 0.0 0.0 22-23 0.35 0.0 0.0 0.0 0.0 24-25 0.35 0.0 0.0 0.0 0.0 26-27 0.35 0.0 0.0 0.0 0.0 28-29 0.35 0.0 0.0 0.0 0.0 30-31 0.35 0.0 0.0 0.0 0.0 32-33 0.35 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.35 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.3625 0.0 0.0 0.0 0.0 42-43 0.375 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.375 0.0 0.0 0.0 0.0 48-49 0.375 0.0 0.0 0.0 0.0 50-51 0.375 0.0 0.0 0.0 0.0 52-53 0.375 0.0 0.0 0.0 0.0 54-55 0.375 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.4125 0.0 0.0 0.0 0.0 62-63 0.5125 0.0 0.0 0.0 0.0 64-65 0.55 0.0 0.0 0.0 0.0 66-67 0.55 0.0 0.0 0.0 0.0 68-69 0.55 0.0 0.0 0.0 0.0 70-71 0.55 0.0 0.0 0.0 0.0 72-73 0.6 0.0 0.0 0.0 0.0 74-75 0.6 0.0 0.0 0.0 0.0 76-77 0.6 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.6625000000000001 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.9 0.0 0.0 0.0 0.0 130-131 3.0875000000000004 0.0 0.0 0.0 0.0 132-133 3.2125 0.0 0.0 0.0 0.0 134-135 3.425 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAAG 10 0.0069772652 143.975 6 GAAGCCT 10 0.0069772652 143.975 9 GAGCACA 45 8.805728E-9 95.98334 9 TCGGAAG 50 1.8309947E-8 86.385 3 AGAGCAC 50 1.8309947E-8 86.385 8 ATCGGAA 50 1.8309947E-8 86.385 2 GATCGGA 45 9.1275797E-7 82.03704 1 AAGAGCA 55 3.5483026E-8 78.53182 7 GAAGAGC 55 3.5483026E-8 78.53182 6 CGGAAGA 60 6.488335E-8 71.9875 4 GGAAGAG 65 1.129938E-7 66.450005 5 TTGAAAA 35 0.0036850644 20.567858 60-64 CTTGAAA 35 0.0036850644 20.567858 60-64 TGAAAAA 35 0.0036850644 20.567858 60-64 ATCATCT 45 6.871639E-4 19.196669 35-39 GTCACCA 55 1.2320667E-4 18.324091 25-29 GAAAAAA 40 0.007974719 17.996876 60-64 GCTTGAA 40 0.007974719 17.996876 55-59 CAGTCAC 50 0.0013945919 17.277 25-29 CCAGTCA 50 0.0013945919 17.277 25-29 >>END_MODULE SRR8096907 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096907_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0985 33.0 31.0 33.0 18.0 34.0 2 30.56975 33.0 32.0 33.0 25.0 34.0 3 30.1135 33.0 31.0 33.0 18.0 34.0 4 30.3585 33.0 32.0 33.0 15.0 34.0 5 29.9945 33.0 31.0 33.0 15.0 34.0 6 33.87875 38.0 34.0 38.0 16.0 38.0 7 33.96175 38.0 35.0 38.0 16.0 38.0 8 34.351 38.0 36.0 38.0 26.0 38.0 9 34.2255 38.0 36.0 38.0 26.0 38.0 10-14 33.5997 38.0 34.6 38.0 16.0 38.0 15-19 33.201 38.0 34.0 38.0 16.0 38.0 20-24 33.034949999999995 38.0 34.0 38.0 16.0 38.0 25-29 32.69965 38.0 33.4 38.0 16.0 38.0 30-34 32.442099999999996 38.0 33.0 38.0 16.0 38.0 35-39 31.992850000000004 38.0 31.0 38.0 16.0 38.0 40-44 31.889549999999996 38.0 31.4 38.0 14.8 38.0 45-49 31.308249999999997 37.0 29.0 38.0 14.0 38.0 50-54 31.09115 37.0 29.0 38.0 14.0 38.0 55-59 30.707 37.0 27.8 38.0 14.0 38.0 60-64 30.43135 37.0 27.4 38.0 14.0 38.0 65-69 29.964049999999997 36.0 27.0 38.0 9.2 38.0 70-74 29.212650000000004 36.0 24.8 38.0 2.0 38.0 75-79 28.6056 35.4 19.2 38.0 2.0 38.0 80-84 27.991149999999998 34.6 15.8 38.0 2.0 38.0 85-89 27.509149999999998 34.4 15.2 38.0 2.0 38.0 90-94 26.561899999999998 34.0 15.0 38.0 2.0 38.0 95-99 25.967550000000006 33.8 15.0 38.0 2.0 38.0 100-104 25.0678 32.0 14.6 37.2 2.0 38.0 105-109 24.0954 30.0 13.0 37.0 2.0 38.0 110-114 23.14595 28.0 13.0 36.4 2.0 38.0 115-119 22.1188 26.2 2.0 36.0 2.0 38.0 120-124 21.03865 23.4 2.0 35.0 2.0 38.0 125-129 19.55215 20.2 2.0 34.8 2.0 38.0 130-134 18.31375 14.8 2.0 34.0 2.0 38.0 135-139 16.6416 13.6 2.0 34.0 2.0 38.0 140-144 14.847100000000001 6.4 2.0 32.0 2.0 36.4 145-149 12.419550000000001 2.0 2.0 29.2 2.0 36.0 150 8.39775 2.0 2.0 2.