Starting /dee2/code/volunteer_pipeline.sh SRR8096910 current disk space = 1522053922816 free memory = 1449284704 SRR8096910 SRAfilesize ce68ec37df1e4047880bc531a55dc563 SRR8096910.sra SRR8096910.sra file validated SRR8096910 is paired end SRR8096910 is conventional basespace SRR8096910 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.585 34.0 33.0 34.0 32.0 34.0 2 33.06975 34.0 33.0 34.0 32.0 34.0 3 33.09275 34.0 33.0 34.0 31.0 34.0 4 33.37575 34.0 33.0 34.0 33.0 34.0 5 33.44475 34.0 33.0 34.0 33.0 34.0 6 36.99075 38.0 37.0 38.0 36.0 38.0 7 37.4345 38.0 38.0 38.0 37.0 38.0 8 37.38725 38.0 38.0 38.0 37.0 38.0 9 37.51475 38.0 38.0 38.0 37.0 38.0 10-14 37.497 38.0 38.0 38.0 37.4 38.0 15-19 37.4663 38.0 38.0 38.0 37.8 38.0 20-24 37.4504 38.0 38.0 38.0 37.0 38.0 25-29 37.44345 38.0 38.0 38.0 37.4 38.0 30-34 37.35785 38.0 38.0 38.0 37.2 38.0 35-39 37.3061 38.0 38.0 38.0 37.0 38.0 40-44 37.1391 38.0 38.0 38.0 36.4 38.0 45-49 37.1556 38.0 38.0 38.0 37.0 38.0 50-54 37.158550000000005 38.0 38.0 38.0 36.6 38.0 55-59 37.127250000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.97065 38.0 38.0 38.0 36.0 38.0 65-69 36.64895 38.0 38.0 38.0 35.4 38.0 70-74 36.6584 38.0 38.0 38.0 35.4 38.0 75-79 36.068850000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.0459 38.0 38.0 38.0 34.2 38.0 85-89 36.0702 38.0 38.0 38.0 34.0 38.0 90-94 35.2532 38.0 36.8 38.0 28.8 38.0 95-99 35.85594999999999 38.0 38.0 38.0 33.8 38.0 100-104 35.666199999999996 38.0 38.0 38.0 33.0 38.0 105-109 35.4709 38.0 38.0 38.0 32.4 38.0 110-114 34.90545000000001 38.0 36.8 38.0 27.4 38.0 115-119 35.2938 38.0 38.0 38.0 31.8 38.0 120-124 35.217 38.0 38.0 38.0 31.4 38.0 125-129 34.96375 38.0 38.0 38.0 30.6 38.0 130-134 34.808949999999996 38.0 37.4 38.0 29.6 38.0 135-139 34.52335 38.0 36.2 38.0 27.8 38.0 140-144 34.3323 38.0 36.0 38.0 26.8 38.0 145-149 33.93015 38.0 36.0 38.0 23.0 38.0 150 29.892 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 2.0 8 2.0 9 1.0 10 2.0 11 2.0 12 1.0 13 2.0 14 5.0 15 6.0 16 2.0 17 7.0 18 22.0 19 46.0 20 11.0 21 7.0 22 15.0 23 11.0 24 16.0 25 16.0 26 20.0 27 29.0 28 20.0 29 43.0 30 37.0 31 40.0 32 45.0 33 63.0 34 96.0 35 190.0 36 465.0 37 2774.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.46327234155397 11.64147440997083 7.212940864492177 37.68231238398303 2 23.5 19.7 34.725 22.075 3 22.475 20.549999999999997 27.150000000000002 29.825000000000003 4 26.3 28.325 18.875 26.5 5 28.225 31.4 22.650000000000002 17.724999999999998 6 24.5 31.374999999999996 22.900000000000002 21.224999999999998 7 18.65 24.55 37.574999999999996 19.225 8 19.7 24.95 30.425 24.925 9 23.75 20.349999999999998 31.175000000000004 24.725 10-14 23.64 26.99 23.76 25.61 15-19 23.215 25.5 25.21 26.075 20-24 23.24 26.505000000000003 25.264999999999997 24.990000000000002 25-29 23.44 25.040000000000003 25.435000000000002 26.085 30-34 22.23 25.575 26.3 25.895000000000003 35-39 23.345 25.88 24.635 26.14 40-44 22.86 25.03 26.419999999999998 25.69 45-49 23.635 25.174999999999997 26.085 25.105 50-54 