Starting /dee2/code/volunteer_pipeline.sh SRR8380056 current disk space = 1541896011776 free memory = 1607572388 SRR8380056 SRAfilesize b9ea5a55f703646ce83eb0b4f7812c41 SRR8380056.sra SRR8380056.sra file validated SRR8380056 is paired end SRR8380056 is conventional basespace SRR8380056 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380056_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.92 32.0 32.0 32.0 27.0 32.0 2 30.79125 32.0 32.0 32.0 27.0 32.0 3 33.63125 32.0 32.0 37.0 32.0 37.0 4 36.23125 37.0 37.0 37.0 32.0 37.0 5 30.245 37.0 27.0 37.0 12.0 37.0 6 39.06325 41.0 37.0 41.0 37.0 41.0 7 38.897 41.0 37.0 41.0 32.0 41.0 8 38.33825 41.0 37.0 41.0 32.0 41.0 9 39.362 41.0 41.0 41.0 37.0 41.0 10-14 39.6867 41.0 41.0 41.0 36.0 41.0 15-19 38.119800000000005 41.0 37.6 41.0 31.0 41.0 20-24 39.192600000000006 41.0 40.2 41.0 34.0 41.0 25-29 39.4008 41.0 40.2 41.0 36.0 41.0 30-34 39.40265000000001 41.0 40.2 41.0 36.0 41.0 35-39 38.2458 40.2 38.2 41.0 31.0 41.0 40-44 37.0943 39.2 34.4 41.0 31.0 41.0 45-49 39.120050000000006 41.0 40.2 41.0 35.0 41.0 50-54 32.78995 37.6 26.0 41.0 19.0 41.0 55-59 36.78575 41.0 34.0 41.0 26.0 41.0 60-64 36.99405 39.2 36.4 41.0 30.0 41.0 65-69 39.716 41.0 41.0 41.0 37.0 41.0 70-74 36.19385 39.2 32.6 41.0 27.0 41.0 75-79 37.6657 40.2 36.6 41.0 29.0 41.0 80-84 38.223099999999995 41.0 38.4 41.0 32.0 41.0 85-89 38.369550000000004 41.0 38.6 41.0 33.0 41.0 90-94 38.76945 41.0 40.2 41.0 34.0 41.0 95-99 38.9291 41.0 40.2 41.0 35.0 41.0 100-104 37.27025 41.0 36.0 41.0 27.0 41.0 105-109 37.85705 40.2 38.4 41.0 30.0 41.0 110-114 37.69995 41.0 36.8 41.0 30.0 41.0 115-119 38.6826 41.0 39.4 41.0 33.0 41.0 120-124 38.1094 41.0 38.6 41.0 30.0 41.0 125-129 37.67165 41.0 37.0 41.0 29.0 41.0 130-134 38.26585 41.0 37.8 41.0 32.0 41.0 135-139 37.65689999999999 41.0 37.0 41.0 29.0 41.0 140-144 37.276650000000004 40.2 36.0 41.0 27.0 41.0 145-149 37.302949999999996 41.0 37.0 41.0 29.0 41.0 150 37.98775 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 1.0 23 2.0 24 4.0 25 12.0 26 14.0 27 22.0 28 31.0 29 44.0 30 54.0 31 59.0 32 83.0 33 112.0 34 152.0 35 211.0 36 292.0 37 439.0 38 616.0 39 938.0 40 911.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.88441198690506 15.462100226643164 16.041299420800804 39.612188365650965 2 27.275 25.224999999999998 27.425 20.075000000000003 3 26.700000000000003 26.724999999999998 21.175 25.4 4 27.075 31.45 14.174999999999999 27.3 5 29.299999999999997 31.424999999999997 18.2 21.075 6 20.7 34.375 18.425 26.5 7 20.625 12.975 37.8 28.599999999999998 8 23.3 18.825 22.05 35.825 9 23.025000000000002 19.625 26.674999999999997 30.675 10-14 25.985000000000003 24.085 22.355 27.575 15-19 25.665 23.535 23.665 27.134999999999998 20-24 26.919999999999998 23.51 22.830000000000002 26.740000000000002 25-29 26.529999999999998 23.77 23.035 26.665 30-34 26.325 24.13 23.0 26.545 35-39 26.86 24.21 22.43 26.5 40-44 27.37 23.48 22.395 26.755000000000003 45-49 26.340000000000003 24.04 22.545 27.075 50-54 27.425 23.855 21.86 26.86 55-59 27.185 24.47 21.72 26.625 