Starting /dee2/code/volunteer_pipeline.sh SRR8380055 current disk space = 1541908860928 free memory = 1600750356 SRR8380055 SRAfilesize 57e635ebcd35274b613faefcefed656f SRR8380055.sra SRR8380055.sra file validated SRR8380055 is paired end SRR8380055 is conventional basespace SRR8380055 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380055_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.58875 32.0 32.0 32.0 27.0 32.0 2 30.8125 32.0 32.0 32.0 27.0 32.0 3 33.43 32.0 32.0 37.0 32.0 37.0 4 36.18 37.0 37.0 37.0 32.0 37.0 5 30.06625 37.0 27.0 37.0 12.0 37.0 6 39.03625 41.0 37.0 41.0 37.0 41.0 7 38.95275 41.0 37.0 41.0 37.0 41.0 8 38.4755 41.0 37.0 41.0 32.0 41.0 9 39.345 41.0 41.0 41.0 37.0 41.0 10-14 39.7556 41.0 41.0 41.0 37.0 41.0 15-19 38.09545 41.0 37.6 41.0 31.0 41.0 20-24 39.10545 41.0 39.4 41.0 35.0 41.0 25-29 39.483850000000004 41.0 40.2 41.0 36.0 41.0 30-34 39.41850000000001 41.0 40.2 41.0 36.0 41.0 35-39 38.2324 40.2 37.4 41.0 31.0 41.0 40-44 37.08075 39.2 34.4 41.0 31.0 41.0 45-49 39.14985 41.0 40.2 41.0 35.0 41.0 50-54 32.732 37.6 26.0 41.0 19.0 41.0 55-59 36.64795 41.0 34.0 41.0 26.0 41.0 60-64 36.948 39.2 36.4 41.0 30.0 41.0 65-69 39.6721 41.0 41.0 41.0 37.0 41.0 70-74 36.1773 39.2 33.6 41.0 26.0 41.0 75-79 37.61595 40.2 36.6 41.0 29.0 41.0 80-84 38.251850000000005 41.0 38.4 41.0 33.0 41.0 85-89 38.443149999999996 41.0 39.4 41.0 33.0 41.0 90-94 38.746900000000004 41.0 40.2 41.0 34.0 41.0 95-99 38.9971 41.0 40.2 41.0 35.0 41.0 100-104 37.3787 41.0 37.0 41.0 27.0 41.0 105-109 37.75279999999999 40.2 37.4 41.0 30.0 41.0 110-114 37.6672 41.0 36.8 41.0 30.0 41.0 115-119 38.704049999999995 41.0 40.2 41.0 33.0 41.0 120-124 38.108349999999994 41.0 38.6 41.0 31.0 41.0 125-129 37.7169 41.0 37.0 41.0 29.0 41.0 130-134 38.256899999999995 41.0 37.8 41.0 32.0 41.0 135-139 37.607150000000004 41.0 37.0 41.0 29.0 41.0 140-144 37.0576 40.2 36.0 41.0 26.0 41.0 145-149 37.2467 41.0 37.0 41.0 29.0 41.0 150 37.73375 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 4.0 24 7.0 25 5.0 26 15.0 27 18.0 28 27.0 29 40.0 30 57.0 31 66.0 32 86.0 33 104.0 34 151.0 35 235.0 36 325.0 37 432.0 38 605.0 39 916.0 40 902.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.790931989924434 15.163727959697734 18.337531486146098 37.70780856423174 2 25.374999999999996 23.05 29.475 22.1 3 26.974999999999998 26.400000000000002 21.5 25.124999999999996 4 27.650000000000002 30.599999999999998 14.975 26.775 5 29.849999999999998 31.374999999999996 17.525 21.25 6 22.125 32.625 19.125 26.125 7 19.900000000000002 13.3 38.275 28.525 8 22.85 18.2 23.724999999999998 35.225 9 22.575 19.325 25.775 32.324999999999996 10-14 25.03 24.975 22.115000000000002 27.88 15-19 24.98 24.46 23.18 27.38 20-24 26.314999999999998 24.035 22.95 26.700000000000003 25-29 25.86 24.685000000000002 22.63 26.825 30-34 25.72 24.52 23.155 26.605 35-39 26.314999999999998 23.93 23.06 26.695 40-44 25.81 24.26 23.135 26.795 45-49 26.490000000000002 24.3 22.314999999999998 26.895000000000003 50-54 27.034999999999997 23.830000000000002 22.425 26.71 55-59 26.705000000000002 23.86 22.25 27.185 60-64 26.33 24.044999999999998 22.905 26.72 65-69 25.805 23.84 22.98 27.375 70-74 26.674999999999997 23.53 23.06 26.735 75-79 26.43 23.72 23.05 26.8 80-84 25.929999999999996 23.775 22.695 27.6 85-89 26.22 23.455000000000002 23.305 27.02 90-94 26.68 23.47 22.830000000000002 