Starting /dee2/code/volunteer_pipeline.sh SRR8380049 current disk space = 1542149943296 free memory = 1603915316 SRR8380049 SRAfilesize 2e49f8abc3097facfa451e31fbab48b2 SRR8380049.sra SRR8380049.sra file validated SRR8380049 is paired end SRR8380049 is conventional basespace SRR8380049 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380049_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.085 32.0 32.0 32.0 12.0 32.0 2 30.70375 32.0 32.0 32.0 27.0 32.0 3 33.5025 32.0 32.0 37.0 32.0 37.0 4 36.26625 37.0 37.0 37.0 32.0 37.0 5 30.22 37.0 27.0 37.0 12.0 37.0 6 38.97675 41.0 37.0 41.0 37.0 41.0 7 39.258 41.0 41.0 41.0 37.0 41.0 8 38.56575 41.0 37.0 41.0 32.0 41.0 9 39.52425 41.0 41.0 41.0 37.0 41.0 10-14 39.86685 41.0 41.0 41.0 37.0 41.0 15-19 38.3197 41.0 38.6 41.0 31.0 41.0 20-24 39.286950000000004 41.0 40.2 41.0 35.0 41.0 25-29 39.55745 41.0 41.0 41.0 36.0 41.0 30-34 39.55685 41.0 40.2 41.0 36.0 41.0 35-39 38.46939999999999 40.2 39.2 41.0 31.0 41.0 40-44 37.1245 39.2 34.4 41.0 31.0 41.0 45-49 39.330650000000006 41.0 40.2 41.0 36.0 41.0 50-54 32.98135 37.6 26.0 41.0 19.0 41.0 55-59 36.9262 41.0 34.0 41.0 26.0 41.0 60-64 37.17115 39.2 36.4 41.0 30.0 41.0 65-69 39.825100000000006 41.0 41.0 41.0 37.0 41.0 70-74 36.2927 39.2 33.6 41.0 27.0 41.0 75-79 37.789049999999996 40.2 36.6 41.0 29.0 41.0 80-84 38.36725 41.0 38.4 41.0 33.0 41.0 85-89 38.6496 41.0 39.4 41.0 33.0 41.0 90-94 38.832 41.0 40.2 41.0 35.0 41.0 95-99 39.161150000000006 41.0 41.0 41.0 35.0 41.0 100-104 37.6975 41.0 37.0 41.0 30.0 41.0 105-109 38.01625 41.0 38.4 41.0 31.0 41.0 110-114 37.93895 41.0 37.6 41.0 31.0 41.0 115-119 38.7962 41.0 40.2 41.0 33.0 41.0 120-124 38.25325 41.0 38.6 41.0 32.0 41.0 125-129 37.87955 41.0 37.0 41.0 29.0 41.0 130-134 38.483549999999994 41.0 37.8 41.0 32.0 41.0 135-139 37.8706 41.0 37.0 41.0 30.0 41.0 140-144 37.298899999999996 41.0 36.0 41.0 26.0 41.0 145-149 37.4437 41.0 37.0 41.0 29.0 41.0 150 38.0445 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 5.0 24 6.0 25 11.0 26 15.0 27 18.0 28 14.0 29 35.0 30 43.0 31 54.0 32 72.0 33 95.0 34 153.0 35 212.0 36 306.0 37 394.0 38 657.0 39 965.0 40 942.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.39506172839506 15.671453766691862 14.5376669186193 41.395817586293774 2 28.575 24.2 27.224999999999998 20.0 3 27.650000000000002 24.725 21.5 26.125 4 27.55 30.675 14.6 27.175 5 30.55 29.625 18.4 21.425 6 20.5 32.300000000000004 18.05 29.15 7 20.724999999999998 13.850000000000001 34.949999999999996 30.475 8 24.275 17.875 21.65 36.199999999999996 9 22.85 18.125 27.200000000000003 31.825 10-14 26.095000000000002 23.21 21.62 29.075 15-19 25.66 22.5 23.02 28.82 20-24 26.52 22.985 22.645 27.85 25-29 27.01 22.075 22.575 28.34 30-34 26.52 22.795 22.37 28.315 35-39 27.055 23.145 21.895 27.905 40-44 27.3 23.080000000000002 21.365000000000002 28.255000000000003 45-49 26.66 22.865 22.145 28.33 50-54 28.075 22.16 22.02 27.744999999999997 55-59 27.894999999999996 22.445 21.36 28.299999999999997 60-64 27.735 22.3 21.93 28.035 65-69 27.639999999999997 22.395 21.965 28.000000000000004 70-74 