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 113.0 3 52.0 4 38.0 5 17.0 6 26.0 7 32.0 8 26.0 9 18.0 10 19.0 11 33.0 12 48.0 13 37.0 14 59.0 15 42.0 16 51.0 17 63.0 18 55.0 19 57.0 20 82.0 21 75.0 22 93.0 23 100.0 24 103.0 25 126.0 26 133.0 27 161.0 28 164.0 29 174.0 30 214.0 31 266.0 32 294.0 33 350.0 34 353.0 35 296.0 36 197.0 37 33.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.88205771643664 17.465495608531995 9.234629861982434 31.417816813048933 2 25.68691706579279 27.32543483740862 27.300226871691454 19.687421225107133 3 22.648171500630518 22.62295081967213 31.475409836065577 23.25346784363178 4 24.596367305751766 28.128153380423814 18.340060544904137 28.935418768920286 5 31.104944500504537 30.171543895055496 17.81029263370333 20.91321897073663 6 27.68803634528016 31.978798586572438 18.576476527006562 21.756688541140836 7 21.19071644803229 21.644803229061555 34.10696266397578 23.057517658930372 8 21.01412714429869 26.488395560040363 23.83955600403633 28.65792129162462 9 29.112008072653882 20.181634712411707 23.990918264379417 26.715438950554994 10-14 27.717226763548293 24.775456655565648 21.662125340599456 25.845191240286606 15-19 27.397052886556317 23.233750504642714 23.909971740008075 25.459224868792894 20-24 28.587285570131183 26.16044399596367 21.84661957618567 23.405650857719476 25-29 26.932391523713424 26.937436932391524 22.149344096871847 23.98082744702321 30-34 26.995660510646886 24.992431123221316 24.331415884549397 23.680492481582398 35-39 26.115035317860745 25.242179616548942 23.642785065590314 25.0 40-44 29.095403864588064 24.317642903990716 22.531658342162352 24.055294889258867 45-49 27.129162462159435 23.773965691220987 22.91624621594349 26.180625630676087 50-54 26.271442986881937 24.03128153380424 23.834510595358225 25.862764883955602 55-59 25.529767911200807 25.55499495459132 24.485368314833504 24.42986881937437 60-64 24.409568025837707 29.1683488090432 22.51715785224061 23.904925312878483 65-69 24.57088045234249 28.81663974151858 22.37479806138934 24.237681744749594 70-74 26.08651759123719 27.368633587400936 22.013023067992528 24.53182575336934 75-79 24.820761385438754 26.61819650610926 22.81631828738766 25.744723821064326 80-84 25.694374305625693 26.64882335117665 23.113826886173115 24.542975457024543 85-89 25.410208512142173 26.970263038319786 23.168576765789872 24.45095168374817 90-94 26.36281041792853 26.574803149606304 22.516656571774682 24.54572986069049 95-99 25.015151515151512 26.696969696969695 23.595959595959595 24.691919191919194 100-104 26.04261334949005 26.709078057154397 22.9071998384328 24.34110875492275 105-109 25.661482528782066 27.494445566552212 22.081397697434863 24.762674207230862 110-114 25.51257448742551 27.628522371477626 21.957378042621958 24.901525098474902 115-119 25.045454545454543 27.85858585858586 22.42929292929293 24.666666666666668 120-124 25.075757575757574 28.106060606060606 