27.02 95-99 26.740000000000002 23.555 23.275000000000002 26.43 100-104 26.52 23.845 22.595000000000002 27.04 105-109 26.200000000000003 24.45 23.27 26.08 110-114 26.705000000000002 23.669999999999998 23.41 26.215 115-119 26.724999999999998 23.425 23.305 26.545 120-124 26.35 22.845 23.919999999999998 26.884999999999998 125-129 26.474999999999998 23.189999999999998 23.39 26.945000000000004 130-134 27.525 22.82 23.169999999999998 26.484999999999996 135-139 27.134999999999998 23.305 23.09 26.47 140-144 27.165 22.49 23.35 26.995 145-149 27.125 23.06 23.03 26.784999999999997 150 27.224999999999998 23.375 23.95 25.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 0.5 26 1.5 27 3.5 28 2.5 29 5.0 30 7.5 31 8.0 32 14.0 33 20.0 34 26.5 35 32.5 36 36.0 37 49.5 38 75.0 39 96.5 40 108.0 41 119.0 42 126.5 43 129.5 44 138.5 45 142.5 46 137.5 47 135.5 48 123.5 49 121.0 50 126.5 51 117.0 52 111.5 53 97.0 54 95.5 55 98.5 56 88.0 57 92.0 58 93.5 59 103.0 60 105.5 61 96.0 62 91.0 63 90.5 64 103.0 65 95.5 66 84.5 67 82.5 68 70.5 69 66.5 70 63.5 71 53.5 72 50.0 73 44.5 74 40.0 75 33.5 76 28.5 77 27.5 78 21.0 79 20.0 80 15.5 81 9.5 82 5.5 83 3.0 84 4.5 85 3.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 95.05913272010513 90.425 2 4.756898817345598 9.049999999999999 3 0.18396846254927726 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.2625000000000002 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.6375000000000002 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 1.9249999999999998 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGCGC 10 0.006973645 144.0 1 AAGGAGG 10 0.006973645 144.0 2 ACGGTCT 10 0.006973645 144.0 3 >>END_MODULE SRR8380055 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380055_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5825 32.0 32.0 32.0 32.0 32.0 2 31.5325 32.0 32.0 32.0 32.0 32.0 3 35.045 37.0 32.0 37.0 32.0 37.0 4 30.31625 32.0 27.0 37.0 12.0 37.0 5 35.9575 37.0 37.0 37.0 32.0 37.0 6 38.92325 41.0 37.0 41.0 37.0 41.0 7 39.04975 41.0 41.0 41.0 37.0 41.0 8 39.5245 41.0 41.0 41.0 37.0 41.0 9 39.64275 41.0 41.0 41.0 37.0 41.0 10-14 39.486000000000004 41.0 41.0 41.0 36.0 41.0 15-19 39.1597 41.0 40.2 41.0 35.0 41.0 20-24 39.37615 41.0 41.0 41.0 37.0 41.0 25-29 37.8357 40.2 37.4 41.0 31.0 41.0 30-34 39.4713 41.0 41.0 41.0 37.0 41.0 35-39 38.44985 41.0 39.4 41.0 33.0 41.0 40-44 37.897450000000006 41.0 38.4 41.0 31.0 41.0 45-49 38.45835 41.0 38.6 41.0 31.0 41.0 50-54 38.7343 41.0 40.2 41.0 33.0 41.0 55-59 37.6192 41.0 36.8 41.0 28.0 41.0 60-64 38.2347 41.0 39.4 41.0 30.0 41.0 65-69 38.47234999999999 41.0 40.2 41.0 31.0 41.0 70-74 38.1839 41.0 37.8 41.0 31.0 41.0 75-79 38.08165 41.0 38.6 41.0 30.0 41.0 80-84 37.56585 41.0 37.6 41.0 28.0 41.0 85-89 38.4945 41.0 39.4 41.0 32.0 41.0 90-94 36.55115 40.2 35.6 41.0 27.0 41.0 95-99 37.929950000000005 41.0 37.0 41.0 32.0 41.0 100-104 37.82335 41.0 37.0 41.0 30.0 41.0 105-109 36.91875 41.0 37.0 41.0 26.0 41.0 110-114 35.93105 39.4 33.0 41.0 25.0 41.0 115-119 37.48895 41.0 37.0 41.0 31.0 41.0 120-124 37.167550000000006 41.0 37.0 41.0 28.0 41.0 125-129 35.7917 40.2 33.0 41.0 25.0 41.0 130-134 35.12 40.2 32.0 41.0 22.0 41.0 135-139 33.7572 37.0 30.0 41.0 16.0 41.0 140-144 33.36885 37.0 29.0 41.0 18.0 41.0 145-149 33.27115 37.0 28.0 41.0 14.0 41.0 150 29.0675 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 2.0 19 3.0 20 3.0 21 7.0 22 11.0 23 11.0 24 16.0 25 32.0 26 24.0 27 39.0 28 36.0 29 64.0 30 54.0 31 71.0 32 121.0 33 134.0 34 164.0 35 186.0 36 297.0 37 411.0 38 618.0 39 954.0 40 740.