Starting /dee2/code/volunteer_pipeline.sh SRR8380051 current disk space = 1542156627968 free memory = 1606677988 SRR8380051 SRAfilesize bd57588f383bcb363ca57c2200ec48cc SRR8380051.sra SRR8380051.sra file validated SRR8380051 is paired end SRR8380051 is conventional basespace SRR8380051 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380051_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.6675 32.0 32.0 32.0 27.0 32.0 2 30.6775 32.0 32.0 32.0 27.0 32.0 3 33.2625 32.0 32.0 37.0 32.0 37.0 4 36.1025 37.0 37.0 37.0 32.0 37.0 5 29.9525 37.0 27.0 37.0 12.0 37.0 6 39.09 41.0 37.0 41.0 37.0 41.0 7 38.983 41.0 37.0 41.0 37.0 41.0 8 38.51 41.0 37.0 41.0 32.0 41.0 9 39.50975 41.0 41.0 41.0 37.0 41.0 10-14 39.7657 41.0 41.0 41.0 37.0 41.0 15-19 38.12445 41.0 37.6 41.0 31.0 41.0 20-24 39.159949999999995 41.0 40.2 41.0 34.0 41.0 25-29 39.47385 41.0 40.2 41.0 36.0 41.0 30-34 39.35435 41.0 40.2 41.0 36.0 41.0 35-39 38.20265 40.2 37.4 41.0 31.0 41.0 40-44 37.02695 39.2 33.6 41.0 31.0 41.0 45-49 39.204 41.0 40.2 41.0 36.0 41.0 50-54 32.44475 36.6 26.0 41.0 19.0 41.0 55-59 36.5247 41.0 34.0 41.0 26.0 41.0 60-64 36.93375 39.2 36.4 41.0 30.0 41.0 65-69 39.73055000000001 41.0 41.0 41.0 37.0 41.0 70-74 36.0745 39.2 32.6 41.0 27.0 41.0 75-79 37.65925 40.2 36.6 41.0 29.0 41.0 80-84 38.205149999999996 41.0 38.4 41.0 32.0 41.0 85-89 38.3264 41.0 38.6 41.0 33.0 41.0 90-94 38.76615 41.0 40.2 41.0 34.0 41.0 95-99 38.97595 41.0 40.2 41.0 35.0 41.0 100-104 37.39295 41.0 37.0 41.0 27.0 41.0 105-109 37.7119 40.2 37.4 41.0 30.0 41.0 110-114 37.7017 41.0 36.8 41.0 30.0 41.0 115-119 38.6235 41.0 39.4 41.0 33.0 41.0 120-124 38.01725 41.0 38.6 41.0 29.0 41.0 125-129 37.697449999999996 41.0 37.0 41.0 29.0 41.0 130-134 38.2598 41.0 37.8 41.0 32.0 41.0 135-139 37.52405 41.0 37.0 41.0 29.0 41.0 140-144 37.126549999999995 40.2 36.0 41.0 26.0 41.0 145-149 37.2572 41.0 37.0 41.0 29.0 41.0 150 37.77325 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 7.0 24 5.0 25 7.0 26 11.0 27 18.0 28 22.0 29 37.0 30 36.0 31 69.0 32 86.0 33 115.0 34 177.0 35 227.0 36 344.0 37 470.0 38 630.0 39 926.0 40 811.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.7526395173454 14.6807440925088 16.968325791855204 40.598290598290596 2 27.825 21.349999999999998 28.7 22.125 3 26.700000000000003 23.625 22.8 26.875 4 27.200000000000003 29.549999999999997 15.4 27.85 5 30.25 30.775000000000002 17.525 21.45 6 20.175 33.15 19.45 27.224999999999998 7 19.975 13.8 37.95 28.275 8 22.725 19.05 22.825 35.4 9 22.975 20.25 25.624999999999996 31.15 10-14 25.629999999999995 23.880000000000003 22.195 28.294999999999998 15-19 26.155 23.755000000000003 22.770000000000003 27.32 20-24 26.305 23.525 22.365 27.805000000000003 25-29 26.314999999999998 24.355 22.29 27.04 30-34 26.365 24.03 22.175 27.43 35-39 26.619999999999997 23.775 22.509999999999998 27.095000000000002 40-44 26.815 24.025 21.9 27.26 45-49 26.06 23.7 22.64 27.6 50-54 27.515 24.0 22.25 26.235000000000003 55-59 26.555 22.99 22.32 28.134999999999998 60-64 27.310000000000002 22.935 22.55 27.205000000000002 65-69 26.119999999999997 23.335 22.36 28.185 70-74 27.455000000000002 22.98 22.015 27.55 