Starting /dee2/code/volunteer_pipeline.sh SRR8450140 current disk space = 1552301113344 free memory = 1604596584 SRR8450140 SRAfilesize bfc26ba302167282ae966fb2653a4f11 SRR8450140.sra SRR8450140.sra file validated SRR8450140 is paired end SRR8450140 is conventional basespace SRR8450140 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15 37.0 37.0 37.0 37.0 37.0 2 36.3305 37.0 37.0 37.0 37.0 37.0 3 36.342 37.0 37.0 37.0 37.0 37.0 4 36.54 37.0 37.0 37.0 37.0 37.0 5 36.5155 37.0 37.0 37.0 37.0 37.0 6 36.49 37.0 37.0 37.0 37.0 37.0 7 36.3995 37.0 37.0 37.0 37.0 37.0 8 36.536 37.0 37.0 37.0 37.0 37.0 9 36.492 37.0 37.0 37.0 37.0 37.0 10-14 36.502300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.43300000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.456100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.3548 37.0 37.0 37.0 37.0 37.0 30-34 36.386700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.394999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3634 37.0 37.0 37.0 37.0 37.0 45-49 36.3886 37.0 37.0 37.0 37.0 37.0 50-54 36.3291 37.0 37.0 37.0 37.0 37.0 55-59 36.3276 37.0 37.0 37.0 37.0 37.0 60-64 36.2713 37.0 37.0 37.0 37.0 37.0 65-69 36.1721 37.0 37.0 37.0 37.0 37.0 70-74 36.243100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2796 37.0 37.0 37.0 37.0 37.0 80-84 36.265100000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.200599999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.230199999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1452 37.0 37.0 37.0 37.0 37.0 100-104 36.1263 37.0 37.0 37.0 37.0 37.0 105-109 36.1271 37.0 37.0 37.0 37.0 37.0 110-114 36.0621 37.0 37.0 37.0 37.0 37.0 115-119 36.0757 37.0 37.0 37.0 37.0 37.0 120-124 35.923100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9639 37.0 37.0 37.0 37.0 37.0 130-134 35.9504 37.0 37.0 37.0 37.0 37.0 135-139 35.8741 37.0 37.0 37.0 37.0 37.0 140-144 35.855900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.9072 37.0 37.0 37.0 37.0 37.0 150-151 35.296 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 1.0 26 3.0 27 9.0 28 11.0 29 22.0 30 33.0 31 41.0 32 53.0 33 84.0 34 150.0 35 364.0 36 2776.0 37 449.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.80020080321285 9.989959839357429 9.538152610441768 36.67168674698795 2 29.225 12.6 27.875 30.3 3 24.75 16.55 21.175 37.525 4 27.500000000000004 22.825 20.3 29.375 5 27.474999999999998 27.125 22.425 22.975 6 24.55 29.9 22.2 23.35 7 20.674999999999997 22.775000000000002 37.05 19.5 8 22.1 23.150000000000002 28.775000000000002 25.974999999999998 9 20.45 21.925 33.0 24.625 10-14 24.834999999999997 24.36 25.275 25.53 15-19 24.925 24.21 24.834999999999997 26.029999999999998 20-24 24.695 24.665 25.095 25.545 25-29 24.735 24.38 24.295 26.590000000000003 30-34 24.310000000000002 23.465 25.245 26.979999999999997 35-39 25.115 23.645 24.43 26.810000000000002 40-44 24.595 23.72 25.264999999999997 26.419999999999998 45-49 25.235000000000003 24.235 24.07 26.46 50-54 24.47 24.37 24.565 26.595000000000002 55-59 25.235000000000003 23.9 24.335 26.529999999999998 60-64 24.72 23.59 24.48 27.21 65-69 25.285000000000004 24.29 24.265 26.16 70-74 25.195 23.515 24.14 27.150000000000002 75-79 25.509999999999998 23.49 24.575 26.424999999999997 80-84 25.105 23.615 24.15 27.13 85-89 24.695 23.830000000000002 24.38 27.095000000000002 90-94 25.480000000000004 23.494999999999997 24.335 26.69 95-99 25.145 23.02 24.955 26.88 100-104 25.455 23.9 24.135 26.51 105-109 25.655 23.630000000000003 24.115000000000002 26.6 110-114 24.825 23.615 24.54 27.02 115-119 25.895000000000003 23.24 24.0 26.865 120-124 25.03 23.895 24.21 26.865 125-129 25.825 23.810000000000002 23.465 26.900000000000002 130-134 25.965 24.025 23.215 26.795 135-139 25.540000000000003 23.14 24.19 27.13 140-144 26.105 23.175 23.9 26.82 145-149 26.040000000000003 23.525 23.375 27.060000000000002 150-151 26.025 23.25 23.9125 26.