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.099999999999998 14.85 18.375 37.675 2 26.200000000000003 24.325 27.85 21.625 3 28.125 26.8 20.599999999999998 24.474999999999998 4 26.275 30.275000000000002 16.150000000000002 27.3 5 27.325 30.275000000000002 17.599999999999998 24.8 6 21.875 33.300000000000004 18.725 26.1 7 19.375 14.124999999999998 38.224999999999994 28.275 8 23.674999999999997 18.15 23.65 34.525 9 22.35 19.45 26.3 31.900000000000002 10-14 25.305 24.335 22.56 27.800000000000004 15-19 25.765 24.135 23.395 26.705000000000002 20-24 25.790000000000003 24.46 23.549999999999997 26.200000000000003 25-29 25.540000000000003 24.15 23.31 27.0 30-34 25.919999999999998 24.04 23.325000000000003 26.715 35-39 26.345000000000002 24.085 22.814999999999998 26.755000000000003 40-44 26.495 24.26 22.555 26.69 45-49 25.96 24.23 22.46 27.35 50-54 26.035000000000004 23.97 22.53 27.465 55-59 26.13 23.599999999999998 22.82 27.450000000000003 60-64 26.125 23.715 22.84 27.32 65-69 25.795 23.18 23.52 27.505000000000003 70-74 26.365 23.21 23.28 27.145000000000003 75-79 26.39 23.95 22.63 27.029999999999998 80-84 26.33 23.165 23.36 27.145000000000003 85-89 26.125 23.674999999999997 23.315 26.884999999999998 90-94 26.69 23.825 22.935 26.55 95-99 26.529999999999998 23.369999999999997 23.285 26.815 100-104 25.91 24.205 22.875 27.01 105-109 26.779999999999998 23.705000000000002 23.02 26.495 110-114 27.32 24.310000000000002 22.35 26.02 115-119 27.200000000000003 22.865 23.1 26.834999999999997 120-124 26.71 23.635 23.135 26.52 125-129 27.089999999999996 22.825 23.64 26.445 130-134 27.134999999999998 22.66 23.645 26.56 135-139 26.51 23.7 23.235 26.555 140-144 26.950000000000003 23.150000000000002 23.24 26.66 145-149 26.455000000000002 23.435 23.41 26.700000000000003 150 27.425 23.075000000000003 23.849999999999998 25.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.5 24 0.5 25 1.0 26 2.0 27 2.0 28 5.0 29 8.0 30 7.0 31 8.5 32 17.5 33 19.5 34 26.5 35 39.0 36 44.0 37 49.0 38 71.0 39 99.0 40 98.5 41 103.0 42 124.5 43 141.0 44 128.0 45 121.5 46 142.0 47 140.5 48 126.0 49 123.5 50 127.5 51 113.0 52 112.5 53 113.5 54 103.0 55 108.0 56 102.5 57 93.0 58 86.5 59 92.0 60 92.0 61 89.5 62 97.0 63 96.5 64 92.5 65 97.5 66 93.0 67 76.0 68 70.0 69 67.0 70 65.0 71 64.0 72 54.0 73 48.0 74 46.5 75 35.5 76 25.0 77 20.5 78 17.0 79 14.0 80 12.0 81 8.5 82 5.0 83 2.0 84 2.5 85 1.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.92486011191046 88.125 2 5.595523581135091 10.5 3 0.45297095656807884 1.275 4 0.02664535038635758 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.05 0.0 50-51 0.1 0.0 0.0 0.05 0.0 52-53 0.1 0.0 0.0 0.05 0.0 54-55 0.1125 0.0 0.0 0.05 0.0 56-57 0.125 0.0 0.0 0.05 0.0 58-59 0.125 0.0 0.0 0.05 0.0 60-61 0.125 0.0 0.0 0.05 0.0 62-63 0.125 0.0 0.0 0.05 0.0 64-65 0.125 0.0 0.0 0.05 0.0 66-67 0.125 0.0 0.0 0.05 0.0 68-69 0.1375 0.0 0.0 0.05 0.0 70-71 0.15 0.0 0.0 0.05 0.0 72-73 0.175 0.0 0.0 0.05 0.0 74-75 0.175 0.0 0.0 0.05 0.0 76-77 0.175 0.0 0.0 0.05 0.0 78-79 0.175 0.0 0.0 0.05 0.0 80-81 0.1875 0.0 0.0 0.05 0.0 82-83 0.21250000000000002 0.0 0.0 0.05 0.0 84-85 0.225 0.0 0.0 0.05 0.0 86-87 0.225 0.0 0.0 0.05 0.0 88-89 0.25 0.0 0.0 