27.765 22.255 21.18 28.799999999999997 75-79 27.46 22.84 21.36 28.34 80-84 28.199999999999996 21.735 21.560000000000002 28.505000000000003 85-89 27.58 22.52 21.605 28.294999999999998 90-94 27.794999999999998 22.525000000000002 21.355 28.325 95-99 28.38 21.495 21.315 28.810000000000002 100-104 27.250000000000004 22.525000000000002 21.965 28.26 105-109 27.55 21.95 21.94 28.560000000000002 110-114 27.67 22.17 21.64 28.52 115-119 28.13 21.740000000000002 21.805 28.325 120-124 28.084999999999997 21.52 21.529999999999998 28.865000000000002 125-129 29.185 21.815 21.595 27.405 130-134 27.76 22.314999999999998 21.645 28.28 135-139 27.860000000000003 22.21 21.895 28.035 140-144 28.88 22.155 21.295 27.67 145-149 28.68 21.855 21.740000000000002 27.725 150 27.575 23.5 22.3 26.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 1.0 25 0.0 26 2.0 27 2.5 28 2.5 29 5.5 30 8.0 31 7.5 32 16.0 33 21.0 34 16.5 35 23.5 36 32.5 37 34.5 38 40.5 39 54.0 40 66.5 41 93.5 42 113.5 43 110.0 44 104.5 45 107.0 46 111.5 47 110.5 48 110.5 49 113.0 50 122.5 51 117.0 52 95.5 53 83.5 54 82.5 55 94.0 56 106.0 57 104.0 58 109.0 59 118.5 60 115.5 61 115.5 62 114.0 63 115.5 64 120.5 65 109.5 66 101.5 67 109.0 68 98.5 69 83.5 70 89.5 71 88.0 72 79.5 73 76.5 74 57.0 75 38.0 76 32.0 77 27.0 78 25.0 79 18.5 80 12.5 81 8.5 82 6.5 83 4.5 84 2.5 85 3.0 86 2.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 94.0926024481107 88.4 2 5.481639169771155 10.299999999999999 3 0.31931878658861096 0.8999999999999999 4 0.10643959552953698 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6625000000000001 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 0.9 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGATA 10 0.006973645 144.0 2 >>END_MODULE SRR8380049 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380049_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5075 32.0 32.0 32.0 32.0 32.0 2 31.4525 32.0 32.0 32.0 32.0 32.0 3 35.08875 37.0 32.0 37.0 32.0 37.0 4 30.1125 32.0 27.0 37.0 12.0 37.0 5 35.86375 37.0 37.0 37.0 32.0 37.0 6 38.73425 41.0 37.0 41.0 32.0 41.0 7 38.79975 41.0 41.0 41.0 32.0 41.0 8 39.4415 41.0 41.0 41.0 37.0 41.0 9 39.4845 41.0 41.0 41.0 37.0 41.0 10-14 39.4629 41.0 41.0 41.0 36.0 41.0 15-19 39.16635 41.0 39.4 41.0 35.0 41.0 20-24 39.30825 41.0 41.0 41.0 37.0 41.0 25-29 37.742000000000004 40.2 37.4 41.0 31.0 41.0 30-34 39.47515 41.0 41.0 41.0 37.0 41.0 35-39 38.35145 41.0 39.4 41.0 33.0 41.0 40-44 37.6726 41.0 37.6 41.0 30.0 41.0 45-49 38.3862 41.0 37.8 41.0 31.0 41.0 50-54 38.638850000000005 41.0 40.2 41.0 33.0 41.0 55-59 37.6652 41.0 36.8 41.0 29.0 41.0 60-64 38.2146 41.0 39.4 41.0 31.0 41.0 65-69 38.352700000000006 41.0 38.6 41.0 31.0 41.0 70-74 38.12755 41.0 37.0 41.0 31.0 41.0 75-79 38.037349999999996 41.0 37.8 41.0 31.0 41.0 80-84 37.656150000000004 41.0 38.6 41.0 29.0 41.0 85-89 38.4298 41.0 39.4 41.0 32.0 41.0 90-94 36.41985 40.2 35.6 41.0 25.0 41.0 95-99 37.869550000000004 41.0 37.0 41.0 31.0 41.0 100-104 37.8044 41.0 37.0 41.0 29.0 41.0 105-109 36.8913 41.0 37.0 41.0 26.0 41.0 110-114 35.913650000000004 39.4 33.0 41.0 