75-79 27.05 23.49 22.455 27.005000000000003 80-84 27.200000000000003 23.455000000000002 21.82 27.525 85-89 26.740000000000002 22.735 22.61 27.915 90-94 27.305 23.155 22.625 26.915 95-99 27.065 22.46 22.755 27.72 100-104 26.995 23.35 22.02 27.634999999999998 105-109 26.619999999999997 23.56 22.59 27.229999999999997 110-114 27.62 22.78 22.235 27.365000000000002 115-119 27.355 22.73 22.25 27.665 120-124 27.575 23.825 22.18 26.419999999999998 125-129 27.095000000000002 23.07 23.005 26.83 130-134 27.21 23.195 22.509999999999998 27.084999999999997 135-139 27.375 22.555 23.07 27.0 140-144 27.555000000000003 22.865 22.205 27.375 145-149 26.974999999999998 23.06 22.685 27.279999999999998 150 26.125 23.7 22.125 28.050000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 2.0 28 2.5 29 5.0 30 6.5 31 5.0 32 8.0 33 18.0 34 27.5 35 31.5 36 36.0 37 49.5 38 60.5 39 71.5 40 93.0 41 100.5 42 113.0 43 131.0 44 128.5 45 125.0 46 129.0 47 132.0 48 130.0 49 123.0 50 107.0 51 106.5 52 116.5 53 109.5 54 101.5 55 88.0 56 75.0 57 89.5 58 102.5 59 111.0 60 118.0 61 103.5 62 102.0 63 106.0 64 106.5 65 107.0 66 95.0 67 84.0 68 76.0 69 73.5 70 70.0 71 66.0 72 60.0 73 57.0 74 55.5 75 41.5 76 31.5 77 28.5 78 17.5 79 12.5 80 12.5 81 10.5 82 10.0 83 5.5 84 1.5 85 0.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.33719704952581 90.47500000000001 2 4.241306638566913 8.05 3 0.26343519494204426 0.75 4 0.052687038988408846 0.2 5 0.07903055848261328 0.375 6 0.026343519494204423 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCAAATGTA 6 0.15 No Hit CTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAAT 5 0.125 No Hit CGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGT 5 0.125 No Hit CGCCAACGGAACCCTCAAGCTCGTGGGCGGCCACTACGACTTCGTCTCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.6124999999999998 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACTTC 10 0.006973645 144.0 2 CTCAGGA 10 0.006973645 144.0 1 >>END_MODULE SRR8380051 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380051_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5175 32.0 32.0 32.0 32.0 32.0 2 31.46375 32.0 32.0 32.0 32.0 32.0 3 34.77625 37.0 32.0 37.0 32.0 37.0 4 30.02 32.0 27.0 37.0 12.0 37.0 5 35.845 37.0 37.0 37.0 32.0 37.0 6 38.62275 41.0 37.0 41.0 32.0 41.0 7 38.9095 41.0 41.0 41.0 32.0 41.0 8 39.4245 41.0 41.0 41.0 37.0 41.0 9 39.62225 41.0 41.0 41.0 37.0 41.0 10-14 39.4337 41.0 40.2 41.0 36.0 41.0 15-19 39.0373 41.0 39.4 41.0 35.0 41.0 20-24 39.24165 41.0 41.0 41.0 36.0 41.0 25-29 37.7281 40.2 37.4 41.0 31.0 41.0 30-34 39.49425 41.0 41.0 41.0 37.0 41.0 35-39 38.3232 41.0 39.4 41.0 32.0 41.0 40-44 37.61145 41.0 37.6 41.0 30.0 41.0 45-49 38.2325 41.0 37.8 41.0 31.0 41.0 50-54 38.57845 41.0 39.4 41.0 32.0 41.0 55-59 37.48965 41.0 36.8 41.0 29.0 41.0 60-64 38.096250000000005 41.0 39.4 41.0 30.0 41.0 65-69 38.262950000000004 41.0 37.8 41.0 32.0 41.0 70-74 38.0961 41.0 37.0 41.0 31.0 41.0 75-79 37.83525 41.0 37.8 41.0 30.0 41.0 80-84 37.506 41.0 36.8 41.0 29.0 41.0 85-89 38.45395 41.0 39.4 41.0 32.0 41.0 90-94 36.28359999999999 40.2 35.6 41.0 25.0 41.0 95-99 37.76995 41.0 37.0 41.0 30.0 41.0 100-104 37.60875 41.0 