0.05 0.0 90-91 0.3125 0.0 0.0 0.05 0.0 92-93 0.3625 0.0 0.0 0.05 0.0 94-95 0.4125 0.0 0.0 0.05 0.0 96-97 0.5 0.0 0.0 0.05 0.0 98-99 0.55 0.0 0.0 0.05 0.0 100-101 0.6 0.0 0.0 0.05 0.0 102-103 0.6125 0.0 0.0 0.05 0.0 104-105 0.7125 0.0 0.0 0.05 0.0 106-107 0.8125 0.0 0.0 0.05 0.0 108-109 0.875 0.0 0.0 0.05 0.0 110-111 0.9125000000000001 0.0 0.0 0.05 0.0 112-113 0.95 0.0 0.0 0.05 0.0 114-115 0.9875 0.0 0.0 0.05 0.0 116-117 1.0 0.0 0.0 0.05 0.0 118-119 1.0625 0.0 0.0 0.05 0.0 120-121 1.15 0.0 0.0 0.05 0.0 122-123 1.2000000000000002 0.0 0.0 0.05 0.0 124-125 1.3375 0.0 0.0 0.05 0.0 126-127 1.4375 0.0 0.0 0.05 0.0 128-129 1.525 0.0 0.0 0.05 0.0 130-131 1.6875 0.0 0.0 0.05 0.0 132-133 1.8 0.0 0.0 0.05 0.0 134-135 1.9249999999999998 0.0 0.0 0.05 0.0 136-137 2.0125 0.0 0.0 0.05 0.0 138 2.05 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139933 spots for SRR8380055.sra Written 1139933 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra Read 1139914 spots for SRR8380055.sra Written 1139914 spots for SRR8380055.sra SRR ids: ['SRR8380055.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_trsu87zb SRR8380055.sra spots: 22798299 blocks: [[1, 1139914], [1139915, 2279828], [2279829, 3419742], [3419743, 4559656], [4559657, 5699570], [5699571, 6839484], [6839485, 7979398], [7979399, 9119312], [9119313, 10259226], [10259227, 11399140], [11399141, 12539054], [12539055, 13678968], [13678969, 14818882], [14818883, 15958796], [15958797, 17098710], [17098711, 18238624], [18238625, 19378538], [19378539, 20518452], [20518453, 21658366], [21658367, 22798299]] SRR8380055 file size 7659367 SRR8380055 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380055 SRR8380055_1.fastq SRR8380055_2.fastq Input file: SRR8380055_1.fastq Paired file: SRR8380055_2.fastq trimmed: SRR8380055-trimmed-pair1.fastq, SRR8380055-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:10:36 2024 >> started Sat Dec 7 16:11:03 2024 >> done (27.005s) 22798299 read pairs processed; of these: 1160 ( 0.01%) short read pairs filtered out after trimming by size control 1209 ( 0.01%) empty read pairs filtered out after trimming by size control 22795930 (99.99%) read pairs available; of these: 1408657 ( 6.18%) trimmed read pairs available after processing 21387273 (93.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 139 0.00% 19 109 0.00% 20 154 0.00% 21 163 0.00% 22 141 0.00% 23 198 0.00% 24 192 0.00% 25 189 0.00% 26 202 0.00% 27 203 0.00% 28 193 0.00% 29 199 0.00% 30 189 0.00% 31 213 0.00% 32 225 0.00% 33 222 0.00% 34 193 0.00% 35 208 0.00% 36 183 0.00% 37 207 0.00% 38 258 0.00% 39 233 0.00% 40 201 0.00% 41 223 0.00% 42 234 0.00% 43 223 0.00% 44 199 0.00% 45 204 0.00% 46 213 0.00% 47 200 0.00% 48 252 0.00% 49 247 0.00% 50 233 0.00% 51 228 0.00% 52 246 0.00% 53 257 0.00% 54 263 0.00% 55 231 0.00% 56 195 0.00% 57 219 0.00% 58 243 0.00% 59 261 0.00% 60 308 0.00% 61 308 0.00% 62 393 0.00% 63 366 0.00% 64 385 0.00% 65 371 0.00% 66 387 0.00% 67 378 0.00% 68 428 0.00% 69 493 0.00% 70 592 0.00% 71 680 0.00% 72 707 0.00% 73 805 0.00% 74 895 0.00% 75 850 0.00% 76 877 0.00% 77 886 0.00% 78 970 0.00% 79 1079 0.00% 80 1255 0.01% 81 1511 0.01% 82 1745 0.01% 83 1884 0.01% 84 2058 0.01% 85 1987 0.01% 86 2078 0.01% 87 2226 0.01% 88 2367 0.01% 89 2549 0.01% 90 2706 0.01% 91 3274 0.01% 92 3585 0.02% 93 3840 0.02% 94 4208 0.02% 95 4197 0.02% 96 4514 0.02% 97 