60-64 27.089999999999996 23.635 22.765 26.51 65-69 26.735 23.5 22.05 27.715 70-74 27.3 24.055 22.14 26.505000000000003 75-79 27.01 23.22 22.66 27.11 80-84 27.565 23.415 21.875 27.145000000000003 85-89 27.134999999999998 22.835 23.125 26.905 90-94 26.779999999999998 22.650000000000002 22.795 27.775 95-99 27.35 23.35 22.79 26.51 100-104 27.11 23.474999999999998 22.625 26.790000000000003 105-109 26.755000000000003 23.605 22.405 27.235 110-114 26.77 23.615 22.134999999999998 27.48 115-119 27.189999999999998 23.22 23.255 26.334999999999997 120-124 26.83 22.765 23.34 27.065 125-129 27.485 23.21 22.215 27.089999999999996 130-134 27.505000000000003 23.119999999999997 22.71 26.665 135-139 26.33 23.665 23.385 26.619999999999997 140-144 27.889999999999997 23.845 21.895 26.369999999999997 145-149 26.85 22.805 23.044999999999998 27.3 150 26.525 22.45 23.775 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 1.0 28 2.0 29 2.0 30 5.0 31 11.5 32 21.0 33 25.0 34 28.0 35 35.0 36 37.0 37 44.0 38 62.0 39 71.5 40 87.0 41 109.0 42 118.5 43 141.5 44 139.5 45 120.0 46 129.0 47 145.0 48 135.0 49 117.0 50 109.0 51 103.0 52 109.0 53 103.5 54 105.5 55 108.5 56 96.5 57 83.5 58 89.0 59 108.5 60 107.5 61 101.5 62 99.0 63 93.5 64 94.5 65 98.5 66 90.5 67 82.5 68 84.5 69 83.5 70 79.0 71 67.5 72 56.5 73 50.0 74 40.0 75 34.0 76 32.0 77 27.0 78 15.5 79 12.0 80 12.5 81 8.5 82 6.5 83 5.5 84 3.5 85 3.0 86 2.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.60174649378142 89.375 2 4.974861074358296 9.4 3 0.396930404869013 1.125 4 0.02646202699126753 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.0625 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5249999999999999 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTCTT 10 0.006973645 144.0 1 >>END_MODULE SRR8380056 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8380056_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.425 32.0 32.0 32.0 32.0 32.0 2 31.52 32.0 32.0 32.0 32.0 32.0 3 34.91 37.0 32.0 37.0 32.0 37.0 4 30.23875 32.0 27.0 37.0 12.0 37.0 5 35.855 37.0 37.0 37.0 32.0 37.0 6 38.825 41.0 37.0 41.0 32.0 41.0 7 38.979 41.0 41.0 41.0 37.0 41.0 8 39.4285 41.0 41.0 41.0 37.0 41.0 9 39.5205 41.0 41.0 41.0 37.0 41.0 10-14 39.45525 41.0 41.0 41.0 36.0 41.0 15-19 39.0707 41.0 40.2 41.0 35.0 41.0 20-24 39.2596 41.0 41.0 41.0 36.0 41.0 25-29 37.74525 40.2 37.4 41.0 31.0 41.0 30-34 39.45 41.0 41.0 41.0 37.0 41.0 35-39 38.2641 41.0 39.4 41.0 32.0 41.0 40-44 37.6062 41.0 37.6 41.0 30.0 41.0 45-49 38.23605 41.0 37.0 41.0 31.0 41.0 50-54 38.51525 41.0 40.2 41.0 31.0 41.0 55-59 37.506150000000005 41.0 36.8 41.0 28.0 41.0 60-64 38.158 41.0 39.4 41.0 30.0 41.0 65-69 38.3391 41.0 38.6 41.0 31.0 41.0 70-74 38.1051 41.0 37.8 41.0 31.0 41.0 75-79 37.859950000000005 41.0 37.8 41.0 30.0 41.0 80-84 37.4283 41.0 36.8 41.0 28.0 41.0 85-89 38.3498 41.0 39.4 41.0 32.0 41.0 90-94 36.266149999999996 40.2 35.6 41.0 24.0 41.0 95-99 37.8223 41.0 37.0 41.0 30.0 41.0 100-104 37.62310000000001 41.0 37.0 41.0 29.0 41.0 105-109 36.76084999999999 41.0 37.0 41.0 26.0 41.0 