Starting /dee2/code/volunteer_pipeline.sh SRR8380052 current disk space = 1542060560384 free memory = 1456498084 SRR8380052 SRAfilesize 6703aa48d82ad206d8c5f86d13456757 SRR8380052.sra SRR8380052.sra file validated SRR8380052 is paired end SRR8380052 is conventional basespace SRR8380052 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380052_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.3375 32.0 32.0 32.0 12.0 32.0 2 30.645 32.0 32.0 32.0 27.0 32.0 3 33.4175 32.0 32.0 37.0 32.0 37.0 4 36.2425 37.0 37.0 37.0 32.0 37.0 5 30.24875 37.0 27.0 37.0 12.0 37.0 6 39.0865 41.0 37.0 41.0 37.0 41.0 7 39.166 41.0 37.0 41.0 37.0 41.0 8 38.5465 41.0 37.0 41.0 32.0 41.0 9 39.34875 41.0 41.0 41.0 37.0 41.0 10-14 39.845299999999995 41.0 41.0 41.0 37.0 41.0 15-19 38.23555 41.0 37.6 41.0 31.0 41.0 20-24 39.24444999999999 41.0 40.2 41.0 35.0 41.0 25-29 39.6241 41.0 41.0 41.0 36.0 41.0 30-34 39.52565 41.0 40.2 41.0 36.0 41.0 35-39 38.3172 40.2 38.2 41.0 31.0 41.0 40-44 37.1163 39.2 34.4 41.0 31.0 41.0 45-49 39.26495 41.0 40.2 41.0 36.0 41.0 50-54 32.8009 37.6 26.0 41.0 19.0 41.0 55-59 36.846900000000005 41.0 34.8 41.0 27.0 41.0 60-64 37.15525 39.2 36.4 41.0 30.0 41.0 65-69 39.852500000000006 41.0 41.0 41.0 37.0 41.0 70-74 36.24005 39.2 33.6 41.0 27.0 41.0 75-79 37.7761 40.2 36.6 41.0 29.0 41.0 80-84 38.38119999999999 41.0 39.2 41.0 33.0 41.0 85-89 38.5029 41.0 39.4 41.0 33.0 41.0 90-94 38.8514 41.0 40.2 41.0 35.0 41.0 95-99 39.109750000000005 41.0 41.0 41.0 35.0 41.0 100-104 37.573249999999994 41.0 37.0 41.0 29.0 41.0 105-109 37.8803 40.2 37.4 41.0 30.0 41.0 110-114 37.8925 41.0 37.6 41.0 31.0 41.0 115-119 38.81235 41.0 40.2 41.0 33.0 41.0 120-124 38.25585 41.0 38.6 41.0 32.0 41.0 125-129 37.804050000000004 41.0 37.0 41.0 29.0 41.0 130-134 38.38615 41.0 37.8 41.0 32.0 41.0 135-139 37.6651 41.0 37.0 41.0 30.0 41.0 140-144 37.156549999999996 40.2 36.0 41.0 27.0 41.0 145-149 37.39965 41.0 37.0 41.0 29.0 41.0 150 37.7665 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 6.0 25 10.0 26 15.0 27 20.0 28 28.0 29 29.0 30 47.0 31 61.0 32 87.0 33 117.0 34 115.0 35 212.0 36 299.0 37 452.0 38 635.0 39 942.0 40 922.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.72260015117158 13.781809019904259 18.241370622323004 39.25422020660116 2 26.974999999999998 23.075000000000003 27.775 22.175 3 27.35 24.8 23.0 24.85 4 26.575 31.1 15.275 27.05 5 31.324999999999996 29.475 17.95 21.25 6 22.05 32.475 19.375 26.1 7 21.375 12.825000000000001 37.675 28.125 8 22.25 18.55 22.7 36.5 9 23.549999999999997 19.8 27.224999999999998 29.425 10-14 26.115 23.585 22.48 27.82 15-19 26.075 23.580000000000002 23.36 26.985 20-24 26.005 23.71 22.81 27.474999999999998 25-29 26.085 23.435 23.195 27.284999999999997 30-34 26.205000000000002 24.395 22.495 26.905 35-39 26.985 23.215 22.455 27.345000000000002 40-44 26.8 23.115 22.650000000000002 27.435 45-49 27.134999999999998 23.195 22.675 26.995 50-54 27.955000000000002 23.005 22.925 26.115 55-59 27.36 23.244999999999997 22.275 27.12 60-64 27.365000000000002 23.474999999999998 22.445 26.715 65-69 27.22 22.74 23.24 26.8 70-74 