Starting /dee2/code/volunteer_pipeline.sh SRR8380050 current disk space = 1542154543104 free memory = 1606468240 SRR8380050 SRAfilesize 69375cf7205061e7aa9b533d44ae4153 SRR8380050.sra SRR8380050.sra file validated SRR8380050 is paired end SRR8380050 is conventional basespace SRR8380050 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380050_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.55625 32.0 32.0 32.0 27.0 32.0 2 30.67125 32.0 32.0 32.0 27.0 32.0 3 33.2575 32.0 32.0 37.0 32.0 37.0 4 36.08125 37.0 37.0 37.0 32.0 37.0 5 30.14125 37.0 27.0 37.0 12.0 37.0 6 39.142 41.0 37.0 41.0 37.0 41.0 7 39.1485 41.0 37.0 41.0 37.0 41.0 8 38.57475 41.0 37.0 41.0 32.0 41.0 9 39.41825 41.0 41.0 41.0 37.0 41.0 10-14 39.68615 41.0 41.0 41.0 37.0 41.0 15-19 38.10080000000001 41.0 37.6 41.0 31.0 41.0 20-24 39.13845 41.0 39.4 41.0 34.0 41.0 25-29 39.4319 41.0 40.2 41.0 36.0 41.0 30-34 39.360400000000006 41.0 40.2 41.0 36.0 41.0 35-39 38.1958 40.2 37.4 41.0 31.0 41.0 40-44 37.007600000000004 39.2 33.6 41.0 30.0 41.0 45-49 39.12625 41.0 40.2 41.0 35.0 41.0 50-54 32.726350000000004 37.6 26.0 41.0 18.0 41.0 55-59 36.6666 41.0 34.0 41.0 26.0 41.0 60-64 36.932550000000006 39.2 35.6 41.0 30.0 41.0 65-69 39.68855 41.0 41.0 41.0 37.0 41.0 70-74 36.16095 39.2 33.6 41.0 27.0 41.0 75-79 37.55075 40.2 36.6 41.0 29.0 41.0 80-84 38.230399999999996 41.0 38.4 41.0 32.0 41.0 85-89 38.42535 41.0 39.4 41.0 33.0 41.0 90-94 38.807050000000004 41.0 40.2 41.0 35.0 41.0 95-99 39.00965 41.0 40.2 41.0 35.0 41.0 100-104 37.3009 41.0 36.0 41.0 27.0 41.0 105-109 37.831950000000006 40.2 38.4 41.0 30.0 41.0 110-114 37.793 41.0 36.8 41.0 31.0 41.0 115-119 38.69895 41.0 40.2 41.0 33.0 41.0 120-124 38.1149 41.0 38.6 41.0 32.0 41.0 125-129 37.64615 41.0 37.0 41.0 29.0 41.0 130-134 38.2779 41.0 37.8 41.0 32.0 41.0 135-139 37.6435 41.0 37.0 41.0 30.0 41.0 140-144 37.157849999999996 40.2 36.0 41.0 26.0 41.0 145-149 37.199400000000004 41.0 37.0 41.0 28.0 41.0 150 37.53525 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 3.0 24 5.0 25 11.0 26 12.0 27 15.0 28 18.0 29 37.0 30 59.0 31 81.0 32 96.0 33 124.0 34 135.0 35 205.0 36 303.0 37 431.0 38 687.0 39 932.0 40 843.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.089604832620186 14.372011074754592 16.71281147747294 40.825572615152275 2 28.799999999999997 22.35 27.675 21.175 3 27.375 25.6 20.625 26.400000000000002 4 28.975 29.175 15.024999999999999 26.825 5 30.049999999999997 30.275000000000002 17.299999999999997 22.375 6 22.2 31.225 18.075 28.499999999999996 7 22.2 12.15 37.8 27.85 8 21.975 17.625 22.575 37.824999999999996 9 23.075000000000003 18.25 25.874999999999996 32.800000000000004 10-14 25.97 23.200000000000003 21.685 29.145 15-19 26.169999999999998 22.305 22.525000000000002 28.999999999999996 20-24 26.755000000000003 22.805 22.07 28.37 25-29 27.465 23.34 20.974999999999998 28.22 30-34 27.105 22.75 21.85 28.294999999999998 35-39 26.395000000000003 23.305 21.67 28.63 40-44 27.584999999999997 22.585 22.085 27.744999999999997 45-49 27.125 21.93 22.325 28.62 50-54 27.650000000000002 22.74 21.82 27.79 55-59 27.405 22.12 21.75 28.725 60-64 27.505000000000003 22.485 21.75 28.26 65-69 27.500000000000004 21.605 21.92 28.975 70-74 27.975 21.55 22.2 28.275 75-79 27.134999999999998 21.959999999999997 22.03 28.875 80-84 27.47 21.83 21.72 28.98 