Starting /dee2/code/volunteer_pipeline.sh SRR8380054 current disk space = 1541874221056 free memory = 1470135916 SRR8380054 SRAfilesize d5aa1d961fe94fab00ffb797bede1c95 SRR8380054.sra SRR8380054.sra file validated SRR8380054 is paired end SRR8380054 is conventional basespace SRR8380054 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380054_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.56875 32.0 32.0 32.0 27.0 32.0 2 30.825 32.0 32.0 32.0 27.0 32.0 3 33.445 32.0 32.0 37.0 32.0 37.0 4 36.3125 37.0 37.0 37.0 37.0 37.0 5 30.5 37.0 27.0 37.0 12.0 37.0 6 39.1945 41.0 37.0 41.0 37.0 41.0 7 39.20825 41.0 37.0 41.0 37.0 41.0 8 38.55375 41.0 37.0 41.0 32.0 41.0 9 39.5485 41.0 41.0 41.0 37.0 41.0 10-14 39.8213 41.0 41.0 41.0 37.0 41.0 15-19 38.26065 41.0 37.6 41.0 31.0 41.0 20-24 39.1462 41.0 39.4 41.0 34.0 41.0 25-29 39.52315 41.0 41.0 41.0 36.0 41.0 30-34 39.4445 41.0 40.2 41.0 36.0 41.0 35-39 38.39790000000001 40.2 38.4 41.0 31.0 41.0 40-44 37.18905 39.2 34.4 41.0 31.0 41.0 45-49 39.10465 41.0 40.2 41.0 35.0 41.0 50-54 33.0443 37.6 28.0 41.0 19.0 41.0 55-59 36.8878 41.0 34.8 41.0 26.0 41.0 60-64 37.02374999999999 39.2 36.4 41.0 30.0 41.0 65-69 39.7011 41.0 41.0 41.0 37.0 41.0 70-74 36.37265000000001 39.2 35.6 41.0 27.0 41.0 75-79 37.66545 40.2 36.6 41.0 29.0 41.0 80-84 38.3226 41.0 39.2 41.0 33.0 41.0 85-89 38.411899999999996 41.0 38.6 41.0 33.0 41.0 90-94 38.80735 41.0 40.2 41.0 34.0 41.0 95-99 39.006899999999995 41.0 40.2 41.0 35.0 41.0 100-104 37.50875 41.0 37.0 41.0 28.0 41.0 105-109 37.895300000000006 40.2 38.4 41.0 30.0 41.0 110-114 37.7664 41.0 36.8 41.0 30.0 41.0 115-119 38.76129999999999 41.0 40.2 41.0 33.0 41.0 120-124 38.146249999999995 41.0 38.6 41.0 31.0 41.0 125-129 37.79335 41.0 37.0 41.0 29.0 41.0 130-134 38.21939999999999 41.0 37.8 41.0 32.0 41.0 135-139 37.66235 41.0 37.0 41.0 30.0 41.0 140-144 37.2055 40.2 36.0 41.0 27.0 41.0 145-149 37.3293 41.0 37.0 41.0 29.0 41.0 150 37.784 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 2.0 21 2.0 22 2.0 23 2.0 24 5.0 25 12.0 26 13.0 27 19.0 28 21.0 29 30.0 30 43.0 31 66.0 32 95.0 33 87.0 34 148.0 35 221.0 36 288.0 37 457.0 38 635.0 39 915.0 40 935.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.236079617032 14.714033761652809 17.989417989417987 40.06046863189721 2 25.874999999999996 22.75 29.049999999999997 22.325 3 26.900000000000002 25.224999999999998 22.2 25.674999999999997 4 28.675 29.599999999999998 14.2 27.525 5 26.924999999999997 32.6 18.125 22.35 6 21.099999999999998 32.925 20.025000000000002 25.95 7 20.875 12.35 37.75 29.025000000000002 8 22.075 18.825 23.375 35.725 9 21.5 18.825 27.875 31.8 10-14 25.71 23.895 21.995 28.4 15-19 26.13 23.34 22.73 27.800000000000004 20-24 26.655 23.735 22.095000000000002 27.515 25-29 26.055 24.135 22.075 27.735 30-34 26.0 24.4 22.13 27.47 35-39 26.384999999999998 23.965 22.55 27.1 40-44 27.125 23.315 22.52 27.04 45-49 25.965 23.365 22.745 27.925 50-54 26.855 23.36 22.405 27.38 55-59 26.185000000000002 23.13 22.869999999999997 27.815 60-64 26.44 23.419999999999998 22.86 27.279999999999998 65-69 