23.485 24.145 25.430000000000003 26.939999999999998 55-59 23.61 24.625 25.745 26.02 60-64 23.630000000000003 25.045 25.935000000000002 25.39 65-69 22.674884746442174 27.084586089396673 24.90479053918621 25.335738624974947 70-74 23.445 27.29 24.12 25.145 75-79 23.61 27.12 24.26 25.009999999999998 80-84 23.715 25.64 24.88 25.765 85-89 23.895 26.125 23.885 26.095000000000002 90-94 23.76475295059012 25.345069013802764 24.26485297059412 26.625325065013 95-99 23.925981495373843 24.55613903475869 25.36134033508377 26.156539134783696 100-104 23.400000000000002 26.045 24.625 25.929999999999996 105-109 24.044999999999998 25.740000000000002 24.654999999999998 25.56 110-114 24.08 25.735000000000003 24.36 25.825 115-119 23.580000000000002 25.275 24.695 26.450000000000003 120-124 24.529999999999998 24.279999999999998 24.935 26.255 125-129 24.208631294694204 25.91388708306246 24.258638795819373 25.618842826423965 130-134 24.171042760690174 26.371592898224556 24.326081520380093 25.131282820705174 135-139 24.329731892757103 25.915366146458584 23.74449779911965 26.010404161664667 140-144 24.02321276702186 25.403972184701583 24.108259542748513 26.464555505528043 145-149 24.542362708812643 25.0925277583275 24.45233570071021 25.912773832149643 150 22.15 27.3 24.45 26.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 4.0 2 0.5 3 3.0 4 3.0 5 1.5 6 2.0 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.5 25 2.5 26 2.0 27 4.0 28 5.5 29 6.0 30 10.0 31 15.5 32 17.5 33 20.5 34 28.5 35 47.5 36 69.5 37 80.5 38 89.0 39 112.0 40 121.0 41 143.0 42 168.0 43 167.0 44 156.0 45 152.5 46 171.5 47 173.5 48 165.0 49 159.0 50 156.0 51 141.0 52 123.0 53 102.5 54 85.0 55 90.5 56 107.5 57 113.0 58 100.5 59 118.0 60 119.0 61 96.5 62 88.0 63 67.5 64 61.5 65 65.5 66 53.5 67 41.0 68 34.0 69 29.0 70 25.5 71 20.0 72 15.0 73 11.0 74 7.5 75 5.0 76 6.0 77 3.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.7250000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.22 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.025 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.025 135-139 0.04 140-144 0.055 145-149 0.03 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 98.0917042141532 92.525 2 1.3252054068380599 2.5 3 0.45056983832494035 1.275 4 0.0 0.0 5 0.05300821627352239 0.25 6 0.0 0.0 7 0.05300821627352239 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026504108136761195 3.1 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 124 3.1 TruSeq Adapter, Index 4 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit NATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 4 (98% over 50bp) GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATG 5 0.125 TruSeq Adapter, Index 4 (100% over 49bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.16249999999999998 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.5375 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.7625 0.0 0.0 0.0 0.0 138 5.