37.0 41.0 29.0 41.0 105-109 36.65545 41.0 36.0 41.0 26.0 41.0 110-114 35.81025 39.4 33.0 41.0 25.0 41.0 115-119 37.3281 41.0 37.0 41.0 28.0 41.0 120-124 36.90815 41.0 37.0 41.0 28.0 41.0 125-129 35.36045 40.2 33.0 41.0 23.0 41.0 130-134 34.77945 39.4 32.0 41.0 20.0 41.0 135-139 33.371249999999996 37.0 28.0 41.0 14.0 41.0 140-144 32.81230000000001 37.0 27.0 41.0 12.0 41.0 145-149 32.70165 37.0 27.0 41.0 12.0 41.0 150 28.42825 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 4.0 20 2.0 21 7.0 22 8.0 23 16.0 24 23.0 25 22.0 26 29.0 27 31.0 28 56.0 29 44.0 30 73.0 31 85.0 32 119.0 33 127.0 34 179.0 35 269.0 36 312.0 37 438.0 38 635.0 39 893.0 40 625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.4 13.25 18.65 39.7 2 27.625 21.2 28.549999999999997 22.625 3 27.474999999999998 25.2 21.425 25.900000000000002 4 28.875 29.9 14.299999999999999 26.924999999999997 5 28.050000000000004 30.875000000000004 15.925 25.15 6 20.849999999999998 32.625 19.3 27.224999999999998 7 20.175 14.725 36.8 28.299999999999997 8 22.675 18.475 23.0 35.85 9 21.9 18.5 27.400000000000002 32.2 10-14 25.71 24.18 22.165000000000003 27.944999999999997 15-19 25.979999999999997 23.525 22.855 27.639999999999997 20-24 26.69 23.53 22.73 27.05 25-29 26.755000000000003 23.955000000000002 21.935 27.355 30-34 25.8 24.055 22.759999999999998 27.384999999999998 35-39 26.450000000000003 23.45 22.285 27.815 40-44 26.6 23.385 21.925 28.09 45-49 26.325 23.474999999999998 22.645 27.555000000000003 50-54 26.640000000000004 23.335 22.42 27.605 55-59 27.495000000000005 23.135 21.759999999999998 27.61 60-64 26.779999999999998 22.97 22.625 27.625 65-69 26.805 23.3 21.935 27.96 70-74 26.8 24.005000000000003 22.055 27.139999999999997 75-79 27.075 23.01 22.505 27.41 80-84 27.165 23.085 22.375 27.375 85-89 26.634999999999998 23.51 22.29 27.565 90-94 27.084999999999997 23.605 22.075 27.235 95-99 26.58 23.515 22.67 27.235 100-104 27.35 23.16 22.384999999999998 27.105 105-109 26.6 23.06 22.314999999999998 28.025 110-114 27.18 23.075000000000003 22.57 27.175 115-119 27.26 22.59 22.275 27.875 120-124 27.575 23.005 22.59 26.83 125-129 27.305 22.53 22.634999999999998 27.529999999999998 130-134 27.445000000000004 23.04 22.685 26.83 135-139 27.310000000000002 22.720000000000002 22.515 27.455000000000002 140-144 27.189999999999998 22.935 22.73 27.145000000000003 145-149 27.555000000000003 23.375 22.485 26.584999999999997 150 26.974999999999998 23.474999999999998 23.775 25.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 1.0 24 1.5 25 1.0 26 0.5 27 0.0 28 2.5 29 5.0 30 8.5 31 11.5 32 17.0 33 21.0 34 18.0 35 22.5 36 31.5 37 46.0 38 63.0 39 80.5 40 102.5 41 111.0 42 126.5 43 135.5 44 121.5 45 118.0 46 122.5 47 116.5 48 116.0 49 130.5 50 127.0 51 102.0 52 99.0 53 103.0 54 93.0 55 94.5 56 90.5 57 94.0 58 112.0 59 110.5 60 99.0 61 96.0 62 102.0 63 99.0 64 102.5 65 101.0 66 93.5 67 90.5 68 84.5 69 75.0 70 65.5 71 70.5 72 59.5 73 54.5 74 56.5 75 45.5 76 37.0 77 26.5 78 17.0 79 14.5 80 14.0 81 12.5 82 8.5 83 5.5 84 4.0 85 2.