Starting /dee2/code/volunteer_pipeline.sh SRR8450139 current disk space = 1552301113344 free memory = 1604601300 SRR8450139 SRAfilesize 1459de0d65c53babc1bcf101ced6b163 SRR8450139.sra SRR8450139.sra file validated SRR8450139 is paired end SRR8450139 is conventional basespace SRR8450139 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.03075 37.0 37.0 37.0 37.0 37.0 2 36.307 37.0 37.0 37.0 37.0 37.0 3 36.341 37.0 37.0 37.0 37.0 37.0 4 36.4645 37.0 37.0 37.0 37.0 37.0 5 36.436 37.0 37.0 37.0 37.0 37.0 6 36.4605 37.0 37.0 37.0 37.0 37.0 7 36.3475 37.0 37.0 37.0 37.0 37.0 8 36.39 37.0 37.0 37.0 37.0 37.0 9 36.5335 37.0 37.0 37.0 37.0 37.0 10-14 36.4253 37.0 37.0 37.0 37.0 37.0 15-19 36.4381 37.0 37.0 37.0 37.0 37.0 20-24 36.430899999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.3563 37.0 37.0 37.0 37.0 37.0 30-34 36.392700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.31080000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3272 37.0 37.0 37.0 37.0 37.0 45-49 36.243 37.0 37.0 37.0 37.0 37.0 50-54 36.2645 37.0 37.0 37.0 37.0 37.0 55-59 36.1543 37.0 37.0 37.0 37.0 37.0 60-64 36.1519 37.0 37.0 37.0 37.0 37.0 65-69 36.0393 37.0 37.0 37.0 37.0 37.0 70-74 36.1271 37.0 37.0 37.0 37.0 37.0 75-79 36.1973 37.0 37.0 37.0 37.0 37.0 80-84 36.2046 37.0 37.0 37.0 37.0 37.0 85-89 36.08 37.0 37.0 37.0 37.0 37.0 90-94 36.1607 37.0 37.0 37.0 37.0 37.0 95-99 36.062200000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.0322 37.0 37.0 37.0 37.0 37.0 105-109 36.0535 37.0 37.0 37.0 37.0 37.0 110-114 35.947900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0129 37.0 37.0 37.0 37.0 37.0 120-124 35.9481 37.0 37.0 37.0 37.0 37.0 125-129 35.873900000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8645 37.0 37.0 37.0 37.0 37.0 135-139 35.7992 37.0 37.0 37.0 37.0 37.0 140-144 35.772800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.89020000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.23075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 0.0 25 4.0 26 3.0 27 7.0 28 19.0 29 21.0 30 55.0 31 40.0 32 63.0 33 96.0 34 155.0 35 360.0 36 2747.0 37 427.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.2273070153382 11.541362836308776 8.222278099069651 32.00905204928338 2 27.913956978489246 13.48174087043522 29.389694847423716 29.214607303651825 3 22.475 19.2 23.775 34.55 4 27.474999999999998 23.525 20.925 28.075 5 28.299999999999997 28.575 21.5 21.625 6 22.675 31.075000000000003 23.425 22.825 7 19.0 23.150000000000002 38.324999999999996 19.525000000000002 8 22.525000000000002 22.2 28.299999999999997 26.974999999999998 9 22.475 20.925 31.75 24.85 10-14 24.79 25.435000000000002 24.834999999999997 24.94 15-19 24.195 24.279999999999998 25.419999999999998 26.105 20-24 23.35 24.715 26.105 25.83 25-29 24.66 24.404999999999998 24.97 25.965 30-34 24.175 24.505 24.935 26.384999999999998 35-39 24.37 23.815 25.324999999999996 26.490000000000002 40-44 24.875 24.175 24.67 26.279999999999998 45-49 24.895 23.68 25.064999999999998 26.36 50-54 24.38 24.335 24.845 26.44 55-59 25.259999999999998 23.625 24.65 26.465 60-64 24.575 24.34 24.97 26.115 65-69 24.77 24.245 24.565 26.419999999999998 70-74 25.255 24.065 24.355 26.325 