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATT 10 0.0069845165 143.925 4 GAGCACA 45 1.0686472E-6 79.958336 9 AGAGCAC 45 1.0686472E-6 79.958336 8 AAGAGCA 50 1.9998042E-6 71.9625 7 GATCGGA 55 2.1827273E-6 70.724815 1 TCGGAAG 55 3.5233206E-6 65.420456 3 ATCGGAA 55 3.5233206E-6 65.420456 2 GAAGAGC 60 5.905982E-6 59.96875 6 GGAAGAG 60 5.905982E-6 59.96875 5 CGGAAGA 65 9.4945335E-6 55.35577 4 AATCTCG 25 5.1992905E-4 28.785 35-39 TCTCGTA 25 5.1992905E-4 28.785 40-44 CTCGTAT 25 5.1992905E-4 28.785 40-44 GTATGCC 30 0.0015077575 23.987501 45-49 ATCTCGT 30 0.0015077575 23.987501 40-44 TGCCGTC 30 0.0015077575 23.987501 45-49 TATGCCG 30 0.0015077575 23.987501 45-49 CAATCTC 30 0.0015077575 23.987501 35-39 CCGTCTT 30 0.0015077575 23.987501 50-54 ATGCCGT 30 0.0015077575 23.987501 45-49 >>END_MODULE SRR8096910 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8096910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2215 33.0 33.0 34.0 31.0 34.0 2 32.46875 33.0 33.0 34.0 32.0 34.0 3 32.0295 33.0 33.0 34.0 30.0 34.0 4 32.278 33.0 33.0 34.0 31.0 34.0 5 32.1595 33.0 33.0 34.0 31.0 34.0 6 36.4335 38.0 38.0 38.0 35.0 38.0 7 36.4345 38.0 38.0 38.0 34.0 38.0 8 36.45125 38.0 38.0 38.0 35.0 38.0 9 36.4 38.0 38.0 38.0 35.0 38.0 10-14 36.27395 38.0 38.0 38.0 34.0 38.0 15-19 36.151149999999994 38.0 38.0 38.0 34.0 38.0 20-24 36.208349999999996 38.0 38.0 38.0 34.0 38.0 25-29 36.17325 38.0 38.0 38.0 34.0 38.0 30-34 36.10625 38.0 38.0 38.0 33.6 38.0 35-39 36.033300000000004 38.0 38.0 38.0 33.4 38.0 40-44 36.2669 38.0 38.0 38.0 34.2 38.0 45-49 36.102599999999995 38.0 38.0 38.0 33.8 38.0 50-54 36.102199999999996 38.0 38.0 38.0 33.6 38.0 55-59 35.986000000000004 38.0 38.0 38.0 33.2 38.0 60-64 36.152 38.0 38.0 38.0 33.8 38.0 65-69 35.92620000000001 38.0 38.0 38.0 33.6 38.0 70-74 35.4373 38.0 38.0 38.0 32.6 38.0 75-79 35.304899999999996 38.0 38.0 38.0 32.4 38.0 80-84 35.20985 38.0 38.0 38.0 30.8 38.0 85-89 35.232150000000004 38.0 38.0 38.0 31.6 38.0 90-94 35.108900000000006 38.0 38.0 38.0 31.0 38.0 95-99 34.97875 38.0 38.0 38.0 29.4 38.0 100-104 34.91459999999999 38.0 38.0 38.0 29.6 38.0 105-109 34.679550000000006 38.0 37.4 38.0 28.0 38.0 110-114 34.54275 38.0 36.8 38.0 26.2 38.0 115-119 34.37455 38.0 36.0 38.0 25.0 38.0 120-124 34.25535 38.0 36.0 38.0 23.4 38.0 125-129 34.047399999999996 38.0 36.0 38.0 22.8 38.0 130-134 33.85815 38.0 35.6 38.0 20.2 38.0 135-139 33.60424999999999 38.0 35.0 38.0 18.4 38.0 140-144 33.2255 38.0 35.0 38.0 14.0 38.0 145-149 32.486650000000004 38.0 34.6 38.0 8.8 38.0 150 25.6515 34.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 10.0 4 12.0 5 1.0 6 3.0 7 6.0 8 3.0 9 1.0 10 2.0 11 13.0 12 8.0 13 11.0 14 6.0 15 14.0 16 15.0 17 57.0 18 12.0 19 8.0 20 8.0 21 7.0 22 10.0 23 12.0 24 17.0 25 21.0 26 22.0 27 28.0 28 32.0 29 37.0 30 57.0 31 61.0 32 73.0 33 115.0 34 135.0 35 221.0 36 524.0 37 2417.