25.0 41.0 115-119 37.4234 41.0 37.0 41.0 31.0 41.0 120-124 37.1706 41.0 37.0 41.0 28.0 41.0 125-129 35.67865 40.2 33.0 41.0 24.0 41.0 130-134 35.043350000000004 39.4 32.0 41.0 20.0 41.0 135-139 33.56515 37.0 29.0 41.0 14.0 41.0 140-144 33.18 37.0 28.0 41.0 18.0 41.0 145-149 33.11315 37.0 27.0 41.0 14.0 41.0 150 28.7715 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 2.0 19 1.0 20 2.0 21 7.0 22 11.0 23 19.0 24 19.0 25 23.0 26 21.0 27 39.0 28 44.0 29 41.0 30 49.0 31 94.0 32 99.0 33 126.0 34 191.0 35 237.0 36 305.0 37 434.0 38 666.0 39 917.0 40 650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.950000000000003 12.675 18.375 41.0 2 27.875 21.8 28.225 22.1 3 27.450000000000003 24.925 21.125 26.5 4 28.249999999999996 28.7 14.249999999999998 28.799999999999997 5 30.4 28.299999999999997 17.825 23.474999999999998 6 20.95 32.300000000000004 17.925 28.825 7 20.65 12.9 38.324999999999996 28.125 8 22.375 18.35 22.650000000000002 36.625 9 22.825 18.575 27.825 30.775000000000002 10-14 25.97 23.155 22.025 28.849999999999998 15-19 26.295 22.61 22.755 28.34 20-24 26.39 23.11 22.220000000000002 28.28 25-29 26.83 22.975 21.73 28.465 30-34 27.169999999999998 22.725 22.545 27.560000000000002 35-39 27.365000000000002 22.264999999999997 22.145 28.225 40-44 27.735 22.42 21.725 28.12 45-49 27.145000000000003 22.81 21.895 28.15 50-54 27.150000000000002 22.035 22.045 28.77 55-59 27.62 22.245 21.255 28.88 60-64 26.700000000000003 22.39 22.32 28.59 65-69 26.995 22.235 22.175 28.595 70-74 27.665 22.03 22.025 28.28 75-79 27.465 21.92 21.875 28.74 80-84 27.425 22.105 22.115000000000002 28.355000000000004 85-89 27.1 22.215 21.755 28.93 90-94 28.215 21.8 21.88 28.105000000000004 95-99 27.905 21.395 22.009999999999998 28.689999999999998 100-104 27.77 21.740000000000002 21.759999999999998 28.73 105-109 27.029999999999998 23.185 21.775 28.01 110-114 27.66 22.425 21.365000000000002 28.549999999999997 115-119 28.01 21.54 21.615000000000002 28.835 120-124 27.765 21.654999999999998 21.855 28.725 125-129 28.189999999999998 21.759999999999998 21.705 28.345 130-134 28.535 22.0 21.52 27.944999999999997 135-139 27.92 22.02 21.605 28.455000000000002 140-144 28.754999999999995 22.05 21.305 27.889999999999997 145-149 28.645 22.21 21.154999999999998 27.99 150 29.575000000000003 22.1 21.6 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.0 26 0.5 27 3.0 28 5.5 29 7.0 30 8.5 31 8.0 32 8.5 33 13.5 34 17.5 35 17.0 36 26.0 37 41.5 38 51.5 39 70.0 40 80.5 41 84.5 42 103.0 43 124.0 44 122.0 45 109.5 46 110.0 47 112.5 48 117.0 49 114.5 50 107.5 51 109.0 52 98.0 53 73.0 54 74.0 55 85.5 56 87.0 57 100.5 58 119.0 59 116.0 60 106.5 61 108.5 62 119.5 63 123.5 64 106.0 65 98.5 66 106.5 67 111.5 68 121.0 69 103.5 70 86.0 71 79.0 72 68.5 73 70.5 74 64.0 75 48.5 76 34.5 77 27.5 78 20.5 79 17.5 80 16.5 81 11.0 82 6.0 83 4.5 84 2.5 85 3.0 86 3.