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.5 29 4.0 30 4.0 31 7.0 32 13.0 33 16.5 34 20.0 35 29.0 36 43.0 37 55.0 38 76.5 39 84.5 40 97.0 41 123.0 42 139.5 43 150.5 44 154.5 45 155.5 46 161.5 47 180.5 48 172.0 49 161.0 50 156.0 51 144.5 52 122.0 53 108.5 54 114.5 55 102.0 56 85.5 57 87.5 58 92.0 59 84.0 60 83.5 61 93.5 62 90.0 63 80.0 64 80.0 65 92.5 66 91.0 67 66.0 68 52.0 69 54.5 70 55.0 71 43.0 72 29.0 73 30.5 74 34.0 75 24.0 76 16.0 77 11.5 78 8.5 79 7.5 80 6.0 81 2.5 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16298633017875 90.5 2 4.547844374342797 8.649999999999999 3 0.26288117770767616 0.75 4 0.026288117770767613 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.025 98-99 0.0 0.0 0.0 0.0 0.05 100-101 0.025 0.0 0.0 0.0 0.05 102-103 0.0875 0.0 0.0 0.0 0.05 104-105 0.2 0.0 0.0 0.0 0.05 106-107 0.225 0.0 0.0 0.0 0.05 108-109 0.2625 0.0 0.0 0.0 0.05 110-111 0.3125 0.0 0.0 0.0 0.05 112-113 0.3625 0.0 0.0 0.0 0.05 114-115 0.4 0.0 0.0 0.0 0.05 116-117 0.475 0.0 0.0 0.0 0.05 118-119 0.5625 0.0 0.0 0.0 0.05 120-121 0.675 0.0 0.0 0.0 0.05 122-123 0.8 0.0 0.0 0.0 0.05 124-125 0.85 0.0 0.0 0.0 0.05 126-127 0.9625 0.0 0.0 0.0 0.05 128-129 1.125 0.0 0.0 0.0 0.05 130-131 1.2875 0.0 0.0 0.0 0.05 132-133 1.5125000000000002 0.0 0.0 0.0 0.05 134-135 1.75 0.0 0.0 0.0 0.05 136-137 1.925 0.0 0.0 0.0 0.05 138-139 2.0999999999999996 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGAA 10 0.006830828 145.0 1 >>END_MODULE SRR8450140 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.011 37.0 37.0 37.0 37.0 37.0 2 35.7135 37.0 37.0 37.0 37.0 37.0 3 35.752 37.0 37.0 37.0 37.0 37.0 4 35.799 37.0 37.0 37.0 37.0 37.0 5 35.6355 37.0 37.0 37.0 37.0 37.0 6 35.5455 37.0 37.0 37.0 37.0 37.0 7 35.7565 37.0 37.0 37.0 37.0 37.0 8 35.5715 37.0 37.0 37.0 37.0 37.0 9 35.6495 37.0 37.0 37.0 37.0 37.0 10-14 35.5227 37.0 37.0 37.0 37.0 37.0 15-19 35.4072 37.0 37.0 37.0 37.0 37.0 20-24 35.387600000000006 37.0 37.0 37.0 37.0 37.0 25-29 35.220099999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.121300000000005 37.0 37.0 37.0 32.2 37.0 35-39 35.192099999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.0351 37.0 37.0 37.0 29.8 37.0 45-49 35.0358 37.0 37.0 37.0 32.2 37.0 50-54 34.954 37.0 37.0 37.0 25.0 37.0 55-59 35.0467 37.0 37.0 37.0 32.2 37.0 60-64 34.9993 37.0 37.0 37.0 29.8 37.0 65-69 34.9497 37.0 37.0 37.0 25.0 37.0 70-74 34.900400000000005 37.0 37.0 37.0 25.0 37.0 75-79 34.8923 37.0 37.0 37.0 25.0 37.0 80-84 34.9295 37.0 37.0 37.0 25.0 37.0 85-89 34.7838 37.0 37.0 37.0 25.0 37.0 90-94 34.8447 37.0 37.0 37.0 25.0 37.0 95-99 34.7924 37.0 37.0 37.0 25.0 37.0 100-104 34.8043 37.0 37.0 37.0 25.0 37.0 105-109 34.832800000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.67379999999999 37.0 37.0 37.0 25.0 37.0 115-119 34.713 37.0 37.0 37.0 25.0 37.0 120-124 34.6332 37.0 37.0 37.0 25.0 37.0 125-129 34.5592 37.0 37.0 37.0 25.0 37.0 130-134 34.4861 37.0 37.0 37.0 25.0 37.0 135-139 34.424 37.0 37.0 37.0 25.0 37.0 140-144 34.2474 37.0 37.0 37.0 25.0 37.0 145-149 34.31700000000001 37.0 37.0 37.0 25.0 37.0 150-151 33.449 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 19.0 14 21.0 15 17.0 16 16.0 17 15.0 18 13.0 19 5.0 20 16.0 21 19.0 22 19.0 23 17.0 24 20.0 25 16.0 26 17.0 27 23.0 28 19.0 29 34.0 30 45.0 31 56.0 32 75.0 33 130.0 34 228.0 35 580.0 36 2369.0 37 209.