Starting /dee2/code/volunteer_pipeline.sh SRR8380053 current disk space = 1541859225600 free memory = 1471505380 SRR8380053 SRAfilesize b1e369124061d4439d29286089f93bc3 SRR8380053.sra SRR8380053.sra file validated SRR8380053 is paired end SRR8380053 is conventional basespace SRR8380053 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380053_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.63625 32.0 32.0 32.0 27.0 32.0 2 30.89625 32.0 32.0 32.0 32.0 32.0 3 33.345 32.0 32.0 37.0 32.0 37.0 4 36.23875 37.0 37.0 37.0 37.0 37.0 5 30.64875 37.0 27.0 37.0 12.0 37.0 6 39.1805 41.0 37.0 41.0 37.0 41.0 7 39.13875 41.0 37.0 41.0 37.0 41.0 8 38.5735 41.0 37.0 41.0 32.0 41.0 9 39.52675 41.0 41.0 41.0 37.0 41.0 10-14 39.851600000000005 41.0 41.0 41.0 37.0 41.0 15-19 38.45995 41.0 38.6 41.0 32.0 41.0 20-24 39.396 41.0 40.2 41.0 36.0 41.0 25-29 39.6608 41.0 41.0 41.0 36.0 41.0 30-34 39.476 41.0 40.2 41.0 36.0 41.0 35-39 38.54075 41.0 39.2 41.0 31.0 41.0 40-44 37.42695 39.2 36.4 41.0 31.0 41.0 45-49 39.30095 41.0 40.2 41.0 36.0 41.0 50-54 33.336 37.6 28.0 41.0 19.0 41.0 55-59 37.09845 41.0 36.8 41.0 27.0 41.0 60-64 37.14955 40.2 36.4 41.0 30.0 41.0 65-69 39.8096 41.0 41.0 41.0 37.0 41.0 70-74 36.616 40.2 35.6 41.0 27.0 41.0 75-79 37.912600000000005 40.2 36.6 41.0 29.0 41.0 80-84 38.5261 41.0 39.2 41.0 33.0 41.0 85-89 38.623450000000005 41.0 39.4 41.0 33.0 41.0 90-94 38.93115 41.0 40.2 41.0 35.0 41.0 95-99 39.14325 41.0 41.0 41.0 35.0 41.0 100-104 37.69715 41.0 37.0 41.0 31.0 41.0 105-109 38.111850000000004 41.0 38.4 41.0 33.0 41.0 110-114 38.101 41.0 38.4 41.0 31.0 41.0 115-119 38.7582 41.0 40.2 41.0 33.0 41.0 120-124 38.20165 41.0 38.6 41.0 31.0 41.0 125-129 37.9653 41.0 37.0 41.0 30.0 41.0 130-134 38.461200000000005 41.0 37.8 41.0 33.0 41.0 135-139 37.8544 41.0 37.0 41.0 30.0 41.0 140-144 37.33970000000001 41.0 36.0 41.0 27.0 41.0 145-149 37.47895 41.0 37.0 41.0 31.0 41.0 150 37.96475 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 3.0 24 5.0 25 7.0 26 5.0 27 17.0 28 25.0 29 32.0 30 34.0 31 57.0 32 85.0 33 126.0 34 126.0 35 201.0 36 292.0 37 415.0 38 577.0 39 928.0 40 1061.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.895612708018152 14.674735249621785 17.095310136157337 39.334341906202724 2 27.85 22.95 28.425 20.775 3 25.575 26.025 22.475 25.924999999999997 4 27.675 28.9 15.825 27.6 5 29.849999999999998 30.7 18.05 21.4 6 20.825 32.15 19.175 27.85 7 20.549999999999997 13.25 37.55 28.65 8 23.599999999999998 19.25 22.725 34.425 9 22.325 18.875 26.625 32.175 10-14 25.490000000000002 24.195 22.525000000000002 27.79 15-19 25.595000000000002 23.794999999999998 23.05 27.560000000000002 20-24 25.865 24.310000000000002 22.82 27.005000000000003 25-29 26.265 23.765 22.745 27.224999999999998 30-34 25.83 24.345 22.63 27.195000000000004 35-39 27.189999999999998 23.84 22.35 26.619999999999997 40-44 27.200000000000003 23.135 22.675 26.99 45-49 26.515 23.29 22.73 27.465 50-54 27.529999999999998 23.175 22.264999999999997 27.029999999999998 55-59 26.235000000000003 23.544999999999998 22.405 27.815 60-64 27.089999999999996 22.85 22.905 27.155 65-69 27.175 22.86 