110-114 35.796350000000004 39.4 33.0 41.0 25.0 41.0 115-119 37.36355 41.0 37.0 41.0 31.0 41.0 120-124 37.13625 41.0 37.0 41.0 28.0 41.0 125-129 35.61125 40.2 33.0 41.0 23.0 41.0 130-134 34.81705 39.4 32.0 41.0 18.0 41.0 135-139 33.494 37.0 29.0 41.0 14.0 41.0 140-144 33.0759 37.0 28.0 41.0 16.0 41.0 145-149 33.232350000000004 37.0 27.0 41.0 14.0 41.0 150 28.822 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 9.0 20 2.0 21 7.0 22 15.0 23 13.0 24 20.0 25 19.0 26 30.0 27 36.0 28 63.0 29 53.0 30 72.0 31 85.0 32 112.0 33 134.0 34 149.0 35 210.0 36 293.0 37 404.0 38 630.0 39 991.0 40 650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.025000000000002 14.6 17.1 39.275 2 26.525 22.5 29.325000000000003 21.65 3 26.325 26.700000000000003 21.75 25.224999999999998 4 30.099999999999998 29.25 15.25 25.4 5 27.925 31.1 17.150000000000002 23.825 6 20.65 32.525 20.125 26.700000000000003 7 20.125 13.8 37.4 28.675 8 22.25 18.2 23.25 36.3 9 22.525000000000002 19.875 27.474999999999998 30.125 10-14 26.125 23.91 22.605 27.36 15-19 25.965 23.715 23.355 26.965 20-24 26.215 24.0 22.95 26.834999999999997 25-29 26.32 23.75 22.945 26.985 30-34 26.035000000000004 23.71 23.055 27.200000000000003 35-39 26.314999999999998 24.055 22.720000000000002 26.91 40-44 26.790000000000003 23.494999999999997 22.62 27.095000000000002 45-49 26.395000000000003 23.72 22.71 27.175 50-54 26.13 23.84 22.919999999999998 27.11 55-59 26.640000000000004 23.080000000000002 22.634999999999998 27.644999999999996 60-64 26.685 22.99 23.355 26.97 65-69 26.810000000000002 22.805 22.58 27.805000000000003 70-74 26.88 22.720000000000002 22.650000000000002 27.750000000000004 75-79 27.05 22.89 22.41 27.650000000000002 80-84 26.640000000000004 22.98 22.945 27.435 85-89 27.279999999999998 22.425 23.14 27.155 90-94 26.245 23.74 22.384999999999998 27.63 95-99 26.76 22.43 23.200000000000003 27.61 100-104 26.63 23.185 22.585 27.6 105-109 26.39 22.79 23.005 27.815 110-114 27.22 23.77 22.495 26.515 115-119 27.0 22.595000000000002 22.88 27.525 120-124 26.185000000000002 23.135 23.24 27.439999999999998 125-129 26.810000000000002 22.27 23.155 27.765 130-134 26.810000000000002 22.58 23.425 27.185 135-139 27.365000000000002 23.23 22.915 26.490000000000002 140-144 27.195000000000004 22.919999999999998 22.869999999999997 27.015 145-149 27.305 23.075000000000003 22.515 27.105 150 27.425 22.2 23.425 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 1.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 5.0 29 6.5 30 5.0 31 6.0 32 12.5 33 21.0 34 28.0 35 38.5 36 46.5 37 46.5 38 60.0 39 72.0 40 87.0 41 115.0 42 129.0 43 137.0 44 135.0 45 133.5 46 127.0 47 117.0 48 130.5 49 130.0 50 125.5 51 117.5 52 102.0 53 91.0 54 85.0 55 85.0 56 89.0 57 93.0 58 96.5 59 97.0 60 93.5 61 114.0 62 111.5 63 97.5 64 97.5 65 94.5 66 89.0 67 89.0 68 96.0 69 86.5 70 68.5 71 58.0 72 53.5 73 52.5 74 48.0 75 38.0 76 31.5 77 24.5 78 23.0 79 19.0 80 10.0 81 7.5 82 6.5 83 4.5 84 1.5 85 0.0 86 1.