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.35120643431635 87.05000000000001 2 6.13941018766756 11.450000000000001 3 0.42895442359249336 1.2 4 0.08042895442359249 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.2625 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.7374999999999998 0.0 0.0 0.0 0.0 136-137 1.7999999999999998 0.0 0.0 0.0 0.0 138 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACTC 10 0.006973645 144.0 2 CCCAACT 10 0.006973645 144.0 1 >>END_MODULE Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121131 spots for SRR8380051.sra Written 1121131 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra Read 1121127 spots for SRR8380051.sra Written 1121127 spots for SRR8380051.sra SRR ids: ['SRR8380051.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z4cl28x0 SRR8380051.sra spots: 22422544 blocks: [[1, 1121127], [1121128, 2242254], [2242255, 3363381], [3363382, 4484508], [4484509, 5605635], [5605636, 6726762], [6726763, 7847889], [7847890, 8969016], [8969017, 10090143], [10090144, 11211270], [11211271, 12332397], [12332398, 13453524], [13453525, 14574651], [14574652, 15695778], [15695779, 16816905], [16816906, 17938032], [17938033, 19059159], [19059160, 20180286], [20180287, 21301413], [21301414, 22422544]] SRR8380051 file size 7532770 SRR8380051 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380051 SRR8380051_1.fastq SRR8380051_2.fastq Input file: SRR8380051_1.fastq Paired file: SRR8380051_2.fastq trimmed: SRR8380051-trimmed-pair1.fastq, SRR8380051-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:02:49 2024 >> started Sat Dec 7 16:03:24 2024 >> done (34.418s) 22422544 read pairs processed; of these: 2511 ( 0.01%) short read pairs filtered out after trimming by size control 1106 ( 0.00%) empty read pairs filtered out after trimming by size control 22418927 (99.98%) read pairs available; of these: 1227795 ( 5.48%) trimmed read pairs available after processing 21191132 (94.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 301 0.00% 19 263 0.00% 20 352 0.00% 21 360 0.00% 22 335 0.00% 23 391 0.00% 24 375 0.00% 25 300 0.00% 26 341 0.00% 27 406 0.00% 28 297 0.00% 29 383 0.00% 30 344 0.00% 31 301 0.00% 32 335 0.00% 33 273 0.00% 34 294 0.00% 35 277 0.00% 36 279 0.00% 37 284 0.00% 38 304 0.00% 39 279 0.00% 40 350 0.00% 41 411 0.00% 42 255 0.00% 43 261 0.00% 44 283 0.00% 45 249 0.00% 46 263 0.00% 47 231 0.00% 48 281 0.00% 49 232 0.00% 50 253 0.00% 51 260 0.00% 52 275 0.00% 53 274 0.00% 54 288 0.00% 55 261 0.00% 56 298 0.00% 57 260 0.00% 58 269 0.00% 59 299 0.00% 60 302 0.00% 61 312 0.00% 62 324 0.00% 63 323 0.00% 64 310 0.00% 65 338 0.00% 66 361 0.00% 67 338 0.00% 68 387 0.00% 69 391 0.00% 70 429 0.00% 71 567 0.00% 72 557 0.00% 73 611 0.00% 74 615 0.00% 75 632 0.00% 76 640 0.00% 77 691 0.00% 78 701 0.00% 79 849 0.00% 80 911 0.00% 81 923 0.00% 82 1141 0.01% 83 1227 0.01% 84 1367 0.01% 85 1370 0.01% 86 1441 0.01% 87 1475 0.01% 88 1553 0.01% 89 1611 0.01% 90 1955 0.01% 91 2144 0.01% 92 2353 0.01% 93 2716 0.01% 94 2870 0.01% 95 2928 0.01% 96 2885 0.01% 97 3137 0.01% 98 3284 0.01% 99 3385 0.02% 100 3527 0.02% 101 3877 0.02% 102 4135 0.02% 103 4635 0.02% 104 4882 0.02% 105 5057 0.02% 106 5033 0.02% 107 5303 0.02% 108 5239 0.02% 109 5266 0.02% 110 5630 0.03% 111 6013 