26.279999999999998 23.035 22.925 27.76 70-74 27.11 23.200000000000003 22.31 27.38 75-79 27.42 23.195 22.115000000000002 27.27 80-84 27.115000000000002 22.895 22.34 27.650000000000002 85-89 27.279999999999998 23.105 22.46 27.155 90-94 26.884999999999998 22.39 22.725 28.000000000000004 95-99 26.735 22.865 22.98 27.42 100-104 27.265 22.305 22.595000000000002 27.834999999999997 105-109 27.055 22.7 22.875 27.37 110-114 27.35 22.814999999999998 22.16 27.675 115-119 26.840000000000003 22.425 23.080000000000002 27.655 120-124 27.47 22.12 22.985 27.425 125-129 27.11 22.435 22.59 27.865000000000002 130-134 27.415 22.415 23.064999999999998 27.105 135-139 27.169999999999998 22.770000000000003 22.535 27.525 140-144 26.939999999999998 22.91 22.425 27.725 145-149 27.22 22.759999999999998 22.53 27.49 150 26.25 22.35 22.7 28.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 3.0 28 6.0 29 7.0 30 7.0 31 7.5 32 11.5 33 15.5 34 20.5 35 29.5 36 45.0 37 53.0 38 61.0 39 80.0 40 89.0 41 100.5 42 113.5 43 127.5 44 135.5 45 134.0 46 138.5 47 131.5 48 117.5 49 118.5 50 119.5 51 107.0 52 102.0 53 96.0 54 92.5 55 96.5 56 96.5 57 91.0 58 97.0 59 102.0 60 99.5 61 105.5 62 104.0 63 97.5 64 99.0 65 96.0 66 99.0 67 98.5 68 83.0 69 89.5 70 86.0 71 63.0 72 53.0 73 52.5 74 45.0 75 38.5 76 32.0 77 24.0 78 18.5 79 16.0 80 13.5 81 8.0 82 7.0 83 5.0 84 3.0 85 3.5 86 3.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40466719702997 89.0 2 5.171042163882259 9.75 3 0.37125430920180325 1.05 4 0.05303632988597189 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.7875000000000001 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1375000000000002 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8380054 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380054_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56875 32.0 32.0 32.0 32.0 32.0 2 31.54875 32.0 32.0 32.0 32.0 32.0 3 34.84625 37.0 32.0 37.0 32.0 37.0 4 30.03875 32.0 27.0 37.0 12.0 37.0 5 35.9 37.0 37.0 37.0 32.0 37.0 6 38.8115 41.0 37.0 41.0 32.0 41.0 7 38.889 41.0 41.0 41.0 37.0 41.0 8 39.46275 41.0 41.0 41.0 37.0 41.0 9 39.664 41.0 41.0 41.0 37.0 41.0 10-14 39.4418 41.0 40.2 41.0 36.0 41.0 15-19 39.058099999999996 41.0 39.4 41.0 35.0 41.0 20-24 39.23925 41.0 41.0 41.0 36.0 41.0 25-29 37.7534 40.2 37.4 41.0 31.0 41.0 30-34 39.445350000000005 41.0 41.0 41.0 36.0 41.0 35-39 38.29665 41.0 39.4 41.0 32.0 41.0 40-44 37.57155 41.0 37.6 41.0 30.0 41.0 45-49 38.1624 41.0 37.0 41.0 31.0 41.0 50-54 38.480199999999996 41.0 39.4 41.0 33.0 41.0 55-59 37.35745 41.0 36.8 41.0 28.0 41.0 60-64 38.11415 41.0 39.4 41.0 30.0 41.0 65-69 38.234 41.0 37.0 41.0 31.0 41.0 70-74 38.09275 41.0 37.0 41.0 31.0 41.0 75-79 37.86775 41.0 37.8 41.0 30.0 41.0 80-84 37.42525 41.0 36.8 41.0 28.0 41.0 85-89 38.306799999999996 41.0 39.4 41.0 32.0 41.0 90-94 36.330499999999994 40.2 35.6 41.0 24.0 41.0 95-99 37.775150000000004 41.0 37.0 41.0 30.0 41.0 100-104 37.58755 41.0 37.0 41.0 29.0 41.0 105-109 36.507600000000004 41.0 36.0 41.0 25.0 41.0 110-114 35.70565 39.4 33.0 41.0 25.0 41.0 115-119 37.32325 41.0 37.0 41.0 30.0 41.0 