4596 0.02% 98 4647 0.02% 99 5023 0.02% 100 5266 0.02% 101 5596 0.02% 102 6124 0.03% 103 6517 0.03% 104 6941 0.03% 105 7356 0.03% 106 7327 0.03% 107 7407 0.03% 108 7481 0.03% 109 7716 0.03% 110 7954 0.03% 111 8539 0.04% 112 9134 0.04% 113 9852 0.04% 114 10357 0.05% 115 10585 0.05% 116 10759 0.05% 117 10725 0.05% 118 11157 0.05% 119 11041 0.05% 120 11486 0.05% 121 12157 0.05% 122 12888 0.06% 123 13637 0.06% 124 14239 0.06% 125 14505 0.06% 126 15165 0.07% 127 15139 0.07% 128 15418 0.07% 129 15927 0.07% 130 16368 0.07% 131 16834 0.07% 132 17505 0.08% 133 18273 0.08% 134 19589 0.09% 135 20304 0.09% 136 20371 0.09% 137 20878 0.09% 138 21290 0.09% 139 22121 0.10% 140 22263 0.10% 141 22779 0.10% 142 23684 0.10% 143 25064 0.11% 144 26174 0.11% 145 27670 0.12% 146 29018 0.13% 147 33808 0.15% 148 62309 0.27% 149 552767 2.42% 150 21387273 93.82% 22795930 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=29 prefix-density=0.82 prefix-fanout=2.2 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=10.51 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=26 prefix-density=0.83 prefix-fanout=2.2 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=10.52 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.3 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG SRR8380055 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:12:30 Started mapping on | Dec 07 16:12:30 Finished on | Dec 07 16:15:15 Mapping speed, Million of reads per hour | 497.37 Number of input reads | 22795930 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21755613 Uniquely mapped reads % | 95.44% Average mapped length | 296.63 Number of splices: Total | 16303654 Number of splices: Annotated (sjdb) | 15220871 Number of splices: GT/AG | 16063447 Number of splices: GC/AG | 194504 Number of splices: AT/AC | 4526 Number of splices: Non-canonical | 41177 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202844 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 42078 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 1.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 837473 837473 837473 N_multimapping 202844 202844 202844 N_noFeature 493933 10849334 10927908 N_ambiguous 631308 83223 81000 UnstrandedReadsAssigned:20630372 PositiveStrandReadsAssigned:10823056 NegativeStrandReadsAssigned:10746705 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380055 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380055-trimmed-pair1.fastq SRR8380055-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,795,930 reads, 21,356,200 reads pseudoaligned [quant] estimated average fragment length: 248.851 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52973 SRR8380055.ke.tsv 35125 SRR8380055.se.tsv 88098 total ==> SRR8380055.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.392 0 0 PNS24247 1044 796.149 30.2262 2.014 PNS24249 1928 1680.15 92.7916 2.92974 PNS24246 1044 796.149 30.2262 2.014 PNS24248 1044 796.149 30.2262 2.014 PNS24244 1471 1223.15 92.5298 4.01302 PNS24243 293 68.4417 0 0 KQK14069 1603 1355.15 221.04 8.65272 KQK14071 474 228.418 14.9574 3.47371 ==> SRR8380055.se.tsv <== BRADI_1g14170v3 248 BRADI_1g53295v3 13 BRADI_1g59795v3 375 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 185 BRADI_1g74790v3 258 BRADI_1g09890v3 0 BRADI_1g77505v3 439 BRADI_1g48960v3 0 SRR8380055 completed mapping pipeline successfully