27.54 23.25 22.515 26.695 75-79 27.93 22.835 22.31 26.924999999999997 80-84 27.025 22.745 22.945 27.284999999999997 85-89 27.944999999999997 22.67 22.68 26.705000000000002 90-94 27.41 23.14 22.495 26.955000000000002 95-99 27.35 23.095 22.36 27.195000000000004 100-104 27.05 23.29 22.2 27.46 105-109 27.034999999999997 22.925 22.235 27.805000000000003 110-114 27.189999999999998 23.925 21.855 27.029999999999998 115-119 26.974999999999998 22.805 22.37 27.85 120-124 26.729999999999997 23.43 22.21 27.63 125-129 27.889999999999997 23.155 22.445 26.51 130-134 27.145000000000003 22.89 23.03 26.935 135-139 26.99 23.27 22.470000000000002 27.27 140-144 27.62 22.365 22.61 27.405 145-149 27.62 23.09 22.36 26.93 150 27.725 23.95 22.575 25.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.5 26 1.5 27 0.5 28 3.5 29 6.5 30 9.5 31 9.5 32 10.5 33 19.0 34 24.0 35 30.5 36 42.0 37 56.5 38 66.5 39 72.5 40 85.0 41 101.5 42 126.0 43 140.5 44 128.5 45 130.0 46 134.0 47 135.0 48 125.0 49 109.5 50 106.0 51 101.5 52 104.0 53 102.5 54 100.0 55 87.5 56 91.0 57 99.5 58 89.5 59 110.0 60 111.5 61 99.5 62 113.5 63 105.0 64 96.5 65 88.5 66 81.5 67 84.0 68 85.0 69 85.5 70 74.0 71 62.5 72 59.0 73 55.0 74 49.0 75 40.5 76 38.0 77 30.5 78 16.5 79 14.0 80 14.0 81 9.5 82 9.0 83 7.5 84 3.5 85 2.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.55314648334215 89.4 2 5.156002115282919 9.75 3 0.26441036488630354 0.75 4 0.026441036488630353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5249999999999999 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCTTC 10 0.006973645 144.0 3 >>END_MODULE SRR8380052 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380052_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5975 32.0 32.0 32.0 32.0 32.0 2 31.52125 32.0 32.0 32.0 32.0 32.0 3 35.08 37.0 32.0 37.0 32.0 37.0 4 30.00875 32.0 27.0 37.0 12.0 37.0 5 35.92 37.0 37.0 37.0 32.0 37.0 6 38.763 41.0 37.0 41.0 32.0 41.0 7 39.034 41.0 41.0 41.0 37.0 41.0 8 39.39225 41.0 41.0 41.0 37.0 41.0 9 39.61525 41.0 41.0 41.0 37.0 41.0 10-14 39.5564 41.0 41.0 41.0 36.0 41.0 15-19 39.10885 41.0 39.4 41.0 35.0 41.0 20-24 39.360299999999995 41.0 41.0 41.0 37.0 41.0 25-29 37.87825 40.2 37.4 41.0 31.0 41.0 30-34 39.505849999999995 41.0 41.0 41.0 37.0 41.0 35-39 38.428999999999995 41.0 39.4 41.0 33.0 41.0 40-44 37.685050000000004 41.0 37.6 41.0 30.0 41.0 45-49 38.38119999999999 41.0 38.6 41.0 32.0 41.0 50-54 38.6935 41.0 40.2 41.0 33.0 41.0 55-59 37.5173 41.0 36.8 41.0 29.0 41.0 60-64 38.147949999999994 41.0 39.4 41.0 31.0 41.0 65-69 38.3947 41.0 39.4 41.0 31.0 41.0 70-74 38.287000000000006 41.0 37.8 41.0 32.0 41.0 75-79 37.95335 41.0 38.6 41.0 30.0 41.0 80-84 37.5751 41.0 38.6 41.0 29.0 41.0 85-89 38.56165000000001 41.0 39.4 41.0 32.0 41.0 90-94 36.4887 40.2 35.6 41.0 27.0 41.0 95-99 37.9159 41.0 37.0 41.0 31.0 41.0 100-104 37.81095 41.0 37.0 41.0 29.0 41.0 105-109 36.892950000000006 41.0 37.0 41.0 26.0 41.0 110-114 35.947 39.4 33.0 41.0 26.0 41.0 115-119 37.46815 41.0 37.0 41.0 31.0 41.0 120-124 37.062599999999996 41.0 37.0 41.0 28.0 41.0 125-129 35.58385 41.0 33.0 41.0 23.0 41.0 130-134 35.009249999999994 39.4 32.0 41.0 22.0 41.0 135-139 33.74675 37.0 29.0 41.0 16.0 41.0 140-144 33.269600000000004 37.0 29.0 41.0 18.0 41.0 145-149 33.1331 37.0 27.0 41.0 14.0 41.0 150 28.976 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 4.0 19 5.0 20 4.0 21 8.0 22 5.0 23 14.0 24 10.0 25 30.0 26 31.0 27 42.0 28 43.0 29 61.0 30 53.0 31 71.0 32 122.0 33 131.0 34 149.0 35 195.0 36 304.0 37 426.0 38 593.0 39 994.0 40 701.