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.554108216432866 16.007014028056112 8.692384769539078 35.74649298597195 2 26.146903985961394 24.968663825520178 29.957382802707443 18.927049385810978 3 24.003009781790823 23.676950087785304 28.843742162026587 23.47629796839729 4 26.869041645760163 28.95132965378826 18.43953838434521 25.74009031610637 5 30.20572002007025 30.080280983442048 20.22077270446563 19.49322629202208 6 25.68991470145509 32.91520321123934 19.744104365278474 21.650777722027094 7 22.31135622963149 19.453497117071947 34.14389571321133 24.091250940085235 8 22.428499749121926 24.510787757150023 24.310085298544905 28.750627195183142 9 27.370797792272956 20.99849473156046 24.912192674360263 26.71851480180632 10-14 27.502634351949425 24.45682171709569 21.897736966230116 26.142806964724773 15-19 27.027705280064247 23.44408753262397 23.97109014254166 25.557117044770127 20-24 28.200110391891215 25.204475889407398 21.80239851472728 24.793015203974107 25-29 26.84943865276664 26.177826784282278 22.418805132317562 24.55392943063352 30-34 27.479463033460227 24.564215588058506 23.712682829092365 24.243638549388898 35-39 26.491658734532336 23.585992685737185 24.16211612644657 25.760232453283905 40-44 28.680190333082894 23.881793137991487 23.385925369396443 24.052091159529176 45-49 26.94871923404682 22.998646548699185 23.640282720938394 26.412351496315605 50-54 26.380183523040667 23.336509050794767 24.60011031439603 25.683197111768543 55-59 25.911438744295673 25.760994935058424 23.810240208615415 24.517326112030492 60-64 25.309787789093463 26.634224652586163 23.473636682887676 24.5823508754327 65-69 25.935775213246366 26.502759658805818 23.09081786251882 24.470647265429 70-74 25.920907357221722 25.835591689250226 23.35641874937268 24.887082204155377 75-79 25.68632371392723 25.360100376411545 23.442910915934757 25.510664993726472 80-84 26.355149568359764 25.195743826540856 23.785384460951615 24.663722144147762 85-89 25.958642842802647 25.065247942180285 23.935956635213813 25.040152579803255 90-94 26.311298499222 24.905887667519952 24.042563870902978 24.74024996235507 95-99 25.8168130489335 25.284818067754077 23.959849435382687 24.938519447929735 100-104 26.336126863050136 25.181913986049082 24.107994178752445 24.37396497214834 105-109 26.081501555756297 25.122954933253038 23.597310047174545 25.198233463816123 110-114 25.983738205179684 25.020076289901628 24.392692230475806 24.603493274442883 115-119 25.951209717899808 24.887059532175485 24.058829434795705 25.102901315129 120-124 25.990260555248756 26.165972187358804 23.69094834078016 24.15281891661228 125-129 26.303638644918443 26.51944792973651 23.03638644918444 24.140526976160604 130-134 27.225288509784246 25.50426492724536 23.386853988961363 23.883592574009032 135-139 26.457758836801204 26.29230383554776 23.419403359237904 23.830533968413135 140-144 26.97576396206533 26.132771338250787 23.633900346229115 23.257564353454764 145-149 26.633165829145728 26.170854271356784 23.758793969849247 23.43718592964824 150 25.582560761713857 27.58707090954648 22.575795539964922 24.25457278877474 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 0.5 24 0.0 25 1.0 26 1.5 27 2.0 28 4.0 29 4.5 30 5.5 31 8.0 32 11.0 33 20.5 34 28.5 35 30.0 36 33.0 37 44.5 38 65.5 39 80.0 40 90.5 41 113.0 42 136.0 43 141.5 44 148.5 45 158.0 46 161.0 47 157.0 48 149.0 49 148.5 50 141.5 51 139.0 52 129.5 53 111.0 54 99.5 55 97.0 56 100.0 57 114.5 58 137.0 59 135.5 60 133.5 61 124.0 62 103.0 63 99.5 64 99.0 65 88.5 66 66.0 67 60.0 68 66.5 69 57.0 70 41.0 71 31.5 72 23.5 73 17.5 74 13.0 75 4.0 76 3.0 77 4.