0.03% 112 6308 0.03% 113 7012 0.03% 114 7375 0.03% 115 7528 0.03% 116 7626 0.03% 117 7674 0.03% 118 7773 0.03% 119 8247 0.04% 120 8287 0.04% 121 8504 0.04% 122 9051 0.04% 123 9714 0.04% 124 9993 0.04% 125 10495 0.05% 126 10953 0.05% 127 10998 0.05% 128 11060 0.05% 129 11143 0.05% 130 11530 0.05% 131 11898 0.05% 132 12733 0.06% 133 12810 0.06% 134 13906 0.06% 135 14133 0.06% 136 14344 0.06% 137 14571 0.06% 138 14944 0.07% 139 15378 0.07% 140 15840 0.07% 141 16135 0.07% 142 16645 0.07% 143 17297 0.08% 144 18271 0.08% 145 19339 0.09% 146 20997 0.09% 147 25674 0.11% 148 59252 0.26% 149 600779 2.68% 150 21191132 94.52% 22418927 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=25 prefix-density=0.89 prefix-fanout=2.1 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=7.61 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=27 prefix-density=0.87 prefix-fanout=2.1 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=30.85 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=CAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCAAGAC SRR8380051 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:04:09 Started mapping on | Dec 07 16:04:09 Finished on | Dec 07 16:07:01 Mapping speed, Million of reads per hour | 469.23 Number of input reads | 22418927 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21384233 Uniquely mapped reads % | 95.38% Average mapped length | 297.06 Number of splices: Total | 16216367 Number of splices: Annotated (sjdb) | 15222102 Number of splices: GT/AG | 15986281 Number of splices: GC/AG | 189350 Number of splices: AT/AC | 4362 Number of splices: Non-canonical | 36374 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 179945 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 45966 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 1.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 854749 854749 854749 N_multimapping 179945 179945 179945 N_noFeature 474794 10671695 10727869 N_ambiguous 631121 89052 87185 UnstrandedReadsAssigned:20278318 PositiveStrandReadsAssigned:10623486 NegativeStrandReadsAssigned:10569179 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380051 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380051-trimmed-pair1.fastq SRR8380051-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,418,927 reads, 21,011,960 reads pseudoaligned [quant] estimated average fragment length: 262.129 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52973 SRR8380051.ke.tsv 35125 SRR8380051.se.tsv 88098 total ==> SRR8380051.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.14 0 0 PNS24247 1044 782.871 18.1913 1.23709 PNS24249 1928 1666.87 82.5789 2.63751 PNS24246 1044 782.871 18.1913 1.23709 PNS24248 1044 782.871 18.1913 1.23709 PNS24244 1471 1209.87 76.8472 3.38156 PNS24243 293 62.3108 1 0.854406 KQK14069 1603 1341.87 44.2933 1.75734 KQK14071 474 215.317 0 0 ==> SRR8380051.se.tsv <== BRADI_1g14170v3 48 BRADI_1g53295v3 25 BRADI_1g59795v3 362 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 228 BRADI_1g74790v3 345 BRADI_1g09890v3 0 BRADI_1g77505v3 373 BRADI_1g48960v3 0 SRR8380051 completed mapping pipeline successfully