75-79 24.959999999999997 23.77 24.75 26.52 80-84 24.75 24.759999999999998 24.03 26.46 85-89 25.205 23.705000000000002 24.485 26.605 90-94 25.324999999999996 23.47 24.65 26.555 95-99 25.45 23.990000000000002 24.265 26.295 100-104 26.055 23.69 24.22 26.035000000000004 105-109 25.655 23.995 24.215 26.135 110-114 25.290000000000003 23.735 24.13 26.845000000000002 115-119 25.545 23.135 24.535 26.784999999999997 120-124 25.845000000000002 23.674999999999997 23.605 26.875 125-129 25.765 23.225 24.27 26.740000000000002 130-134 25.929999999999996 23.18 24.37 26.52 135-139 25.83 22.650000000000002 24.27 27.250000000000004 140-144 25.874999999999996 23.080000000000002 24.29 26.755000000000003 145-149 25.615 23.65 23.94 26.795 150-151 26.35 23.0 24.3125 26.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.5 27 2.0 28 2.0 29 4.0 30 7.0 31 8.5 32 13.0 33 21.0 34 28.5 35 34.0 36 38.5 37 53.0 38 68.5 39 80.5 40 97.0 41 114.5 42 143.5 43 164.5 44 170.5 45 175.5 46 177.0 47 174.5 48 171.0 49 168.5 50 164.5 51 153.0 52 129.0 53 112.0 54 107.0 55 100.0 56 100.5 57 100.0 58 81.0 59 80.0 60 89.5 61 83.0 62 73.5 63 69.5 64 72.0 65 81.0 66 69.0 67 55.0 68 53.0 69 45.0 70 48.5 71 44.0 72 35.0 73 32.0 74 31.5 75 25.0 76 15.5 77 11.0 78 5.5 79 3.5 80 3.5 81 2.5 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.22427440633246 90.225 2 4.379947229551451 8.3 3 0.34300791556728233 0.975 4 0.0 0.0 5 0.02638522427440633 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02638522427440633 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTTAACATCTCGTAT 15 0.375 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTTAACATCGCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.2125 0.0 0.0 0.0 0.0 136-137 1.3875000000000002 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTATT 10 0.006830828 145.0 1 GTATTAC 10 0.006830828 145.0 3 GCATCTT 10 0.006830828 145.0 145 GGTATTA 10 0.006830828 145.0 2 >>END_MODULE SRR8450139 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.825 37.0 37.0 37.0 37.0 37.0 2 35.3015 37.0 37.0 37.0 37.0 37.0 3 35.348 37.0 37.0 37.0 37.0 37.0 4 35.233 37.0 37.0 37.0 37.0 37.0 5 35.284 37.0 37.0 37.0 37.0 37.0 6 35.2505 37.0 37.0 37.0 37.0 37.0 7 35.216 37.0 37.0 37.0 37.0 37.0 8 35.1505 37.0 37.0 37.0 37.0 37.0 9 35.043 37.0 37.0 37.0 25.0 37.0 10-14 34.9871 37.0 37.0 37.0 29.8 37.0 15-19 34.8698 37.0 37.0 37.0 25.0 37.0 20-24 34.763 37.0 37.0 37.0 25.0 37.0 25-29 34.55980000000001 37.0 37.0 37.0 25.0 37.0 30-34 34.5757 37.0 37.0 37.0 25.0 37.0 35-39 34.5801 37.0 37.0 37.0 25.0 37.0 40-44 34.474000000000004 37.0 37.0 37.0 25.0 37.0 45-49 34.4003 37.0 37.0 37.0 25.0 37.0 50-54 34.3561 37.0 37.0 37.0 25.0 37.0 55-59 34.377500000000005 37.0 37.0 37.0 25.0 37.0 60-64 34.3685 37.0 37.0 37.0 25.0 37.0 65-69 34.3677 37.0 37.0 37.0 25.0 37.0 70-74 34.28670000000001 37.0 37.0 37.0 25.0 37.0 75-79 34.2402 37.0 37.0 37.0 25.0 37.0 80-84 34.228699999999996 37.0 37.0 37.0 25.0 37.0 85-89 34.2544 37.0 37.0 37.0 25.0 37.0 90-94 34.2883 37.0 37.0 37.0 25.0 37.0 95-99 34.220600000000005 37.0 37.0 37.0 25.0 37.0 100-104 34.2697 37.0 37.0 37.0 25.0 37.0 105-109 34.285399999999996 37.0 37.0 37.0 25.0 37.0 110-114 34.157900000000005 37.0 37.0 