22.065656565656568 24.752525252525253 125-129 25.343434343434346 28.43939393939394 22.12121212121212 24.095959595959595 130-134 25.169209011011212 28.957470451560763 22.239620163652894 23.63370037377513 135-139 25.68672995354474 28.575035346394667 21.85922035952333 23.879014340537267 140-144 24.56955314314567 29.74501388538248 21.519818227720272 24.16561474375158 145-149 24.955770105646263 28.964262245362182 21.730778951625133 24.349188697366426 150 25.40404040404041 31.818181818181817 19.41919191919192 23.358585858585858 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 17.5 2 8.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 2.0 23 2.0 24 1.0 25 2.0 26 4.5 27 3.5 28 3.0 29 6.5 30 8.5 31 11.5 32 10.5 33 14.0 34 29.5 35 39.5 36 48.5 37 64.5 38 79.0 39 86.5 40 90.0 41 110.0 42 122.0 43 135.0 44 146.0 45 151.0 46 156.0 47 162.0 48 163.0 49 152.5 50 144.5 51 131.0 52 114.5 53 106.5 54 111.0 55 115.0 56 115.5 57 112.0 58 118.0 59 112.5 60 102.5 61 102.0 62 109.0 63 101.5 64 86.5 65 86.5 66 81.5 67 62.5 68 45.0 69 44.5 70 43.0 71 33.5 72 26.5 73 21.0 74 12.0 75 4.5 76 1.5 77 1.0 78 2.5 79 2.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.8250000000000001 3 0.8750000000000001 4 0.8999999999999999 5 0.8999999999999999 6 0.95 7 0.8999999999999999 8 0.8999999999999999 9 0.8999999999999999 10-14 0.91 15-19 0.9199999999999999 20-24 0.8999999999999999 25-29 0.8999999999999999 30-34 0.91 35-39 0.8999999999999999 40-44 0.895 45-49 0.8999999999999999 50-54 0.8999999999999999 55-59 0.8999999999999999 60-64 0.9199999999999999 65-69 0.96 70-74 0.9450000000000001 75-79 0.97 80-84 0.9900000000000001 85-89 0.9650000000000001 90-94 0.9400000000000001 95-99 1.0 100-104 0.97 105-109 0.98 110-114 0.9900000000000001 115-119 1.0 120-124 1.0 125-129 1.0 130-134 1.01 135-139 0.98 140-144 0.975 145-149 1.085 150 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26064382139148 94.625 2 1.3499480789200415 2.6 3 0.20768431983385255 0.6 4 0.05192107995846314 0.2 5 0.0 0.0 6 0.02596053997923157 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02596053997923157 0.22499999999999998 >10 0.0778816199376947 1.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 39 0.975 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 15 0.375 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 9 0.22499999999999998 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.1875 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.21250000000000002 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.2375 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.25 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGCC 10 0.007143492 142.82278 9 GGCAATC 10 0.007143492 142.82278 2 GATCGGA 20 2.0230655E-6 142.82278 1 TCGGAAG 20 2.0230655E-6 142.82278 3 AGAGCGC 10 0.007143492 142.82278 8 ATCGGAA 20 2.0230655E-6 142.82278 2 GTGAAGT 10 0.007143492 142.82278 1 GAGCGTC 15 1.2108619E-4 142.82277 9 AGAGCGT 15 1.2108619E-4 142.82277 8 GAAGAGC 30 9.961332E-8 119.01898 6 CGGAAGA 30 9.961332E-8 119.01898 4 AAGAGCG 35 2.4979818E-7 102.01627 7 GGAAGAG 35 3.2665004E-5 81.613014 5 GTAGGGA 25 5.1198364E-4 28.856777 15-19 TAGGGAA 20 0.006077124 28.856775 15-19 GAGTGTA 