85-89 27.595 22.005 21.84 28.560000000000002 90-94 26.965 21.955 22.1 28.98 95-99 27.87 22.264999999999997 21.67 28.194999999999997 100-104 27.655 21.725 22.395 28.225 105-109 27.534999999999997 22.305 21.915000000000003 28.244999999999997 110-114 27.405 22.735 21.529999999999998 28.33 115-119 27.99 21.43 21.705 28.875 120-124 27.88 21.654999999999998 22.075 28.389999999999997 125-129 27.905 21.97 22.075 28.050000000000004 130-134 27.705000000000002 22.29 21.625 28.38 135-139 28.18 21.6 22.05 28.17 140-144 27.82 22.045 21.685 28.449999999999996 145-149 28.17 22.009999999999998 21.285 28.535 150 27.474999999999998 22.325 22.6 27.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 0.5 29 1.5 30 7.0 31 8.5 32 9.0 33 16.5 34 19.5 35 22.5 36 28.0 37 34.0 38 47.5 39 67.5 40 80.0 41 82.5 42 98.0 43 116.0 44 114.0 45 110.5 46 108.5 47 118.0 48 120.5 49 107.5 50 113.0 51 111.5 52 105.0 53 108.5 54 99.5 55 96.0 56 98.0 57 97.0 58 104.5 59 104.5 60 107.0 61 101.0 62 97.0 63 109.0 64 116.0 65 113.0 66 108.5 67 103.5 68 99.5 69 102.5 70 89.5 71 73.5 72 68.5 73 70.5 74 62.0 75 46.5 76 43.5 77 37.0 78 30.5 79 21.5 80 11.0 81 8.0 82 8.0 83 7.0 84 4.0 85 2.5 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 94.42527209981418 88.925 2 4.990708786833023 9.4 3 0.5574727900185824 1.575 4 0.026546323334218212 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0125 0.0 0.0 0.0 0.025 88-89 0.025 0.0 0.0 0.0 0.025 90-91 0.025 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.05 0.0 0.0 0.0 0.025 98-99 0.05 0.0 0.0 0.0 0.025 100-101 0.05 0.0 0.0 0.0 0.025 102-103 0.075 0.0 0.0 0.0 0.025 104-105 0.075 0.0 0.0 0.0 0.025 106-107 0.075 0.0 0.0 0.0 0.025 108-109 0.075 0.0 0.0 0.0 0.025 110-111 0.1125 0.0 0.0 0.0 0.025 112-113 0.125 0.0 0.0 0.0 0.025 114-115 0.1375 0.0 0.0 0.0 0.025 116-117 0.16249999999999998 0.0 0.0 0.0 0.025 118-119 0.2 0.0 0.0 0.0 0.025 120-121 0.21250000000000002 0.0 0.0 0.0 0.025 122-123 0.25 0.0 0.0 0.0 0.025 124-125 0.35 0.0 0.0 0.0 0.025 126-127 0.4125 0.0 0.0 0.0 0.025 128-129 0.425 0.0 0.0 0.0 0.025 130-131 0.425 0.0 0.0 0.0 0.025 132-133 0.4375 0.0 0.0 0.0 0.025 134-135 0.5249999999999999 0.0 0.0 0.0 0.025 136-137 0.6125 0.0 0.0 0.0 0.025 138 0.65 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACACAT 10 0.006973645 144.0 3 >>END_MODULE SRR8380050 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380050_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.37 32.0 32.0 32.0 32.0 32.0 2 31.51125 32.0 32.0 32.0 32.0 32.0 3 34.82625 37.0 32.0 37.0 32.0 37.0 4 30.21 32.0 27.0 37.0 12.0 37.0 5 35.69 37.0 37.0 37.0 32.0 37.0 6 38.76425 41.0 37.0 41.0 32.0 41.0 7 38.738 41.0 41.0 41.0 32.0 41.0 8 39.265 41.0 41.0 41.0 37.0 41.0 9 39.40875 41.0 41.0 41.0 37.0 41.0 10-14 39.30255 41.0 40.2 41.0 36.0 41.0 15-19 38.8632 41.0 39.4 41.0 35.0 41.0 20-24 39.10065 41.0 41.0 41.0 36.0 41.0 25-29 37.5249 40.2 37.4 41.0 30.0 41.0 30-34 39.2881 41.0 41.0 41.0 37.0 41.0 35-39 38.184749999999994 41.0 39.4 41.0 32.0 41.0 40-44 37.465050000000005 41.0 37.6 41.0 29.0 41.0 45-49 38.1256 41.0 37.0 41.0 31.0 41.0 50-54 38.416250000000005 41.0 39.4 41.0 31.0 41.0 55-59 37.14640000000001 41.0 36.8 41.0 27.0 41.0 60-64 37.885799999999996 41.0 38.6 41.0 29.0 41.0 65-69 38.0957 41.0 37.0 41.0 31.0 41.0 70-74 37.933350000000004 41.0 37.0 41.0 30.0 41.0 75-79 