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.27499999999999997 3 0.325 4 0.35000000000000003 5 0.35000000000000003 6 0.35000000000000003 7 0.27499999999999997 8 0.35000000000000003 9 0.35000000000000003 10-14 0.35500000000000004 15-19 0.38 20-24 0.35500000000000004 25-29 0.24 30-34 0.18 35-39 0.19499999999999998 40-44 0.17500000000000002 45-49 0.255 50-54 0.28500000000000003 55-59 0.295 60-64 0.335 65-69 0.35000000000000003 70-74 0.37 75-79 0.375 80-84 0.38 85-89 0.38 90-94 0.385 95-99 0.375 100-104 0.365 105-109 0.37 110-114 0.38 115-119 0.38999999999999996 120-124 0.40499999999999997 125-129 0.375 130-134 0.35000000000000003 135-139 0.27499999999999997 140-144 0.35500000000000004 145-149 0.5 150 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.78714436248683 92.80000000000001 2 1.60695468914647 3.05 3 0.3424657534246575 0.975 4 0.15806111696522657 0.6 5 0.026343519494204423 0.125 6 0.026343519494204423 0.15 7 0.026343519494204423 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026343519494204423 2.125 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 85 2.125 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 45 1.067543E-6 79.97222 9 AGAGCGT 45 1.067543E-6 79.97222 8 AAGAGCG 50 1.9977415E-6 71.975 7 TCGGAAG 50 1.9977415E-6 71.975 3 GATCGGA 55 3.519688E-6 65.43182 1 ATCGGAA 55 3.519688E-6 65.43182 2 CGGAAGA 60 5.899901E-6 59.979164 4 GGAAGAG 60 5.899901E-6 59.979164 5 GAAGAGC 65 9.484764E-6 55.36538 6 ATTAAAA 20 0.006149672 28.79 55-59 CGCCGTA 25 5.1940075E-4 28.79 45-49 CCGTATC 30 4.402666E-5 28.789999 45-49 TGGTCGC 30 0.0015062337 23.991667 40-44 ATCTCGG 30 0.0015062337 23.991667 35-39 GATCTCG 30 0.0015062337 23.991667 30-34 GGTGGTC 30 0.0015062337 23.991667 40-44 GTGGTCG 30 0.0015062337 23.991667 40-44 GCCGTAT 30 0.0015062337 23.991667 45-49 AGATCTC 30 0.0015062337 23.991667 30-34 GGTCGCC 30 0.0015062337 23.991667 40-44 >>END_MODULE Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961041 spots for SRR8096910.sra Written 1961041 spots for SRR8096910.sra Read 1961055 spots for SRR8096910.sra Written 1961055 spots for SRR8096910.sra SRR ids: ['SRR8096910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fbcd_htu SRR8096910.sra spots: 39220834 blocks: [[1, 1961041], [1961042, 3922082], [3922083, 5883123], [5883124, 7844164], [7844165, 9805205], [9805206, 11766246], [11766247, 13727287], [13727288, 15688328], [15688329, 17649369], [17649370, 19610410], [19610411, 21571451], [21571452, 23532492], [23532493, 25493533], [25493534, 27454574], [27454575, 29415615], [29415616, 31376656], [31376657, 33337697], [33337698, 35298738], [35298739, 37259779], [37259780, 39220834]] SRR8096910 