120-124 36.90835 41.0 37.0 41.0 28.0 41.0 125-129 35.3871 40.2 33.0 41.0 23.0 41.0 130-134 34.591300000000004 39.4 31.0 41.0 20.0 41.0 135-139 33.25765 37.0 27.0 41.0 14.0 41.0 140-144 32.8987 37.0 27.0 41.0 18.0 41.0 145-149 32.8621 37.0 27.0 41.0 12.0 41.0 150 28.981 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 3.0 19 1.0 20 3.0 21 8.0 22 12.0 23 17.0 24 14.0 25 31.0 26 33.0 27 33.0 28 47.0 29 61.0 30 48.0 31 97.0 32 91.0 33 153.0 34 188.0 35 251.0 36 333.0 37 419.0 38 630.0 39 926.0 40 599.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.049999999999997 13.3 18.35 39.300000000000004 2 26.8 23.875 29.4 19.925 3 26.424999999999997 26.75 21.55 25.275 4 29.075 28.275 14.6 28.050000000000004 5 27.925 31.95 17.224999999999998 22.900000000000002 6 22.775000000000002 30.95 20.200000000000003 26.075 7 20.575 13.625000000000002 37.724999999999994 28.075 8 23.125 19.325 22.425 35.125 9 23.200000000000003 18.425 25.5 32.875 10-14 25.535000000000004 24.205 21.945 28.315 15-19 26.115 23.25 22.830000000000002 27.805000000000003 20-24 25.564999999999998 23.56 23.41 27.465 25-29 26.265 23.849999999999998 22.705000000000002 27.18 30-34 26.205000000000002 23.7 23.01 27.084999999999997 35-39 26.284999999999997 23.89 22.12 27.705000000000002 40-44 26.924999999999997 23.53 22.509999999999998 27.034999999999997 45-49 26.69 23.535 22.59 27.185 50-54 26.729999999999997 23.05 22.605 27.615000000000002 55-59 27.325 23.145 21.875 27.655 60-64 27.51 22.814999999999998 22.009999999999998 27.665 65-69 26.795 22.755 22.245 28.205000000000002 70-74 27.235 23.064999999999998 22.12 27.58 75-79 26.51 22.59 22.775000000000002 28.125 80-84 26.87 22.985 22.485 27.66 85-89 27.169999999999998 22.765 21.94 28.125 90-94 27.305 23.265 22.49 26.939999999999998 95-99 26.900000000000002 23.46 22.46 27.18 100-104 26.83 23.7 22.134999999999998 27.334999999999997 105-109 27.565 23.125 22.07 27.24 110-114 27.13 23.61 22.355 26.905 115-119 28.185 22.025 22.605 27.185 120-124 27.87 22.82 22.264999999999997 27.045 125-129 27.36 23.044999999999998 22.31 27.284999999999997 130-134 27.77 22.71 22.465 27.055 135-139 27.215 23.3 22.62 26.865 140-144 27.37 22.045 22.915 27.67 145-149 26.99 23.119999999999997 22.28 27.61 150 28.375 23.525 21.8 26.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 2.0 27 2.0 28 2.5 29 6.5 30 8.0 31 10.0 32 13.5 33 20.0 34 24.5 35 29.5 36 41.5 37 47.5 38 58.0 39 74.0 40 83.5 41 100.5 42 125.5 43 131.0 44 115.5 45 125.0 46 137.0 47 133.0 48 130.5 49 115.0 50 114.5 51 118.5 52 109.0 53 95.0 54 93.5 55 96.0 56 92.0 57 98.0 58 96.0 59 87.0 60 99.5 61 115.0 62 107.0 63 96.0 64 105.0 65 101.5 66 77.5 67 76.5 68 84.5 69 80.5 70 76.0 71 67.5 72 65.0 73 64.0 74 56.5 75 47.5 76 37.5 77 27.0 78 21.0 79 19.5 80 12.0 81 7.5 82 6.5 83 5.0 84 2.