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.11642914762032 86.575 2 6.292013982253295 11.700000000000001 3 0.5108900242000538 1.425 4 0.08066684592632428 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6625000000000001 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 0.9 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATAT 10 0.006973645 144.0 1 >>END_MODULE Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Read 1188457 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188457 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra Read 1188445 spots for SRR8380049.sra Written 1188445 spots for SRR8380049.sra SRR ids: ['SRR8380049.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_blvhf9nf SRR8380049.sra spots: 23768912 blocks: [[1, 1188445], [1188446, 2376890], [2376891, 3565335], [3565336, 4753780], [4753781, 5942225], [5942226, 7130670], [7130671, 8319115], [8319116, 9507560], [9507561, 10696005], [10696006, 11884450], [11884451, 13072895], [13072896, 14261340], [14261341, 15449785], [15449786, 16638230], [16638231, 17826675], [17826676, 19015120], [19015121, 20203565], [20203566, 21392010], [21392011, 22580455], [22580456, 23768912]] SRR8380049 file size 7986380 SRR8380049 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380049 SRR8380049_1.fastq SRR8380049_2.fastq Input file: SRR8380049_1.fastq Paired file: SRR8380049_2.fastq trimmed: SRR8380049-trimmed-pair1.fastq, SRR8380049-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:59:07 2024 >> started Sat Dec 7 15:59:33 2024 >> done (26.011s) 23768912 read pairs processed; of these: 1333 ( 0.01%) short read pairs filtered out after trimming by size control 722 ( 0.00%) empty read pairs filtered out after trimming by size control 23766857 (99.99%) read pairs available; of these: 1078905 ( 4.54%) trimmed read pairs available after processing 22687952 (95.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 167 0.00% 19 147 0.00% 20 156 0.00% 21 206 0.00% 22 229 0.00% 23 238 0.00% 24 237 0.00% 25 264 0.00% 26 282 0.00% 27 275 0.00% 28 299 0.00% 29 308 0.00% 30 285 0.00% 31 224 0.00% 32 265 0.00% 33 232 0.00% 34 316 0.00% 35 245 0.00% 36 281 0.00% 37 267 0.00% 38 268 0.00% 39 296 0.00% 40 284 0.00% 41 294 0.00% 42 282 0.00% 43 274 0.00% 44 279 0.00% 45 257 0.00% 46 278 0.00% 47 242 0.00% 48 267 0.00% 49 307 0.00% 50 279 0.00% 51 275 0.00% 52 299 0.00% 53 271 0.00% 54 255 0.00% 55 274 0.00% 56 252 0.00% 57 245 0.00% 58 267 0.00% 59 237 0.00% 60 276 0.00% 61 307 0.00% 62 263 0.00% 63 268 0.00% 64 292 0.00% 65 288 0.00% 66 293 0.00% 67 270 0.00% 68 290 0.00% 69 334 0.00% 70 304 0.00% 71 329 0.00% 72 358 0.00% 73 380 0.00% 74 403 0.00% 75 439 0.00% 76 388 0.00% 77 410 0.00% 78 439 0.00% 79 470 0.00% 80 503 0.00% 81 562 0.00% 82 654 0.00% 83 660 0.00% 84 689 0.00% 85 737 0.00% 86 714 0.00% 87 730 0.00% 88 785 0.00% 89 874 0.00% 90 942 0.00% 91 1051 0.00% 92 1174 0.00% 93 1301 0.01% 94 1419 0.01% 95 1482 0.01% 96 1502 0.01% 97 1572 0.01% 98 1642 0.01% 99 1740 0.01% 100 1871 0.01% 101 1977 0.01% 102 2240 0.01% 103 2247 0.01% 104 2444 0.01% 105 2571 0.01% 106 2735 0.01% 107 2733 0.01% 108 2739 0.01% 109 2898 0.01% 110 3044 0.01% 111 3234 0.01% 112 3616 0.02% 113 3885 0.02% 114 3911 0.02% 115 4110 0.02% 116 4236 0.02% 117 4263 0.02% 118 4409 0.02% 119 4625 0.02% 