37.0 25.0 37.0 115-119 34.196 37.0 37.0 37.0 25.0 37.0 120-124 34.1573 37.0 37.0 37.0 25.0 37.0 125-129 34.047599999999996 37.0 37.0 37.0 25.0 37.0 130-134 33.9369 37.0 37.0 37.0 25.0 37.0 135-139 33.8558 37.0 37.0 37.0 25.0 37.0 140-144 33.6683 37.0 37.0 37.0 22.2 37.0 145-149 33.7705 37.0 37.0 37.0 25.0 37.0 150-151 32.90375 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 23.0 14 33.0 15 36.0 16 21.0 17 13.0 18 14.0 19 13.0 20 18.0 21 29.0 22 34.0 23 36.0 24 31.0 25 29.0 26 29.0 27 29.0 28 26.0 29 42.0 30 49.0 31 47.0 32 75.0 33 137.0 34 242.0 35 594.0 36 2212.0 37 184.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.7 18.7 9.9 27.700000000000003 2 35.449999999999996 20.25 23.35 20.95 3 29.475 23.5 23.175 23.849999999999998 4 31.5 28.000000000000004 17.075000000000003 23.425 5 31.3 30.75 17.775 20.175 6 28.299999999999997 32.425 17.75 21.525 7 28.075 18.625 28.7 24.6 8 27.875 22.55 21.224999999999998 28.349999999999998 9 27.575 21.475 23.925 27.025 10-14 29.599999999999998 24.36 20.355 25.685000000000002 15-19 28.815 23.794999999999998 21.435000000000002 25.955000000000002 20-24 28.050000000000004 24.805 21.525 25.619999999999997 25-29 27.815 25.635 21.224999999999998 25.324999999999996 30-34 27.54 25.380000000000003 21.525 25.555 35-39 27.495000000000005 25.915 20.830000000000002 25.759999999999998 40-44 27.529999999999998 25.345000000000002 21.905 25.22 45-49 26.939999999999998 25.575 21.84 25.645 50-54 26.974999999999998 25.979999999999997 21.425 25.619999999999997 55-59 27.775 25.44 21.375 25.41 60-64 27.01 26.215 21.349999999999998 25.424999999999997 65-69 27.26 25.995 21.84 24.905 70-74 27.22 26.565 21.21 25.005 75-79 27.05 25.915 21.41 25.624999999999996 80-84 27.52 25.979999999999997 21.5 25.0 85-89 27.084999999999997 25.759999999999998 21.68 25.474999999999998 90-94 26.97 25.745 21.654999999999998 25.629999999999995 95-99 27.215 26.305 21.455 25.025 100-104 27.284999999999997 26.009999999999998 22.0 24.705 105-109 27.034999999999997 26.505000000000003 21.23 25.230000000000004 110-114 27.365000000000002 26.07 21.515 25.05 115-119 27.265 26.08 21.66 24.995 120-124 27.925 25.900000000000002 21.125 25.05 125-129 27.345000000000002 26.505000000000003 21.64 24.51 130-134 27.275 26.05 21.485000000000003 25.19 135-139 27.18 26.284999999999997 22.189999999999998 24.345 140-144 26.865 26.6 22.439999999999998 24.095 145-149 27.689999999999998 26.650000000000002 21.240000000000002 24.42 150-151 27.725 26.974999999999998 20.775 24.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 1.0 5 1.5 6 2.5 7 2.0 8 0.5 9 1.5 10 4.5 11 5.0 12 2.0 13 2.0 14 2.5 15 3.0 16 4.5 17 3.0 18 2.0 19 1.5 20 2.5 21 3.0 22 1.5 23 3.5 24 4.5 25 4.0 26 4.5 27 4.5 28 4.5 29 9.0 30 9.5 31 4.5 32 6.0 33 13.0 34 18.5 35 22.0 36 29.5 37 39.5 38 47.5 39 67.5 40 93.5 41 106.0 42 120.0 43 130.5 44 134.5 45 140.5 46 157.0 47 170.0 48 154.0 49 134.0 50 127.5 51 115.5 52 105.0 53 112.5 54 108.0 55 98.0 56 106.0 57 100.5 58 93.0 59 98.0 60 90.5 61 81.0 62 86.0 63 95.0 64 89.5 65 74.5 66 77.0 67 84.0 68 74.5 69 65.5 70 65.5 71 69.0 72 61.0 73 40.5 74 30.5 75 30.0 76 23.0 77 14.5 78 13.5 79 11.0 80 6.5 81 6.5 82 4.0 83 1.5 84 2.0 85 2.5 86 1.0 87 1.0 88 2.0 89 1.5 90 2.0 91 2.0 92 3.0 93 5.5 94 4.5 95 3.0 96 2.0 97 2.0 98 3.0 99 3.0 100 11.