22.305 27.66 70-74 26.99 23.425 22.035 27.55 75-79 27.284999999999997 23.11 22.09 27.515 80-84 27.07 23.13 22.705000000000002 27.095000000000002 85-89 26.945000000000004 22.58 23.09 27.384999999999998 90-94 26.784999999999997 23.400000000000002 22.509999999999998 27.305 95-99 27.200000000000003 22.61 22.285 27.905 100-104 27.57 23.365 22.05 27.015 105-109 26.86 23.57 22.625 26.945000000000004 110-114 27.47 22.865 22.134999999999998 27.529999999999998 115-119 27.250000000000004 22.705000000000002 22.470000000000002 27.575 120-124 26.795 22.98 23.105 27.12 125-129 27.26 22.795 22.49 27.455000000000002 130-134 27.229999999999997 23.18 22.175 27.415 135-139 27.450000000000003 23.76 22.02 26.77 140-144 27.13 22.905 22.185 27.779999999999998 145-149 27.115000000000002 22.79 22.715 27.38 150 26.474999999999998 24.275 22.825 26.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 4.0 29 4.5 30 6.5 31 13.0 32 14.5 33 14.0 34 18.0 35 29.5 36 39.0 37 44.0 38 49.5 39 61.0 40 82.0 41 114.5 42 140.0 43 129.0 44 113.5 45 118.0 46 135.0 47 135.0 48 126.0 49 117.5 50 112.5 51 115.5 52 104.0 53 108.5 54 108.0 55 105.0 56 101.0 57 92.5 58 97.5 59 117.0 60 122.5 61 102.0 62 100.0 63 103.5 64 101.5 65 94.0 66 93.5 67 93.0 68 88.0 69 79.5 70 69.5 71 63.0 72 54.5 73 53.5 74 53.0 75 39.5 76 25.5 77 18.0 78 13.5 79 16.5 80 14.0 81 7.0 82 5.0 83 2.5 84 0.5 85 2.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67156208277704 87.7 2 5.9279038718291055 11.1 3 0.32042723631508674 0.8999999999999999 4 0.08010680907877168 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.2999999999999998 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.3375000000000004 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAATC 10 0.006973645 144.0 1 CAGGCAT 10 0.006973645 144.0 1 >>END_MODULE SRR8380053 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380053_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3425 32.0 32.0 32.0 32.0 32.0 2 31.55875 32.0 32.0 32.0 32.0 32.0 3 35.10375 37.0 32.0 37.0 32.0 37.0 4 30.555 32.0 27.0 37.0 12.0 37.0 5 35.865 37.0 37.0 37.0 32.0 37.0 6 38.72975 41.0 37.0 41.0 32.0 41.0 7 38.82025 41.0 41.0 41.0 32.0 41.0 8 39.5105 41.0 41.0 41.0 37.0 41.0 9 39.6325 41.0 41.0 41.0 37.0 41.0 10-14 39.524499999999996 41.0 41.0 41.0 36.0 41.0 15-19 39.106849999999994 41.0 40.2 41.0 35.0 41.0 20-24 39.406549999999996 41.0 41.0 41.0 37.0 41.0 25-29 37.93339999999999 40.2 37.4 41.0 31.0 41.0 30-34 39.5324 41.0 41.0 41.0 37.0 41.0 35-39 38.47885 41.0 39.4 41.0 33.0 41.0 40-44 37.83495 41.0 37.6 41.0 30.0 41.0 45-49 38.4085 41.0 38.6 41.0 31.0 41.0 50-54 38.618700000000004 41.0 40.2 41.0 33.0 41.0 55-59 37.712900000000005 41.0 37.8 41.0 28.0 41.0 60-64 38.18315 41.0 39.4 41.0 30.0 41.0 65-69 38.5164 41.0 39.4 41.0 32.0 41.0 70-74 38.207449999999994 41.0 38.6 41.0 31.0 41.0 75-79 37.99125 41.0 38.6 41.0 30.0 41.0 80-84 37.6472 41.0 38.6 41.0 28.0 41.0 85-89 38.38565 41.0 39.4 41.0 32.0 41.0 90-94 36.5375 40.2 35.6 41.0 25.0 41.0 95-99 37.83995 41.0 37.0 41.0 32.0 41.0 100-104 37.7165 41.0 37.0 41.0 29.0 41.0 105-109 36.8718 41.0 37.0 41.0 26.0 41.0 110-114 35.99385 39.4 