file size 13192350 SRR8096910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8096910 SRR8096910_1.fastq SRR8096910_2.fastq Input file: SRR8096910_1.fastq Paired file: SRR8096910_2.fastq trimmed: SRR8096910-trimmed-pair1.fastq, SRR8096910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Dec 8 05:06:29 2024 >> started Sun Dec 8 05:11:18 2024 >> done (289.760s) 39220834 read pairs processed; of these: 67080 ( 0.17%) short read pairs filtered out after trimming by size control 1410417 ( 3.60%) empty read pairs filtered out after trimming by size control 37743337 (96.23%) read pairs available; of these: 12403267 (32.86%) trimmed read pairs available after processing 25340070 (67.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 181 0.00% 19 614 0.00% 20 614 0.00% 21 170 0.00% 22 310 0.00% 23 162 0.00% 24 257 0.00% 25 161 0.00% 26 150 0.00% 27 186 0.00% 28 156 0.00% 29 136 0.00% 30 218 0.00% 31 157 0.00% 32 241 0.00% 33 164 0.00% 34 246 0.00% 35 371 0.00% 36 442 0.00% 37 390 0.00% 38 446 0.00% 39 556 0.00% 40 891 0.00% 41 1023 0.00% 42 913 0.00% 43 1261 0.00% 44 1082 0.00% 45 1342 0.00% 46 1251 0.00% 47 1386 0.00% 48 1782 0.00% 49 2129 0.01% 50 2454 0.01% 51 3057 0.01% 52 2915 0.01% 53 3170 0.01% 54 2974 0.01% 55 3742 0.01% 56 5334 0.01% 57 4317 0.01% 58 4929 0.01% 59 4696 0.01% 60 4614 0.01% 61 10847 0.03% 62 11521 0.03% 63 3499 0.01% 64 2039 0.01% 65 2012 0.01% 66 1950 0.01% 67 2009 0.01% 68 2263 0.01% 69 3200 0.01% 70 3152 0.01% 71 2940 0.01% 72 3001 0.01% 73 3613 0.01% 74 3182 0.01% 75 3531 0.01% 76 3737 0.01% 77 4140 0.01% 78 4465 0.01% 79 4785 0.01% 80 5325 0.01% 81 5801 0.02% 82 6490 0.02% 83 7744 0.02% 84 11585 0.03% 85 13373 0.04% 86 16104 0.04% 87 18240 0.05% 88 18208 0.05% 89 18005 0.05% 90 18188 0.05% 91 17808 0.05% 92 17722 0.05% 93 18068 0.05% 94 19431 0.05% 95 21267 0.06% 96 23667 0.06% 97 27562 0.07% 98 27369 0.07% 99 27421 0.07% 100 29153 0.08% 101 31243 0.08% 102 33494 0.09% 103 36414 0.10% 104 38975 0.10% 105 41223 0.11% 106 42819 0.11% 107 45726 0.12% 108 45861 0.12% 109 46757 0.12% 110 46675 0.12% 111 47771 0.13% 112 48592 0.13% 113 48727 0.13% 114 50294 0.13% 115 52303 0.14% 116 53810 0.14% 117 57167 0.15% 118 57190 0.15% 119 58679 0.16% 120 60621 0.16% 121 62280 0.17% 122 63770 0.17% 123 65866 0.17% 124 68319 0.18% 125 71275 0.19% 126 74166 0.20% 127 77099 0.20% 128 79761 0.21% 129 82054 0.22% 130 85102 0.23% 131 87866 0.23% 132 91619 0.24% 133 94912 0.25% 134 100024 0.27% 135 103867 0.28% 136 109033 0.29% 137 113654 0.30% 138 120184 0.32% 139 129832 0.34% 140 137420 0.36% 141 148408 0.39% 142 161580 0.43% 143 183038 0.48% 144 212933 0.56% 145 257756 0.68% 146 329573 0.87% 147 502544 1.33% 148 924471 2.45% 149 6414513 17.00% 150 25340070 67.14% 37743337 reads passed initial QC criterion=sequence-density sequence-density=2.24 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=20 prefix-density=2.28 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=15.93 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=2.5 