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.74861367837339 90.64999999999999 2 3.8552944283073676 7.3 3 0.31687351465540003 0.8999999999999999 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.026406126221283337 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026406126221283337 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 36 0.8999999999999999 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.1124999999999998 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138-139 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra Read 1459735 spots for SRR8450139.sra Written 1459735 spots for SRR8450139.sra SRR ids: ['SRR8450139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxbync2r SRR8450139.sra spots: 29194700 blocks: [[1, 1459735], [1459736, 2919470], [2919471, 4379205], [4379206, 5838940], [5838941, 7298675], [7298676, 8758410], [8758411, 10218145], [10218146, 11677880], [11677881, 13137615], [13137616, 14597350], [14597351, 16057085], [16057086, 17516820], [17516821, 18976555], [18976556, 20436290], [20436291, 21896025], [21896026, 23355760], [23355761, 24815495], [24815496, 26275230], [26275231, 27734965], [27734966, 29194700]] SRR8450139 file size 9871425 SRR8450139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450139 SRR8450139_1.fastq SRR8450139_2.fastq Input file: SRR8450139_1.fastq Paired file: SRR8450139_2.fastq trimmed: SRR8450139-trimmed-pair1.fastq, SRR8450139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:53:06 2024 >> started Fri Dec 6 09:53:42 2024 >> done (35.672s) 29194700 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 103077 ( 0.35%) empty read pairs filtered out after trimming by size control 29091550 (99.65%) read pairs available; of these: 1126566 ( 3.87%) trimmed read pairs available after processing 27964984 (96.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 7 0.00% 21 4 0.00% 22 6 0.00% 23 7 0.00% 24 9 0.00% 25 9 0.00% 26 15 0.00% 27 10 0.00% 28 16 0.00% 29 13 0.00% 30 20 0.00% 31 23 0.00% 32 27 0.00% 33 12 0.00% 34 15 0.00% 35 26 0.00% 36 26 0.00% 37 30 0.00% 38 21 0.00% 39 28 0.00% 40 24 0.00% 41 33 0.00% 42 40 0.00% 43 23 0.00% 44 30 0.00% 45 26 0.00% 46 23 0.00% 47 30 0.00% 48 26 0.00% 49 32 0.00% 50 34 0.00% 51 38 0.00% 52 42 0.00% 53 38 0.00% 54 38 0.00% 55 51 0.00% 56 54 0.00% 57 49 0.00% 58 58 0.00% 59 59 0.00% 60 57 0.00% 61 62 0.00% 62 70 0.00% 63 103 0.00% 64 84 0.00% 65 91 0.00% 66 93 0.00% 67 90 0.00% 68 112 0.00% 69 139 0.00% 70 165 0.00% 71 145 0.00% 72 208 0.00% 73 233 0.00% 74 232 0.00% 75 298 0.00% 76 294 0.00% 77 362 0.00% 78 353 0.00% 79 428 0.00% 80 467 0.00% 81 550 0.00% 82 595 0.00% 83 710 0.00% 84 798 0.00% 85 904 0.00% 86 937 0.00% 87 1094 0.00% 88 1221 0.00% 89 1339 0.00% 90 1413 0.00% 91 1631 0.01% 92 1852 0.01% 93 2089 0.01% 94 2302 0.01% 95 2571 0.01% 96 2898 0.01% 97 2962 0.01% 98 3273 0.01% 99 3546 0.01% 100 3877 0.01% 101 4393 0.02% 102 4694 0.02% 103 5177 0.02% 104 5581 0.02% 105 5994 0.02% 106 6607 0.02% 107 6853 0.02% 108 7325 0.03% 109 7856 0.03% 110 8290 0.03% 111 9049 0.03% 112 9386 0.03% 113 10263 0.04% 114 10860 