34.0 41.0 25.0 41.0 115-119 37.46715 41.0 37.0 41.0 31.0 41.0 120-124 37.19565 41.0 37.0 41.0 28.0 41.0 125-129 35.7435 41.0 33.0 41.0 23.0 41.0 130-134 35.03825 40.2 32.0 41.0 20.0 41.0 135-139 33.869899999999994 37.0 30.0 41.0 16.0 41.0 140-144 33.4365 37.0 29.0 41.0 18.0 41.0 145-149 33.447900000000004 37.0 28.0 41.0 14.0 41.0 150 29.38725 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 2.0 19 1.0 20 4.0 21 6.0 22 10.0 23 17.0 24 19.0 25 21.0 26 38.0 27 37.0 28 41.0 29 54.0 30 62.0 31 70.0 32 91.0 33 140.0 34 176.0 35 227.0 36 287.0 37 405.0 38 572.0 39 932.0 40 786.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.275000000000002 14.075 17.05 38.6 2 25.95 23.599999999999998 29.225 21.224999999999998 3 26.5 25.575 20.9 27.025 4 28.799999999999997 28.499999999999996 15.65 27.05 5 26.5 31.825 17.925 23.75 6 20.575 32.925 19.5 27.0 7 21.475 13.15 37.2 28.175 8 23.674999999999997 18.025 23.599999999999998 34.699999999999996 9 21.95 20.349999999999998 25.974999999999998 31.724999999999998 10-14 25.82 23.345 22.869999999999997 27.965 15-19 25.435000000000002 23.380000000000003 23.150000000000002 28.035 20-24 25.935000000000002 24.33 23.03 26.705000000000002 25-29 26.99 23.68 22.825 26.505000000000003 30-34 26.075 24.365000000000002 22.564999999999998 26.995 35-39 27.065 23.68 22.634999999999998 26.619999999999997 40-44 26.889999999999997 23.625 22.245 27.24 45-49 26.735 23.51 22.09 27.665 50-54 26.009999999999998 23.485 22.64 27.865000000000002 55-59 26.36 23.810000000000002 22.005 27.825 60-64 26.945000000000004 23.485 22.34 27.229999999999997 65-69 26.450000000000003 23.02 22.875 27.655 70-74 27.089999999999996 23.375 22.08 27.455000000000002 75-79 26.375 23.49 22.665 27.47 80-84 27.505000000000003 22.775000000000002 22.235 27.485 85-89 27.075 22.884999999999998 22.665 27.375 90-94 27.034999999999997 22.935 22.38 27.650000000000002 95-99 26.655 23.43 22.46 27.455000000000002 100-104 27.27 22.975 22.6 27.155 105-109 26.88 23.09 22.37 27.66 110-114 27.97 23.355 21.975 26.700000000000003 115-119 26.765 22.535 23.115 27.584999999999997 120-124 27.415 22.875 22.895 26.815 125-129 27.425 22.61 22.770000000000003 27.195000000000004 130-134 27.735 23.080000000000002 22.595000000000002 26.590000000000003 135-139 27.41 22.720000000000002 22.895 26.974999999999998 140-144 27.389999999999997 22.470000000000002 22.96 27.18 145-149 27.450000000000003 23.27 22.235 27.045 150 25.775 24.05 23.175 27.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 0.5 25 0.5 26 1.0 27 1.0 28 2.0 29 2.5 30 4.5 31 9.0 32 15.0 33 19.5 34 20.5 35 30.0 36 43.0 37 52.0 38 68.0 39 80.5 40 96.5 41 102.5 42 110.5 43 125.5 44 134.5 45 142.5 46 137.5 47 130.0 48 121.5 49 121.5 50 115.5 51 103.0 52 105.0 53 93.0 54 93.0 55 102.5 56 97.5 57 99.5 58 95.5 59 96.0 60 101.0 61 100.5 62 102.5 63 100.5 64 95.5 65 93.0 66 95.0 67 89.5 68 79.5 69 84.5 70 77.5 71 62.5 72 58.0 73 56.0 74 50.0 75 49.0 76 39.5 77 21.0 78 14.5 79 15.5 80 14.0 81 8.0 82 5.0 83 4.5 84 3.5 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.33477789815818 85.225 2 7.069339111592633 13.05 3 0.5417118093174431 1.5 4 