25 5.436138E-4 28.564558 25-29 GTGTAGA 20 0.0063885385 28.564558 25-29 AAGAGTG 25 5.436138E-4 28.564558 25-29 CATTAAA 20 0.0063885385 28.564558 50-54 AGAGTGT 25 5.436138E-4 28.564558 25-29 >>END_MODULE Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155972 spots for SRR8096907.sra Written 2155972 spots for SRR8096907.sra Read 2155980 spots for SRR8096907.sra Written 2155980 spots for SRR8096907.sra SRR ids: ['SRR8096907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ot680i2o SRR8096907.sra spots: 43119448 blocks: [[1, 2155972], [2155973, 4311944], [4311945, 6467916], [6467917, 8623888], [8623889, 10779860], [10779861, 12935832], [12935833, 15091804], [15091805, 17247776], [17247777, 19403748], [19403749, 21559720], [21559721, 23715692], [23715693, 25871664], [25871665, 28027636], [28027637, 30183608], [30183609, 32339580], [32339581, 34495552], [34495553, 36651524], [36651525, 38807496], [38807497, 40963468], [40963469, 43119448]] SRR8096907 file size 14505848 SRR8096907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096907 SRR8096907_1.fastq SRR8096907_2.fastq Input file: SRR8096907_1.fastq Paired file: SRR8096907_2.fastq trimmed: SRR8096907-trimmed-pair1.fastq, SRR8096907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 22:03:00 2024 >> started Sat Dec 7 22:09:05 2024 >> done (365.290s) 43119448 read pairs processed; of these: 285290 ( 0.66%) short read pairs filtered out after trimming by size control 3444206 ( 7.99%) empty read pairs filtered out after trimming by size control 39389952 (91.35%) read pairs available; of these: 23582450 (59.87%) trimmed read pairs available after processing 15807502 (40.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 160 0.00% 19 193 0.00% 20 111 0.00% 21 252 0.00% 22 304 0.00% 23 182 0.00% 24 237 0.00% 25 209 0.00% 26 406 0.00% 27 492 0.00% 28 413 0.00% 29 284 0.00% 30 404 0.00% 31 355 0.00% 32 412 0.00% 33 337 0.00% 34 685 0.00% 35 1039 0.00% 36 942 0.00% 37 1009 0.00% 38 1203 0.00% 39 1930 0.00% 40 5033 0.01% 41 3324 0.01% 42 2714 0.01% 43 2521 0.01% 44 2557 0.01% 45 3441 0.01% 46 4291 0.01% 47 3932 0.01% 48 5177 0.01% 49 5740 0.01% 50 8520 0.02% 51 7703 0.02% 52 5241 0.01% 53 6786 0.02% 54 6089 0.02% 55 9859 0.03% 56 10532 0.03% 57 6453 0.02% 58 9258 0.02% 59 12110 0.03% 60 9344 0.02% 61 40303 0.10% 62 12292 0.03% 63 3629 0.01% 64 3505 0.01% 65 3828 0.01% 66 3808 0.01% 67 4366 0.01% 68 5301 0.01% 69 8346 0.02% 70 7759 0.02% 71 5852 0.01% 72 5757 0.01% 73 7489 0.02% 74 5936 0.02% 75 6444 0.02% 76 6930 0.02% 77 7527 0.02% 78 8153 0.02% 79 9104 0.02% 80 9984 0.03% 81 10932 0.03% 82 12545 0.03% 83 16110 0.04% 84 29717 0.08% 85 31184 0.08% 86 34754 0.09% 87 36822 0.09% 88 36933 0.09% 89 36915 0.09% 90 36354 0.09% 91 35876 0.09% 92 36053 0.09% 93 36200 0.09% 94 38680 0.10% 95 40507 0.10% 96 42993 0.11% 97 46041 0.12% 98 49332 0.13% 99 52717 0.13% 100 53074 0.13% 101 56889 0.14% 102 60192 0.15% 103 63681 0.16% 104 67070 0.17% 105 69801 0.18% 106 74927 0.19% 107 76863 0.20% 108 81105 0.21% 109 82458 0.21% 110 85445 0.22% 111 90135 0.23% 112 93608 0.24% 113 98285 0.25% 114 100871 0.26% 115 105494 0.27% 116 110477 0.28% 117 116167 0.29% 118 120171 0.31% 119 