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGC criterion=sequence-density sequence-density=1.91 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=13 prefix-density=2.06 prefix-fanout=2.9 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=18.15 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -y GAGTTCAGCAAGGTCGG -o SRR8096910 SRR8096910_1.fastq SRR8096910_2.fastq Input file: SRR8096910_1.fastq Paired file: SRR8096910_2.fastq trimmed: SRR8096910-trimmed-pair1.fastq, SRR8096910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC -- paired 3' end adapter sequence (-y): GAGTTCAGCAAGGTCGG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Dec 8 05:28:18 2024 >> started Sun Dec 8 05:29:36 2024 >> done (77.811s) 12581112 read pairs processed; of these: 1215 ( 0.01%) short read pairs filtered out after trimming by size control 4386 ( 0.03%) empty read pairs filtered out after trimming by size control 12575511 (99.96%) read pairs available; of these: 1247 ( 0.01%) trimmed read pairs available after processing 12574264 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 58 0.00% 19 218 0.00% 20 221 0.00% 21 58 0.00% 22 84 0.00% 23 39 0.00% 24 93 0.00% 25 47 0.00% 26 41 0.00% 27 68 0.00% 28 48 0.00% 29 42 0.00% 30 79 0.00% 31 46 0.00% 32 68 0.00% 33 58 0.00% 34 94 0.00% 35 139 0.00% 36 150 0.00% 37 134 0.00% 38 147 0.00% 39 196 0.00% 40 290 0.00% 41 357 0.00% 42 326 0.00% 43 429 0.00% 44 343 0.00% 45 459 0.00% 46 402 0.00% 47 461 0.00% 48 598 0.00% 49 679 0.01% 50 833 0.01% 51 985 0.01% 52 1024 0.01% 53 1041 0.01% 54 973 0.01% 55 1293 0.01% 56 1818 0.01% 57 1483 0.01% 58 1616 0.01% 59 1511 0.01% 60 1540 0.01% 61 3524 0.03% 62 3831 0.03% 63 1194 0.01% 64 702 0.01% 65 668 0.01% 66 599 0.00% 67 652 0.01% 68 771 0.01% 69 1042 0.01% 70 1000 0.01% 71 978 0.01% 72 985 0.01% 73 1230 0.01% 74 1079 0.01% 75 1128 0.01% 76 1208 0.01% 77 1345 0.01% 78 1471 0.01% 79 1567 0.01% 80 1750 0.01% 81 1936 0.02% 82 2197 0.02% 83 2527 0.02% 84 3882 0.03% 85 4412 0.04% 86 5311 0.04% 87 6107 0.05% 88 5918 0.05% 89 5997 0.05% 90 6019 0.05% 91 5935 0.05% 92 5960 0.05% 93 6126 0.05% 94 6550 0.05% 95 7138 0.06% 96 7962 0.06% 97 9241 0.07% 98 9095 0.07% 99 9263 0.07% 100 9775 0.08% 101 10334 0.08% 102 11227 0.09% 103 12062 0.10% 104 12864 0.10% 105 13719 0.11% 106 14343 0.11% 107 15163 0.12% 108 15053 0.12% 109 15450 0.12% 110 15569 0.12% 111 15971 0.13% 112 16167 0.13% 113 16246 0.13% 114 16784 0.13% 115 17585 0.14% 116 17927 0.14% 117 19002 0.15% 118 19256 0.15% 119 19799 0.16% 120 20178 0.16% 121 20707 0.16% 122 21260 0.17% 123 21798 0.17% 124 22792 0.18% 125 23665 0.19% 126 24498 0.19% 127 25625 0.20% 128 26685 0.21% 129 27274 0.22% 130 28134 0.22% 131 29256 0.23% 132 30482 0.24% 133 31541 0.25% 134 33117 0.26% 135 34626 0.28% 136 36504 0.29% 137 38056 0.30% 138 39879 0.32% 139 43167 0.34% 140 45766 0.36% 141 49566 0.39% 142 53806 0.43% 143 60910 0.48% 144 71276 0.57% 145 86180 0.69% 146 109666 0.87% 147 167691 1.33% 148 307504 2.45% 149 2137903 17.00% 150 8442814 