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.78832311383631 87.94999999999999 2 5.811783524393495 10.9 3 0.37323380431884834 1.05 4 0.026659557451346308 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTGCG 10 0.006973645 144.0 4 >>END_MODULE Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105710 spots for SRR8380056.sra Written 1105710 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra Read 1105709 spots for SRR8380056.sra Written 1105709 spots for SRR8380056.sra SRR ids: ['SRR8380056.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ngdrj2un SRR8380056.sra spots: 22114181 blocks: [[1, 1105709], [1105710, 2211418], [2211419, 3317127], [3317128, 4422836], [4422837, 5528545], [5528546, 6634254], [6634255, 7739963], [7739964, 8845672], [8845673, 9951381], [9951382, 11057090], [11057091, 12162799], [12162800, 13268508], [13268509, 14374217], [14374218, 15479926], [15479927, 16585635], [16585636, 17691344], [17691345, 18797053], [18797054, 19902762], [19902763, 21008471], [21008472, 22114181]] SRR8380056 file size 7428878 SRR8380056 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8380056 SRR8380056_1.fastq SRR8380056_2.fastq Input file: SRR8380056_1.fastq Paired file: SRR8380056_2.fastq trimmed: SRR8380056-trimmed-pair1.fastq, SRR8380056-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:22:54 2024 >> started Sat Dec 7 16:24:35 2024 >> done (100.712s) 22114181 read pairs processed; of these: 1114 ( 0.01%) short read pairs filtered out after trimming by size control 1076 ( 0.00%) empty read pairs filtered out after trimming by size control 22111991 (99.99%) read pairs available; of these: 1436234 ( 6.50%) trimmed read pairs available after processing 20675757 (93.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 144 0.00% 19 110 0.00% 20 161 0.00% 21 170 0.00% 22 190 0.00% 23 184 0.00% 24 234 0.00% 25 203 0.00% 26 195 0.00% 27 254 0.00% 28 206 0.00% 29 254 0.00% 30 243 0.00% 31 222 0.00% 32 239 0.00% 33 215 0.00% 34 222 0.00% 35 230 0.00% 36 231 0.00% 37 241 0.00% 38 247 0.00% 39 212 0.00% 40 211 0.00% 41 236 0.00% 42 230 0.00% 43 242 0.00% 44 215 0.00% 45 201 0.00% 46 231 0.00% 47 209 0.00% 48 251 0.00% 49 273 0.00% 50 252 0.00% 51 260 0.00% 52 262 0.00% 53 246 0.00% 54 254 0.00% 55 263 0.00% 56 270 0.00% 57 278 0.00% 58 268 0.00% 59 308 0.00% 60 303 0.00% 61 356 0.00% 62 363 0.00% 63 390 0.00% 64 373 0.00% 65 356 0.00% 66 357 0.00% 67 406 0.00% 68 450 0.00% 69 480 0.00% 70 543 0.00% 71 692 0.00% 72 764 0.00% 73 852 0.00% 74 793 0.00% 75 854 0.00% 76 892 0.00% 77 987 0.00% 78 1009 0.00% 79 1209 0.01% 80 1359 0.01% 81 1604 0.01% 82 1835 0.01% 83 2041 0.01% 84 2113 0.01% 85 2170 0.01% 86 2267 0.01% 87 2384 0.01% 88 2578 0.01% 89 2819 0.01% 90 3017 0.01% 91 3405 0.02% 92 3899 0.02% 93 4239 0.02% 94 4647 0.02% 95 4785 0.02% 96 4733 0.02% 97 4955 0.02% 98 5057 0.02% 99 5340 0.02% 100 5645 0.03% 101 5934 0.03% 102 6530 0.03% 103 7159 0.03% 104 7347 0.03% 105 7667 0.03% 106 7930 0.04% 107 7778 0.04% 108 7783 0.04% 109 8169 0.04% 110 8651 0.04% 111 9063 0.04% 112 9723 0.04% 113 10529 0.05% 114 10962 0.05% 115 11161 0.05% 116 11372 0.05% 117 