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.975 14.6 18.625 38.800000000000004 2 27.375 22.1 28.799999999999997 21.725 3 27.05 24.725 21.55 26.674999999999997 4 28.299999999999997 29.675 15.1 26.924999999999997 5 28.775000000000002 29.575000000000003 17.150000000000002 24.5 6 21.775 31.900000000000002 19.15 27.175 7 19.725 14.174999999999999 37.875 28.225 8 22.575 19.2 23.25 34.975 9 23.0 19.225 27.875 29.9 10-14 25.3 23.98 22.38 28.34 15-19 26.279999999999998 23.055 23.305 27.36 20-24 25.72 23.799999999999997 23.07 27.41 25-29 26.72 23.635 22.525000000000002 27.12 30-34 26.43 23.985 22.965 26.619999999999997 35-39 26.950000000000003 23.255 22.675 27.12 40-44 25.919999999999998 23.865 22.725 27.49 45-49 26.279999999999998 23.98 22.470000000000002 27.27 50-54 26.76 23.79 22.57 26.88 55-59 26.619999999999997 23.294999999999998 22.759999999999998 27.325 60-64 26.39 23.669999999999998 22.314999999999998 27.625 65-69 26.775 23.405 22.325 27.495000000000005 70-74 26.834999999999997 23.175 22.095000000000002 27.894999999999996 75-79 26.165 22.939999999999998 22.71 28.185 80-84 26.419999999999998 22.89 22.78 27.91 85-89 27.284999999999997 22.95 22.040000000000003 27.725 90-94 27.24 23.085 22.384999999999998 27.29 95-99 27.325 22.775000000000002 22.475 27.425 100-104 26.93 23.26 22.875 26.935 105-109 27.224999999999998 22.805 22.264999999999997 27.705000000000002 110-114 27.04 23.064999999999998 22.36 27.534999999999997 115-119 27.215 22.54 22.08 28.165000000000003 120-124 27.49 23.05 22.41 27.05 125-129 27.200000000000003 22.919999999999998 22.28 27.6 130-134 27.075 22.98 22.855 27.089999999999996 135-139 27.284999999999997 22.259999999999998 23.200000000000003 27.255000000000003 140-144 27.73 23.095 21.815 27.36 145-149 28.025 23.035 21.990000000000002 26.950000000000003 150 28.599999999999998 22.225 23.125 26.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 0.0 27 2.0 28 5.5 29 6.0 30 7.5 31 11.0 32 15.5 33 17.5 34 21.5 35 30.0 36 37.0 37 45.5 38 64.5 39 85.5 40 91.0 41 100.0 42 119.5 43 124.0 44 127.0 45 139.5 46 129.0 47 127.5 48 142.0 49 132.5 50 111.5 51 107.0 52 104.5 53 95.5 54 100.0 55 101.5 56 93.5 57 92.5 58 102.0 59 102.0 60 99.0 61 106.0 62 95.0 63 80.5 64 83.5 65 89.5 66 84.0 67 85.5 68 98.5 69 92.5 70 80.0 71 70.0 72 69.5 73 62.0 74 43.0 75 38.0 76 32.0 77 26.0 78 23.5 79 16.5 80 10.0 81 6.0 82 5.5 83 4.0 84 1.5 85 1.