127984 0.32% 120 135289 0.34% 121 140456 0.36% 122 147247 0.37% 123 154601 0.39% 124 162187 0.41% 125 171332 0.43% 126 179402 0.46% 127 188431 0.48% 128 198076 0.50% 129 207368 0.53% 130 219802 0.56% 131 233369 0.59% 132 243176 0.62% 133 257079 0.65% 134 270676 0.69% 135 290283 0.74% 136 314350 0.80% 137 337343 0.86% 138 360822 0.92% 139 386557 0.98% 140 420200 1.07% 141 461561 1.17% 142 505000 1.28% 143 569936 1.45% 144 643636 1.63% 145 786219 2.00% 146 1005445 2.55% 147 1416250 3.60% 148 2425098 6.16% 149 8047400 20.43% 150 15807502 40.13% 39389952 reads passed initial QC criterion=sequence-density sequence-density=2.17 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=10 prefix-density=2.22 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.43 sequence-density-rank=20 fanout-score=10.90 fanout-score-rank=1 prefix-density=1.22 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.39 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=15 prefix-density=1.51 prefix-fanout=2.4 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=20.08 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -y TGAAGCAGATCGAGTA -o SRR8096907 SRR8096907_1.fastq SRR8096907_2.fastq Input file: SRR8096907_1.fastq Paired file: SRR8096907_2.fastq trimmed: SRR8096907-trimmed-pair1.fastq, SRR8096907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -- paired 3' end adapter sequence (-y): TGAAGCAGATCGAGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 22:26:22 2024 >> started Sat Dec 7 22:27:45 2024 >> done (83.222s) 13129984 read pairs processed; of these: 1601 ( 0.01%) short read pairs filtered out after trimming by size control 5157 ( 0.04%) empty read pairs filtered out after trimming by size control 13123226 (99.95%) read pairs available; of these: 6424 ( 0.05%) trimmed read pairs available after processing 13116802 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 73 0.00% 19 77 0.00% 20 40 0.00% 21 96 0.00% 22 111 0.00% 23 75 0.00% 24 80 0.00% 25 79 0.00% 26 135 0.00% 27 157 0.00% 28 149 0.00% 29 107 0.00% 30 133 0.00% 31 119 0.00% 32 143 0.00% 33 116 0.00% 34 236 0.00% 35 309 0.00% 36 296 0.00% 37 334 0.00% 38 410 0.00% 39 627 0.00% 40 1683 0.01% 41 1145 0.01% 42 878 0.01% 43 838 0.01% 44 836 0.01% 45 1171 0.01% 46 1394 0.01% 47 1318 0.01% 48 1721 0.01% 49 1902 0.01% 50 2877 0.02% 51 2613 0.02% 52 1782 0.01% 53 2252 0.02% 54 1984 0.02% 55 3331 0.03% 56 3488 0.03% 57 2209 0.02% 58 3192 0.02% 59 3982 0.03% 60 3157 0.02% 61 13358 0.10% 62 4000 0.03% 63 1186 0.01% 64 1124 0.01% 65 1243 0.01% 66 1279 0.01% 67 1432 0.01% 68 1766 0.01% 69 2742 0.02% 70 2560 0.02% 71 1885 0.01% 72 1851 0.01% 73 2478 0.02% 74 2029 0.02% 75 2165 0.02% 76 2327 0.02% 77 2494 0.02% 78 2695 0.02% 79 3125 0.02% 80 3291 0.03% 81 3570 0.03% 82 4113 0.03% 83 5442 0.04% 84 9756 0.07% 85 10275 0.08% 86 11693 0.09% 87 12182 0.09% 88 12522 0.10% 89 12352 0.09% 90 12189 0.09% 91 11962 0.09% 92 12046 0.09% 93 11860 0.09% 94 12903 0.10% 95 13387 0.10% 96 14368 0.11% 97 15348 0.12% 98 16194 0.12% 99 17600 0.13% 100 17461 0.13% 101 18920 0.14% 102 19907 0.15% 103 21322 0.16% 104 22390 0.17% 105 23301 0.18% 106 24605 0.19% 107 25678 0.20% 108 26777 0.20% 109 27642 0.21% 