0.027085590465872153 0.1 5 0.027085590465872153 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTTATAATAGTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.3375000000000004 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCACG 10 0.006973645 144.0 5 >>END_MODULE Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314046 spots for SRR8380053.sra Written 1314046 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra Read 1314036 spots for SRR8380053.sra Written 1314036 spots for SRR8380053.sra SRR ids: ['SRR8380053.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3fj1lagr SRR8380053.sra spots: 26280730 blocks: [[1, 1314036], [1314037, 2628072], [2628073, 3942108], [3942109, 5256144], [5256145, 6570180], [6570181, 7884216], [7884217, 9198252], [9198253, 10512288], [10512289, 11826324], [11826325, 13140360], [13140361, 14454396], [14454397, 15768432], [15768433, 17082468], [17082469, 18396504], [18396505, 19710540], [19710541, 21024576], [21024577, 22338612], [22338613, 23652648], [23652649, 24966684], [24966685, 26280730]] SRR8380053 file size 8832647 SRR8380053 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380053 SRR8380053_1.fastq SRR8380053_2.fastq Input file: SRR8380053_1.fastq Paired file: SRR8380053_2.fastq trimmed: SRR8380053-trimmed-pair1.fastq, SRR8380053-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:08:33 2024 >> started Sat Dec 7 16:09:05 2024 >> done (32.614s) 26280730 read pairs processed; of these: 1984 ( 0.01%) short read pairs filtered out after trimming by size control 1798 ( 0.01%) empty read pairs filtered out after trimming by size control 26276948 (99.99%) read pairs available; of these: 1658176 ( 6.31%) trimmed read pairs available after processing 24618772 (93.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 240 0.00% 19 207 0.00% 20 257 0.00% 21 357 0.00% 22 312 0.00% 23 343 0.00% 24 368 0.00% 25 361 0.00% 26 401 0.00% 27 459 0.00% 28 420 0.00% 29 484 0.00% 30 408 0.00% 31 396 0.00% 32 430 0.00% 33 397 0.00% 34 405 0.00% 35 407 0.00% 36 374 0.00% 37 363 0.00% 38 409 0.00% 39 374 0.00% 40 401 0.00% 41 380 0.00% 42 392 0.00% 43 436 0.00% 44 413 0.00% 45 385 0.00% 46 376 0.00% 47 358 0.00% 48 438 0.00% 49 431 0.00% 50 435 0.00% 51 367 0.00% 52 436 0.00% 53 410 0.00% 54 422 0.00% 55 440 0.00% 56 407 0.00% 57 391 0.00% 58 468 0.00% 59 453 0.00% 60 451 0.00% 61 515 0.00% 62 579 0.00% 63 570 0.00% 64 547 0.00% 65 542 0.00% 66 544 0.00% 67 607 0.00% 68 622 0.00% 69 670 0.00% 70 703 0.00% 71 861 0.00% 72 979 0.00% 73 1021 0.00% 74 1025 0.00% 75 1049 0.00% 76 1105 0.00% 77 1235 0.00% 78 1249 0.00% 79 1491 0.01% 80 1624 0.01% 81 1810 0.01% 82 2023 0.01% 83 2335 0.01% 84 2547 0.01% 85 2532 0.01% 86 2565 0.01% 87 2738 0.01% 88 2958 0.01% 89 3260 0.01% 90 3449 0.01% 91 4010 0.02% 92 4482 0.02% 93 4925 0.02% 94 5091 0.02% 95 5468 0.02% 96 5484 0.02% 97 5659 0.02% 98 5726 0.02% 99 6260 0.02% 100 6676 0.03% 101 7149 0.03% 102 7738 0.03% 103 8297 0.03% 104 8731 0.03% 105 8707 0.03% 106 9001 0.03% 107 9110 0.03% 108 9475 0.04% 109 9791 0.04% 110 10081 0.04% 111 10654 0.04% 112 11313 0.04% 113 11904 0.05% 114 12633 