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.42245989304813 87.35000000000001 2 6.2032085561497325 11.600000000000001 3 0.37433155080213903 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.2000000000000002 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCCTG 10 0.006973645 144.0 4 GCCCTGG 15 1.1730364E-4 144.0 5 AAGCTGA 20 0.006139246 28.8 130-134 >>END_MODULE Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210800 spots for SRR8380052.sra Written 1210800 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra Read 1210794 spots for SRR8380052.sra Written 1210794 spots for SRR8380052.sra SRR ids: ['SRR8380052.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pvc9gj66 SRR8380052.sra spots: 24215886 blocks: [[1, 1210794], [1210795, 2421588], [2421589, 3632382], [3632383, 4843176], [4843177, 6053970], [6053971, 7264764], [7264765, 8475558], [8475559, 9686352], [9686353, 10897146], [10897147, 12107940], [12107941, 13318734], [13318735, 14529528], [14529529, 15740322], [15740323, 16951116], [16951117, 18161910], [18161911, 19372704], [19372705, 20583498], [20583499, 21794292], [21794293, 23005086], [23005087, 24215886]] SRR8380052 file size 8136972 SRR8380052 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380052 SRR8380052_1.fastq SRR8380052_2.fastq Input file: SRR8380052_1.fastq Paired file: SRR8380052_2.fastq trimmed: SRR8380052-trimmed-pair1.fastq, SRR8380052-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:10:42 2024 >> started Sat Dec 7 16:11:07 2024 >> done (25.437s) 24215886 read pairs processed; of these: 877 ( 0.00%) short read pairs filtered out after trimming by size control 1104 ( 0.00%) empty read pairs filtered out after trimming by size control 24213905 (99.99%) read pairs available; of these: 1234800 ( 5.10%) trimmed read pairs available after processing 22979105 (94.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 103 0.00% 19 121 0.00% 20 154 0.00% 21 185 0.00% 22 169 0.00% 23 227 0.00% 24 184 0.00% 25 272 0.00% 26 234 0.00% 27 241 0.00% 28 312 0.00% 29 266 0.00% 30 270 0.00% 31 268 0.00% 32 260 0.00% 33 250 0.00% 34 250 0.00% 35 237 0.00% 36 245 0.00% 37 228 0.00% 38 295 0.00% 39 250 0.00% 40 266 0.00% 41 253 0.00% 42 259 0.00% 43 281 0.00% 44 277 0.00% 45 275 0.00% 46 254 0.00% 47 270 0.00% 48 300 0.00% 49 258 0.00% 50 276 0.00% 51 287 0.00% 52 233 0.00% 53 265 0.00% 54 246 0.00% 55 273 0.00% 56 263 0.00% 57 292 0.00% 58 302 0.00% 59 283 0.00% 60 282 0.00% 61 305 0.00% 62 360 0.00% 63 365 0.00% 64 340 0.00% 65 343 0.00% 66 350 0.00% 67 303 0.00% 68 330 0.00% 69 427 0.00% 70 444 0.00% 71 493 0.00% 72 521 0.00% 73 561 0.00% 74 586 0.00% 75 591 0.00% 76 573 0.00% 77 635 0.00% 78 664 0.00% 79 794 0.00% 80 818 0.00% 81 954 0.00% 82 1076 0.00% 83 1256 0.01% 84 1250 0.01% 85 1284 0.01% 86 1258 0.01% 87 1338 0.01% 88 1358 0.01% 89 1528 0.01% 90 1731 0.01% 91 1887 0.01% 92 2135 0.01% 93 2394 0.01% 94 2428 0.01% 95 2518 0.01% 96 2729 0.01% 97 2809 0.01% 98 2945 0.01% 99 3085 0.01% 100 3221 0.01% 101 3504 0.01% 102 3829 0.02% 103 4025 0.02% 104 4241 0.02% 105 4440 0.02% 106 4502 0.02% 107 4612 0.02% 108 4760 0.02% 109 4803 0.02% 110 5209 0.02% 111 5357 0.02% 112 5765 0.02% 113 6399 0.03% 114 6633 0.03% 115 7097 0.03% 116 6934 0.03% 117 6835 0.03% 118 7209 0.03% 119 7409 0.03% 120 7597 0.03% 121 7999 0.03% 122 8771 0.04% 123 8711 0.04% 124 9516 