37.786300000000004 41.0 37.0 41.0 30.0 41.0 80-84 37.24210000000001 41.0 36.8 41.0 27.0 41.0 85-89 38.183749999999996 41.0 39.4 41.0 30.0 41.0 90-94 36.238350000000004 40.2 35.6 41.0 24.0 41.0 95-99 37.60915 41.0 37.0 41.0 30.0 41.0 100-104 37.445350000000005 41.0 37.0 41.0 28.0 41.0 105-109 36.58095 41.0 36.0 41.0 26.0 41.0 110-114 35.66635 39.4 33.0 41.0 24.0 41.0 115-119 37.143950000000004 41.0 37.0 41.0 27.0 41.0 120-124 36.89335 41.0 37.0 41.0 27.0 41.0 125-129 35.3288 40.2 33.0 41.0 21.0 41.0 130-134 34.53574999999999 39.4 31.0 41.0 18.0 41.0 135-139 33.0536 37.0 27.0 41.0 12.0 41.0 140-144 32.7537 37.0 26.0 41.0 16.0 41.0 145-149 32.64985 37.0 27.0 41.0 12.0 41.0 150 28.5865 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 3.0 19 4.0 20 9.0 21 6.0 22 13.0 23 24.0 24 20.0 25 30.0 26 34.0 27 40.0 28 39.0 29 73.0 30 70.0 31 92.0 32 111.0 33 154.0 34 172.0 35 229.0 36 285.0 37 426.0 38 639.0 39 921.0 40 604.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 13.675 17.025000000000002 41.175 2 27.425 22.925 27.625 22.025 3 27.6 25.35 19.55 27.500000000000004 4 29.025000000000002 28.449999999999996 13.850000000000001 28.675 5 29.549999999999997 30.099999999999998 16.175 24.175 6 22.3 32.925 18.099999999999998 26.674999999999997 7 19.950000000000003 14.000000000000002 37.175000000000004 28.875 8 22.725 17.25 22.2 37.824999999999996 9 23.45 18.125 28.4 30.025000000000002 10-14 25.814999999999998 23.595 21.665 28.925 15-19 26.605 22.215 23.025000000000002 28.155 20-24 26.900000000000002 22.955000000000002 22.34 27.805000000000003 25-29 27.389999999999997 23.165 21.545 27.900000000000002 30-34 27.05 23.26 21.8 27.889999999999997 35-39 27.73 22.79 21.54 27.939999999999998 40-44 27.6 23.005 21.46 27.935 45-49 26.82 22.945 21.775 28.46 50-54 26.91 22.95 21.62 28.52 55-59 26.86 22.685 21.725 28.73 60-64 27.295 22.264999999999997 21.805 28.634999999999998 65-69 26.919999999999998 22.855 21.625 28.599999999999998 70-74 27.634999999999998 22.445 21.55 28.37 75-79 27.66 22.43 21.445 28.465 80-84 27.01 22.45 21.89 28.65 85-89 27.045 22.650000000000002 21.805 28.499999999999996 90-94 27.689999999999998 22.564999999999998 21.705 28.04 95-99 27.900000000000002 22.395 21.29 28.415000000000003 100-104 27.815 22.735 21.615000000000002 27.834999999999997 105-109 27.750000000000004 22.125 21.4 28.725 110-114 28.09 23.055 20.75 28.105000000000004 115-119 28.355000000000004 21.43 21.67 28.544999999999998 120-124 27.794999999999998 22.97 21.41 27.825 125-129 27.97 21.990000000000002 22.040000000000003 28.000000000000004 130-134 28.415000000000003 21.795 21.525 28.265 135-139 27.73 22.355 22.24 27.675 140-144 27.865000000000002 21.69 21.895 28.549999999999997 145-149 27.82 22.62 21.54 28.02 150 28.349999999999998 23.625 22.1 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.0 28 0.5 29 3.5 30 7.0 31 8.5 32 9.5 33 16.5 34 26.0 35 29.5 36 32.5 37 33.5 38 49.0 39 68.0 40 73.5 41 86.5 42 103.0 43 116.0 44 116.0 45 113.0 46 113.0 47 116.5 48 120.0 49 122.0 50 120.0 51 106.5 52 93.5 53 92.0 54 98.0 55 106.0 56 105.5 57 98.0 58 99.0 59 102.0 60 109.5 61 113.0 62 111.5 63 114.0 64 104.5 65 94.5 66 96.0 67 94.0 68 88.0 69 90.0 70 90.5 71 76.0 72 68.0 73 64.5 74 65.5 75 60.5 76 43.5 77 35.0 78 27.5 79 17.5 80 10.5 81 11.0 82 10.0 83 8.0 84 6.0 85 1.