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7750467539407 87.75 2 5.744055570398077 10.75 3 0.4007480630510286 1.125 4 0.05343307507347048 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02671653753673524 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0125 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 1.05 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.2374999999999998 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247880 spots for SRR8380054.sra Written 1247880 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra Read 1247867 spots for SRR8380054.sra Written 1247867 spots for SRR8380054.sra SRR ids: ['SRR8380054.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_avyhcul0 SRR8380054.sra spots: 24957353 blocks: [[1, 1247867], [1247868, 2495734], [2495735, 3743601], [3743602, 4991468], [4991469, 6239335], [6239336, 7487202], [7487203, 8735069], [8735070, 9982936], [9982937, 11230803], [11230804, 12478670], [12478671, 13726537], [13726538, 14974404], [14974405, 16222271], [16222272, 17470138], [17470139, 18718005], [18718006, 19965872], [19965873, 21213739], [21213740, 22461606], [22461607, 23709473], [23709474, 24957353]] SRR8380054 file size 8386782 SRR8380054 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380054 SRR8380054_1.fastq SRR8380054_2.fastq Input file: SRR8380054_1.fastq Paired file: SRR8380054_2.fastq trimmed: SRR8380054-trimmed-pair1.fastq, SRR8380054-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:07:06 2024 >> started Sat Dec 7 16:07:36 2024 >> done (30.065s) 24957353 read pairs processed; of these: 2753 ( 0.01%) short read pairs filtered out after trimming by size control 1086 ( 0.00%) empty read pairs filtered out after trimming by size control 24953514 (99.98%) read pairs available; of these: 1281294 ( 5.13%) trimmed read pairs available after processing 23672220 (94.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 313 0.00% 19 264 0.00% 20 309 0.00% 21 366 0.00% 22 349 0.00% 23 375 0.00% 24 391 0.00% 25 392 0.00% 26 403 0.00% 27 468 0.00% 28 360 0.00% 29 447 0.00% 30 393 0.00% 31 388 0.00% 32 337 0.00% 33 360 0.00% 34 332 0.00% 35 357 0.00% 36 359 0.00% 37 386 0.00% 38 376 0.00% 39 334 0.00% 40 398 0.00% 41 443 0.00% 42 333 0.00% 43 326 0.00% 44 361 0.00% 45 333 0.00% 46 295 0.00% 47 332 0.00% 48 300 0.00% 49 324 0.00% 50 315 0.00% 51 324 0.00% 52 355 0.00% 53 332 0.00% 54 306 0.00% 55 315 0.00% 56 353 0.00% 57 334 0.00% 58 332 0.00% 59 342 0.00% 60 353 0.00% 61 353 0.00% 62 364 0.00% 63 384 0.00% 64 387 0.00% 65 384 0.00% 66 390 0.00% 67 355 0.00% 68 369 0.00% 69 467 0.00% 70 435 0.00% 71 525 0.00% 72 589 0.00% 73 592 0.00% 74 564 0.00% 75 654 0.00% 76 659 0.00% 77 625 0.00% 78 714 0.00% 79 775 0.00% 80 804 0.00% 81 927 0.00% 82 1022 0.00% 83 1106 0.00% 84 1227 0.00% 85 1241 0.00% 86 1311 0.01% 87 1286 0.01% 88 1425 0.01% 89 1559 0.01% 90 1546 0.01% 91 1795 0.01% 92 1965 0.01% 93 2195 0.01% 94 2352 0.01% 95 2558 0.01% 96 2475 0.01% 97 2640 0.01% 98 2621 0.01% 99 2930 0.01% 100 2939 0.01% 101 3187 0.01% 102 3405 0.01% 103 3793 0.02% 104 3961 0.02% 105 3981 0.02% 106 4154 0.02% 107 4349 0.02% 108 4385 0.02% 109 4507 0.02% 110 4683 0.02% 111 4870 0.02% 112 5298 0.02% 113 5780 0.02% 114 5923 0.02% 115 6373 0.03% 116 6111 0.02% 117 6455 0.03% 118 6482 0.03% 119 6740 0.03% 120 6990 0.03% 121 7462 0.03% 122 7865 0.03% 123 7998 0.03% 