0.04% 125 9779 0.04% 126 10302 0.04% 127 10223 0.04% 128 10725 0.04% 129 10693 0.04% 130 11134 0.05% 131 11456 0.05% 132 11868 0.05% 133 12433 0.05% 134 13294 0.05% 135 13806 0.06% 136 14066 0.06% 137 14404 0.06% 138 14277 0.06% 139 14974 0.06% 140 15576 0.06% 141 16096 0.07% 142 16650 0.07% 143 17447 0.07% 144 18130 0.07% 145 19742 0.08% 146 21414 0.09% 147 26596 0.11% 148 61094 0.25% 149 632761 2.61% 150 22979105 94.90% 24213905 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=30 prefix-density=0.57 prefix-fanout=2.2 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=30.20 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.7 sequence=CAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCAAGAC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=31 prefix-density=0.57 prefix-fanout=2.2 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=26.45 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.2 sequence=ACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCAAGAC SRR8380052 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:12:04 Started mapping on | Dec 07 16:12:04 Finished on | Dec 07 16:14:59 Mapping speed, Million of reads per hour | 498.11 Number of input reads | 24213905 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22973897 Uniquely mapped reads % | 94.88% Average mapped length | 297.29 Number of splices: Total | 18303409 Number of splices: Annotated (sjdb) | 17184429 Number of splices: GT/AG | 18035911 Number of splices: GC/AG | 220849 Number of splices: AT/AC | 5452 Number of splices: Non-canonical | 41197 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 208966 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 61593 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 2.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1031042 1031042 1031042 N_multimapping 208966 208966 208966 N_noFeature 586644 11506125 11545652 N_ambiguous 680572 88740 87719 UnstrandedReadsAssigned:21706681 PositiveStrandReadsAssigned:11379032 NegativeStrandReadsAssigned:11340526 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380052 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380052-trimmed-pair1.fastq SRR8380052-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,213,905 reads, 22,479,644 reads pseudoaligned [quant] estimated average fragment length: 262.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52973 SRR8380052.ke.tsv 35125 SRR8380052.se.tsv 88098 total ==> SRR8380052.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.162 0 0 PNS24247 1044 782.95 26.5494 1.70243 PNS24249 1928 1666.95 86.0502 2.59166 PNS24246 1044 782.95 26.5494 1.70243 PNS24248 1044 782.95 26.5494 1.70243 PNS24244 1471 1209.95 84.3014 3.49797 PNS24243 293 62.0974 9 7.2764 KQK14069 1603 1341.95 287.731 10.7646 KQK14071 474 215.555 26.944 6.27554 ==> SRR8380052.se.tsv <== BRADI_1g14170v3 333 BRADI_1g53295v3 36 BRADI_1g59795v3 465 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 204 BRADI_1g74790v3 283 BRADI_1g09890v3 0 BRADI_1g77505v3 439 BRADI_1g48960v3 0 SRR8380052 completed mapping pipeline successfully