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.57257632565613 87.35000000000001 2 5.78468130690948 10.8 3 0.6159614354579539 1.725 4 0.0 0.0 5 0.02678093197643278 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.16249999999999998 0.0 0.0 0.0 0.0 116-117 0.1875 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.2375 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.425 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.4375 0.0 0.0 0.0 0.0 134-135 0.5249999999999999 0.0 0.0 0.0 0.0 136-137 0.6125 0.0 0.0 0.0 0.0 138 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACGAGC 10 0.006973645 144.0 2 >>END_MODULE Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105389 spots for SRR8380050.sra Written 1105389 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra Read 1105372 spots for SRR8380050.sra Written 1105372 spots for SRR8380050.sra SRR ids: ['SRR8380050.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_77tigkyj SRR8380050.sra spots: 22107457 blocks: [[1, 1105372], [1105373, 2210744], [2210745, 3316116], [3316117, 4421488], [4421489, 5526860], [5526861, 6632232], [6632233, 7737604], [7737605, 8842976], [8842977, 9948348], [9948349, 11053720], [11053721, 12159092], [12159093, 13264464], [13264465, 14369836], [14369837, 15475208], [15475209, 16580580], [16580581, 17685952], [17685953, 18791324], [18791325, 19896696], [19896697, 21002068], [21002069, 22107457]] SRR8380050 file size 7426612 SRR8380050 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380050 SRR8380050_1.fastq SRR8380050_2.fastq Input file: SRR8380050_1.fastq Paired file: SRR8380050_2.fastq trimmed: SRR8380050-trimmed-pair1.fastq, SRR8380050-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:58:50 2024 >> started Sat Dec 7 15:59:49 2024 >> done (59.577s) 22107457 read pairs processed; of these: 896 ( 0.00%) short read pairs filtered out after trimming by size control 645 ( 0.00%) empty read pairs filtered out after trimming by size control 22105916 (99.99%) read pairs available; of these: 971593 ( 4.40%) trimmed read pairs available after processing 21134323 (95.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 107 0.00% 19 106 0.00% 20 150 0.00% 21 154 0.00% 22 183 0.00% 23 205 0.00% 24 237 0.00% 25 266 0.00% 26 209 0.00% 27 263 0.00% 28 264 0.00% 29 276 0.00% 30 276 0.00% 31 249 0.00% 32 285 0.00% 33 314 0.00% 34 272 0.00% 35 260 0.00% 36 246 0.00% 37 275 0.00% 38 266 0.00% 39 256 0.00% 40 264 0.00% 41 304 0.00% 42 266 0.00% 43 283 0.00% 44 253 0.00% 45 281 0.00% 46 236 0.00% 47 285 0.00% 48 278 0.00% 49 272 0.00% 50 274 0.00% 51 268 0.00% 52 244 0.00% 53 249 0.00% 54 272 0.00% 55 293 0.00% 56 254 0.00% 57 241 0.00% 58 259 0.00% 59 262 0.00% 60 265 0.00% 61 285 0.00% 62 260 0.00% 63 275 0.00% 64 305 0.00% 65 288 0.00% 66 259 0.00% 67 284 0.00% 68 263 0.00% 69 276 0.00% 70 278 0.00% 71 311 0.00% 72 368 0.00% 73 338 0.00% 74 312 0.00% 75 340 0.00% 76 311 0.00% 77 335 0.00% 78 351 0.00% 79 424 0.00% 80 409 0.00% 81 439 0.00% 82 516 0.00% 83 511 0.00% 84 616 0.00% 85 567 0.00% 86 626 0.00% 87 594 0.00% 88 629 0.00% 89 661 0.00% 90 756 0.00% 91 811 0.00% 92 935 0.00% 93 970 0.00% 94 1110 0.01% 95 1086 0.00% 96 1112 0.01% 97 1113 0.01% 98 1296 0.01% 99 1279 0.01% 100 1308 0.01% 101 1456 0.01% 102 1638 0.01% 103 1688 0.01% 104 1921 0.01% 105 1921 0.01% 106 1970 0.01% 107 