0.04% 115 11741 0.04% 116 12402 0.04% 117 12695 0.04% 118 13778 0.05% 119 14031 0.05% 120 14839 0.05% 121 15467 0.05% 122 16284 0.06% 123 17595 0.06% 124 18518 0.06% 125 19239 0.07% 126 20418 0.07% 127 21277 0.07% 128 21880 0.08% 129 22727 0.08% 130 23180 0.08% 131 24309 0.08% 132 25393 0.09% 133 27031 0.09% 134 28092 0.10% 135 29206 0.10% 136 30148 0.10% 137 31245 0.11% 138 32270 0.11% 139 32939 0.11% 140 33691 0.12% 141 34574 0.12% 142 36441 0.13% 143 37886 0.13% 144 39589 0.14% 145 41055 0.14% 146 42273 0.15% 147 43701 0.15% 148 44828 0.15% 149 45443 0.16% 150 46322 0.16% 151 27964984 96.13% 29091550 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=19 prefix-density=0.80 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=34.45 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.8 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=20 prefix-density=0.49 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.15 sequence-density-rank=20 fanout-score=72.60 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=12.1 sequence=CCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR8450139 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:56:57 Started mapping on | Dec 06 09:56:57 Finished on | Dec 06 10:01:40 Mapping speed, Million of reads per hour | 370.07 Number of input reads | 29091550 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 26027083 Uniquely mapped reads % | 89.47% Average mapped length | 299.18 Number of splices: Total | 27518104 Number of splices: Annotated (sjdb) | 25832966 Number of splices: GT/AG | 27147516 Number of splices: GC/AG | 319239 Number of splices: AT/AC | 10758 Number of splices: Non-canonical | 40591 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.89 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287517 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 29930 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.69% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2776950 2776950 2776950 N_multimapping 287517 287517 287517 N_noFeature 767600 25257682 982132 N_ambiguous 679365 4010 126515 UnstrandedReadsAssigned:24580118 PositiveStrandReadsAssigned:765391 NegativeStrandReadsAssigned:24918436 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450139-trimmed-pair1.fastq SRR8450139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,091,550 reads, 26,350,998 reads pseudoaligned [quant] estimated average fragment length: 310.55 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR8450139.ke.tsv 35125 SRR8450139.se.tsv 88098 total ==> SRR8450139.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.294 0 0 PNS24247 1044 734.449 63.5935 4.36532 PNS24249 1928 1618.45 216.108 6.73192 PNS24246 1044 734.449 63.5935 4.36532 PNS24248 1044 734.449 63.5935 4.36532 PNS24244 1471 1161.45 93.1111 4.04173 PNS24243 293 79.6565 0 0 KQK14069 1603 1293.45 5764.85 224.701 KQK14071 474 204.161 78.6042 19.4106 ==> SRR8450139.se.tsv <== BRADI_1g14170v3 5870 BRADI_1g53295v3 256 BRADI_1g59795v3 279 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 824 BRADI_1g74790v3 175 BRADI_1g09890v3 0 BRADI_1g77505v3 437 BRADI_1g48960v3 0 SRR8450139 completed mapping pipeline successfully