0.05% 115 12929 0.05% 116 13040 0.05% 117 13076 0.05% 118 13337 0.05% 119 13816 0.05% 120 14330 0.05% 121 14752 0.06% 122 15784 0.06% 123 16218 0.06% 124 17027 0.06% 125 17398 0.07% 126 17661 0.07% 127 17759 0.07% 128 18013 0.07% 129 18580 0.07% 130 18783 0.07% 131 19307 0.07% 132 20467 0.08% 133 21003 0.08% 134 21559 0.08% 135 22591 0.09% 136 22673 0.09% 137 23192 0.09% 138 23599 0.09% 139 24256 0.09% 140 25068 0.10% 141 24943 0.09% 142 25637 0.10% 143 26814 0.10% 144 27495 0.10% 145 28958 0.11% 146 30829 0.12% 147 36368 0.14% 148 71760 0.27% 149 660172 2.51% 150 24618772 93.69% 26276948 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=2.2 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.22 sequence-density-rank=29 fanout-score=8.51 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=2.3 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=27 prefix-density=0.65 prefix-fanout=2.2 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=11.12 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGG SRR8380053 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:11:56 Started mapping on | Dec 07 16:11:56 Finished on | Dec 07 16:15:27 Mapping speed, Million of reads per hour | 448.33 Number of input reads | 26276948 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 24879486 Uniquely mapped reads % | 94.68% Average mapped length | 296.57 Number of splices: Total | 20412483 Number of splices: Annotated (sjdb) | 19203122 Number of splices: GT/AG | 20127974 Number of splices: GC/AG | 234617 Number of splices: AT/AC | 5629 Number of splices: Non-canonical | 44263 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232464 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 60128 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 2.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1164998 1164998 1164998 N_multimapping 232464 232464 232464 N_noFeature 635161 12465860 12524187 N_ambiguous 704778 93149 91697 UnstrandedReadsAssigned:23539547 PositiveStrandReadsAssigned:12320477 NegativeStrandReadsAssigned:12263602 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380053 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380053-trimmed-pair1.fastq SRR8380053-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,276,948 reads, 24,349,882 reads pseudoaligned [quant] estimated average fragment length: 259.466 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR8380053.ke.tsv 35125 SRR8380053.se.tsv 88098 total ==> SRR8380053.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.861 0 0 PNS24247 1044 785.534 16.4448 0.966503 PNS24249 1928 1669.53 130.048 3.59625 PNS24246 1044 785.534 16.4448 0.966503 PNS24248 1044 785.534 16.4448 0.966503 PNS24244 1471 1212.53 91.6173 3.48839 PNS24243 293 65.768 4 2.80793 KQK14069 1603 1344.53 407.61 13.9963 KQK14071 474 218.106 31.8363 6.73898 ==> SRR8380053.se.tsv <== BRADI_1g14170v3 474 BRADI_1g53295v3 19 BRADI_1g59795v3 635 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 174 BRADI_1g74790v3 237 BRADI_1g09890v3 1 BRADI_1g77505v3 448 BRADI_1g48960v3 0 SRR8380053 completed mapping pipeline successfully