2045 0.01% 108 2124 0.01% 109 2150 0.01% 110 2316 0.01% 111 2416 0.01% 112 2618 0.01% 113 2911 0.01% 114 2958 0.01% 115 3092 0.01% 116 3293 0.01% 117 3283 0.01% 118 3436 0.02% 119 3473 0.02% 120 3684 0.02% 121 3801 0.02% 122 4191 0.02% 123 4376 0.02% 124 4677 0.02% 125 4928 0.02% 126 5065 0.02% 127 5111 0.02% 128 5405 0.02% 129 5557 0.03% 130 5693 0.03% 131 6049 0.03% 132 6363 0.03% 133 6550 0.03% 134 7120 0.03% 135 7257 0.03% 136 7517 0.03% 137 7862 0.04% 138 7962 0.04% 139 8420 0.04% 140 8522 0.04% 141 8846 0.04% 142 9281 0.04% 143 9922 0.04% 144 10408 0.05% 145 11442 0.05% 146 12489 0.06% 147 17925 0.08% 148 52582 0.24% 149 631950 2.86% 150 21134323 95.60% 22105916 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=20 prefix-density=0.82 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=16.84 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.2 sequence=ACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCAAGAC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=18 prefix-density=0.77 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=22.58 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=ACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCAAGAC SRR8380050 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:00:25 Started mapping on | Dec 07 16:00:25 Finished on | Dec 07 16:03:16 Mapping speed, Million of reads per hour | 465.39 Number of input reads | 22105916 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21088255 Uniquely mapped reads % | 95.40% Average mapped length | 297.76 Number of splices: Total | 17836755 Number of splices: Annotated (sjdb) | 16877190 Number of splices: GT/AG | 17594448 Number of splices: GC/AG | 199460 Number of splices: AT/AC | 4250 Number of splices: Non-canonical | 38597 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186751 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 45873 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.55% % of reads unmapped: other | 2.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 830910 830910 830910 N_multimapping 186751 186751 186751 N_noFeature 474418 10615989 10522358 N_ambiguous 614369 97173 96381 UnstrandedReadsAssigned:19999468 PositiveStrandReadsAssigned:10375093 NegativeStrandReadsAssigned:10469516 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380050 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380050-trimmed-pair1.fastq SRR8380050-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,105,916 reads, 20,666,140 reads pseudoaligned [quant] estimated average fragment length: 271.04 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR8380050.ke.tsv 35125 SRR8380050.se.tsv 88098 total ==> SRR8380050.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.237 0 0 PNS24247 1044 773.96 13.368 0.903921 PNS24249 1928 1657.96 112.829 3.56145 PNS24246 1044 773.96 13.368 0.903921 PNS24248 1044 773.96 13.368 0.903921 PNS24244 1471 1200.96 30.0674 1.31024 PNS24243 293 56.0224 2 1.86832 KQK14069 1603 1332.96 260.446 10.2255 KQK14071 474 206.594 24.6226 6.23733 ==> SRR8380050.se.tsv <== BRADI_1g14170v3 299 BRADI_1g53295v3 24 BRADI_1g59795v3 396 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 104 BRADI_1g74790v3 191 BRADI_1g09890v3 0 BRADI_1g77505v3 291 BRADI_1g48960v3 0 SRR8380050 completed mapping pipeline successfully