124 8635 0.03% 125 9168 0.04% 126 9267 0.04% 127 9166 0.04% 128 9502 0.04% 129 9576 0.04% 130 9992 0.04% 131 10426 0.04% 132 10998 0.04% 133 11261 0.05% 134 12369 0.05% 135 12594 0.05% 136 12934 0.05% 137 13375 0.05% 138 13405 0.05% 139 13733 0.06% 140 14073 0.06% 141 14686 0.06% 142 15410 0.06% 143 15908 0.06% 144 16675 0.07% 145 17652 0.07% 146 19655 0.08% 147 25405 0.10% 148 66572 0.27% 149 711431 2.85% 150 23672220 94.87% 24953514 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=16 prefix-density=0.86 prefix-fanout=2.7 sequence=CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=32 fanout-score=6.44 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=1.8 sequence=CTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=17 prefix-density=0.85 prefix-fanout=2.7 sequence=CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=33 fanout-score=6.49 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=1.8 sequence=CTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR8380054 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:11:14 Started mapping on | Dec 07 16:11:14 Finished on | Dec 07 16:14:33 Mapping speed, Million of reads per hour | 451.42 Number of input reads | 24953514 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23598673 Uniquely mapped reads % | 94.57% Average mapped length | 297.20 Number of splices: Total | 19544404 Number of splices: Annotated (sjdb) | 18408719 Number of splices: GT/AG | 19269936 Number of splices: GC/AG | 226585 Number of splices: AT/AC | 5744 Number of splices: Non-canonical | 42139 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 229613 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 55708 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 2.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1125228 1125228 1125228 N_multimapping 229613 229613 229613 N_noFeature 563581 11818147 11865412 N_ambiguous 663211 94149 94640 UnstrandedReadsAssigned:22371881 PositiveStrandReadsAssigned:11686377 NegativeStrandReadsAssigned:11638621 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380054 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380054-trimmed-pair1.fastq SRR8380054-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,953,514 reads, 23,213,816 reads pseudoaligned [quant] estimated average fragment length: 265.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 SRR8380054.ke.tsv 35125 SRR8380054.se.tsv 88098 total ==> SRR8380054.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.579 0 0 PNS24247 1044 779.339 33.4199 2.04195 PNS24249 1928 1663.34 102.607 2.93738 PNS24246 1044 779.339 33.4199 2.04195 PNS24248 1044 779.339 33.4199 2.04195 PNS24244 1471 1206.34 59.1338 2.33417 PNS24243 293 59.7941 7 5.5745 KQK14069 1603 1338.34 88.3347 3.14291 KQK14071 474 211.855 7.66529 1.72288 ==> SRR8380054.se.tsv <== BRADI_1g14170v3 97 BRADI_1g53295v3 9 BRADI_1g59795v3 402 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 195 BRADI_1g74790v3 270 BRADI_1g09890v3 0 BRADI_1g77505v3 424 BRADI_1g48960v3 1 SRR8380054 completed mapping pipeline successfully