110 28699 0.22% 111 30095 0.23% 112 31070 0.24% 113 32739 0.25% 114 33577 0.26% 115 35177 0.27% 116 36521 0.28% 117 38776 0.30% 118 40016 0.30% 119 42789 0.33% 120 44865 0.34% 121 46828 0.36% 122 49156 0.37% 123 51808 0.39% 124 54047 0.41% 125 56733 0.43% 126 60040 0.46% 127 63148 0.48% 128 65841 0.50% 129 69155 0.53% 130 73045 0.56% 131 77773 0.59% 132 80825 0.62% 133 85825 0.65% 134 90231 0.69% 135 97176 0.74% 136 105010 0.80% 137 112269 0.86% 138 120344 0.92% 139 128679 0.98% 140 139846 1.07% 141 153829 1.17% 142 168414 1.28% 143 190105 1.45% 144 214329 1.63% 145 262328 2.00% 146 335177 2.55% 147 471543 3.59% 148 807357 6.15% 149 2679484 20.42% 150 5268107 40.14% criterion=sequence-density sequence-density=2.17 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=10 prefix-density=2.23 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.44 sequence-density-rank=19 fanout-score=11.00 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.56 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=14 prefix-density=1.72 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=24.06 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR8096907 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 22:35:26 Started mapping on | Dec 07 22:35:26 Finished on | Dec 07 23:27:15 Mapping speed, Million of reads per hour | 45.60 Number of input reads | 39383194 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 37233308 Uniquely mapped reads % | 94.54% Average mapped length | 287.22 Number of splices: Total | 35365794 Number of splices: Annotated (sjdb) | 33550311 Number of splices: GT/AG | 34897481 Number of splices: GC/AG | 385953 Number of splices: AT/AC | 8953 Number of splices: Non-canonical | 73407 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 479199 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 14354 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1929998 1929998 1929998 N_multimapping 479199 479199 479199 N_noFeature 1096196 35997386 1383925 N_ambiguous 1103384 3918 159056 UnstrandedReadsAssigned:35033728 PositiveStrandReadsAssigned:1232004 NegativeStrandReadsAssigned:35690327 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096907 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096907-trimmed-pair1.fastq SRR8096907-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,383,194 reads, 35,571,950 reads pseudoaligned [quant] estimated average fragment length: 271.751 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR8096907.ke.tsv 35125 SRR8096907.se.tsv 88098 total ==> SRR8096907.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.664 0 0 PNS24247 1044 773.249 68.6601 3.22042 PNS24249 1928 1657.25 55.9885 1.22529 PNS24246 1044 773.249 68.6601 3.22042 PNS24248 1044 773.249 68.6601 3.22042 PNS24244 1471 1200.25 285.031 8.61288 PNS24243 293 82.9618 0 0 KQK14069 1603 1332.25 4407.96 120 KQK14071 474 220.806 139.173 22.8598 ==> SRR8096907.se.tsv <== BRADI_1g14170v3 5369 BRADI_1g53295v3 689 BRADI_1g59795v3 361 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 896 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 376 BRADI_1g48960v3 0 SRR8096907 completed mapping pipeline successfully