11249 0.05% 118 11361 0.05% 119 11766 0.05% 120 12198 0.06% 121 12680 0.06% 122 13559 0.06% 123 13976 0.06% 124 15019 0.07% 125 15214 0.07% 126 15867 0.07% 127 15791 0.07% 128 16070 0.07% 129 16604 0.08% 130 16596 0.08% 131 17065 0.08% 132 18205 0.08% 133 18787 0.08% 134 19618 0.09% 135 20293 0.09% 136 20482 0.09% 137 21303 0.10% 138 21531 0.10% 139 21916 0.10% 140 22260 0.10% 141 23093 0.10% 142 24084 0.11% 143 24875 0.11% 144 25876 0.12% 145 27354 0.12% 146 28777 0.13% 147 33626 0.15% 148 62465 0.28% 149 556028 2.51% 150 20675757 93.50% 22111991 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=15 prefix-density=0.78 prefix-fanout=2.7 sequence=CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=11.48 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=26 prefix-density=0.68 prefix-fanout=2.2 sequence=GAGGAGTCCGGCAAGGCCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=11.09 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG SRR8380056 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:37:59 Started mapping on | Dec 07 17:37:59 Finished on | Dec 07 17:50:34 Mapping speed, Million of reads per hour | 105.43 Number of input reads | 22111991 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21017145 Uniquely mapped reads % | 95.05% Average mapped length | 296.51 Number of splices: Total | 17108232 Number of splices: Annotated (sjdb) | 16048795 Number of splices: GT/AG | 16857358 Number of splices: GC/AG | 206491 Number of splices: AT/AC | 5065 Number of splices: Non-canonical | 39318 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202038 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 46497 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 1.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 892808 892808 892808 N_multimapping 202038 202038 202038 N_noFeature 525097 10535991 10567069 N_ambiguous 591663 78189 78164 UnstrandedReadsAssigned:19900385 PositiveStrandReadsAssigned:10402965 NegativeStrandReadsAssigned:10371912 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8380056 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8380056-trimmed-pair1.fastq SRR8380056-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,111,991 reads, 20,614,410 reads pseudoaligned [quant] estimated average fragment length: 250.751 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR8380056.ke.tsv 35125 SRR8380056.se.tsv 88098 total ==> SRR8380056.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.5 0 0 PNS24247 1044 794.249 31.818 2.24309 PNS24249 1928 1678.25 129.755 4.3291 PNS24246 1044 794.249 31.818 2.24309 PNS24248 1044 794.249 31.818 2.24309 PNS24244 1471 1221.25 58.7908 2.69547 PNS24243 293 68.7039 2 1.62996 KQK14069 1603 1353.25 237.994 9.84732 KQK14071 474 226.647 6.70629 1.65677 ==> SRR8380056.se.tsv <== BRADI_1g14170v3 265 BRADI_1g53295v3 16 BRADI_1g59795v3 343 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 178 BRADI_1g74790v3 256 BRADI_1g09890v3 0 BRADI_1g77505v3 397 BRADI_1g48960v3 0 SRR8380056 completed mapping pipeline successfully