67.14% criterion=sequence-density sequence-density=2.21 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=21 prefix-density=2.27 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=21.70 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.1 sequence=GGATTGACTAATGGTACACACGATTCACGATTCTTCCGTCATTCATTCACTCGTGCACCTCATGCTTAATTACATTGCGCGGGGTTCACTCCACCATGGTACAAATCAACACATAACTAGACAAAGGTACAAGTTGATCTACGGCGTACAAGTACACATGCATGCATACATCGATCGTCCGATGGATGGACCGATATATACTACAGCTAGCTGCTAATTCTCATTTAGCTCCCGGGGGCGAAGTTGGTAGCAAAGGCCCATGCATTGTTGTTGACTGGGTCGGCGACGTGGTCGAAGAGGTTCTC criterion=sequence-density sequence-density=1.88 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=12 prefix-density=2.03 prefix-fanout=2.9 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=24.59 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.5 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR8096910 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 08 09:56:19 Started mapping on | Dec 08 09:56:27 Finished on | Dec 08 10:19:55 Mapping speed, Million of reads per hour | 96.39 Number of input reads | 37699439 Average input read length | 273 UNIQUE READS: Uniquely mapped reads number | 33008791 Uniquely mapped reads % | 87.56% Average mapped length | 274.55 Number of splices: Total | 30825929 Number of splices: Annotated (sjdb) | 29215136 Number of splices: GT/AG | 30398773 Number of splices: GC/AG | 344616 Number of splices: AT/AC | 8182 Number of splices: Non-canonical | 74358 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433215 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 21199 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.92% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4351450 4351450 4351450 N_multimapping 433215 433215 433215 N_noFeature 1017422 32014571 1244540 N_ambiguous 946859 3928 182684 UnstrandedReadsAssigned:31044510 PositiveStrandReadsAssigned:990292 NegativeStrandReadsAssigned:31581567 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8096910 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8096910-trimmed-pair1.fastq SRR8096910-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,699,439 reads, 34,742,273 reads pseudoaligned [quant] estimated average fragment length: 242.569 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,335 rounds 52973 SRR8096910.ke.tsv 35125 SRR8096910.se.tsv 88098 total ==> SRR8096910.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.763 0 0 PNS24247 1044 802.431 85.0782 4.05833 PNS24249 1928 1686.43 42.9927 0.975806 PNS24246 1044 802.431 85.0782 4.05833 PNS24248 1044 802.431 85.0782 4.05833 PNS24244 1471 1229.43 226.773 7.06032 PNS24243 293 99.7169 0 0 KQK14069 1603 1361.43 1304.55 36.6778 KQK14071 474 245.825 47.8104 7.44447 ==> SRR8096910.se.tsv <== BRADI_1g14170v3 1319 BRADI_1g53295v3 607 BRADI_1g59795v3 371 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 803 BRADI_1g74790v3 139 BRADI_1g09890v3 0 BRADI_1g77505v3 401 BRADI_1g48960v3 0 SRR8096910 completed mapping pipeline successfully