120 4804 0.02% 121 4868 0.02% 122 5490 0.02% 123 5599 0.02% 124 6063 0.03% 125 6215 0.03% 126 6453 0.03% 127 6580 0.03% 128 6524 0.03% 129 6925 0.03% 130 7057 0.03% 131 7250 0.03% 132 7853 0.03% 133 7885 0.03% 134 8565 0.04% 135 9057 0.04% 136 9023 0.04% 137 9251 0.04% 138 9412 0.04% 139 9835 0.04% 140 9917 0.04% 141 10554 0.04% 142 10903 0.05% 143 11466 0.05% 144 12109 0.05% 145 12935 0.05% 146 14601 0.06% 147 20294 0.09% 148 57282 0.24% 149 671908 2.83% 150 22687952 95.46% 23766857 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=19 prefix-density=0.86 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=33.24 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.9 sequence=ACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCAAGAC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=19 prefix-density=0.85 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=22.27 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.1 sequence=ACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCAAGAC SRR8380049 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:00:13 Started mapping on | Dec 07 16:00:13 Finished on | Dec 07 16:02:51 Mapping speed, Million of reads per hour | 541.52 Number of input reads | 23766857 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22564376 Uniquely mapped reads % | 94.94% Average mapped length | 297.68 Number of splices: Total | 18580614 Number of splices: Annotated (sjdb) | 17587264 Number of splices: GT/AG | 18336988 Number of splices: GC/AG | 200449 Number of splices: AT/AC | 4378 Number of splices: Non-canonical | 38799 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196157 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 58040 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 2.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1006324 1006324 1006324 N_multimapping 196157 196157 196157 N_noFeature 500058 11284978 11335868 N_ambiguous 653845 107527 106421 UnstrandedReadsAssigned:21410473 PositiveStrandReadsAssigned:11171871 NegativeStrandReadsAssigned:11122087 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380049 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380049-trimmed-pair1.fastq SRR8380049-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,766,857 reads, 22,141,821 reads pseudoaligned [quant] estimated average fragment length: 275.344 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR8380049.ke.tsv 35125 SRR8380049.se.tsv 88098 total ==> SRR8380049.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.889 0 0 PNS24247 1044 769.656 17.253 1.08775 PNS24249 1928 1653.66 96.1071 2.82015 PNS24246 1044 769.656 17.253 1.08775 PNS24248 1044 769.656 17.253 1.08775 PNS24244 1471 1196.66 39.134 1.58689 PNS24243 293 55.6412 0 0 KQK14069 1603 1328.66 114.831 4.19382 KQK14071 474 202.307 9.94246 2.38476 ==> SRR8380049.se.tsv <== BRADI_1g14170v3 147 BRADI_1g53295v3 5 BRADI_1g59795v3 446 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 185 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR8380049 completed mapping pipeline successfully