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.824999999999996 18.05 10.725 33.4 2 33.775 21.025 23.9 21.3 3 26.200000000000003 24.375 24.349999999999998 25.074999999999996 4 30.375000000000004 26.424999999999997 19.6 23.599999999999998 5 31.45 27.575 18.65 22.325 6 27.05 32.574999999999996 18.099999999999998 22.275 7 26.5 18.224999999999998 30.5 24.775 8 27.075 22.650000000000002 21.075 29.2 9 25.974999999999998 22.625 24.55 26.85 10-14 28.165000000000003 24.565 20.87 26.400000000000002 15-19 28.23 24.635 21.67 25.465 20-24 28.035 24.169999999999998 21.529999999999998 26.265 25-29 27.405 24.67 21.605 26.32 30-34 27.860000000000003 25.14 21.065 25.935000000000002 35-39 27.505000000000003 25.495 21.455 25.545 40-44 27.465 24.5 21.709999999999997 26.325 45-49 28.065 24.855 21.25 25.83 50-54 27.485 25.224999999999998 21.634999999999998 25.655 55-59 27.38 24.6 21.709999999999997 26.31 60-64 27.325 24.895 21.38 26.400000000000002 65-69 27.705000000000002 25.419999999999998 20.805 26.07 70-74 27.16 24.884999999999998 21.965 25.990000000000002 75-79 27.38 25.590000000000003 21.565 25.465 80-84 27.42 25.15 21.6 25.83 85-89 27.095000000000002 24.965 21.85 26.090000000000003 90-94 27.165 25.124999999999996 21.92 25.790000000000003 95-99 27.694999999999997 24.87 21.634999999999998 25.8 100-104 27.55 25.275 21.099999999999998 26.075 105-109 27.139999999999997 25.069999999999997 21.7 26.090000000000003 110-114 27.884999999999998 25.575 21.295 25.245 115-119 27.52 24.805 22.07 25.605 120-124 27.700000000000003 25.540000000000003 21.52 25.240000000000002 125-129 27.315 25.555 21.8 25.330000000000002 130-134 27.589999999999996 25.395 21.775 25.240000000000002 135-139 27.315 25.385 21.775 25.525 140-144 27.839999999999996 26.07 21.099999999999998 24.990000000000002 145-149 27.47 25.41 21.895 25.224999999999998 150-151 27.700000000000003 25.424999999999997 21.3875 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 1.5 6 3.0 7 2.0 8 1.0 9 0.5 10 1.0 11 1.5 12 1.0 13 1.5 14 2.5 15 2.0 16 1.5 17 1.5 18 1.5 19 1.0 20 0.5 21 0.5 22 2.0 23 4.0 24 3.5 25 2.5 26 3.0 27 4.5 28 4.0 29 5.0 30 7.0 31 6.5 32 9.0 33 12.0 34 21.5 35 22.0 36 25.5 37 35.5 38 40.5 39 65.0 40 95.0 41 115.5 42 125.0 43 143.0 44 142.0 45 128.5 46 137.0 47 144.0 48 141.5 49 128.0 50 129.5 51 130.0 52 116.0 53 100.0 54 101.5 55 106.5 56 98.0 57 100.0 58 98.0 59 91.0 60 97.5 61 100.5 62 96.0 63 90.5 64 90.5 65 85.0 66 81.5 67 77.5 68 71.5 69 83.0 70 71.5 71 61.5 72 58.5 73 52.0 74 47.0 75 37.0 76 24.5 77 16.0 78 14.0 79 10.5 80 9.5 81 6.5 82 3.0 83 1.0 84 1.0 85 1.0 86 1.0 87 2.5 88 2.0 89 1.5 90 2.5 91 2.5 92 2.0 93 1.0 94 1.0 95 2.5 96 1.5 97 1.0 98 1.5 99 1.5 100 10.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.67053854276664 90.60000000000001 2 3.9334741288278776 7.449999999999999 3 0.29039070749736007 0.8250000000000001 4 0.05279831045406547 0.2 5 0.0 0.0 6 0.026399155227032733 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026399155227032733 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 31 0.775 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.11249999999999999 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5875 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.975 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAACAC 10 0.006830828 145.0 1 TCATTGT 10 0.006830828 145.0 8 >>END_MODULE Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676686 spots for SRR8450140.sra Written 1676686 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra Read 1676671 spots for SRR8450140.sra Written 1676671 spots for SRR8450140.sra SRR ids: ['SRR8450140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gd3le5wh SRR8450140.sra spots: 33533435 blocks: [[1, 1676671], [1676672, 3353342], [3353343, 5030013], [5030014, 6706684], [6706685, 8383355], [8383356, 10060026], [10060027, 11736697], [11736698, 13413368], [13413369, 15090039], [15090040, 16766710], [16766711, 18443381], [18443382, 20120052], [20120053, 21796723], [21796724, 23473394], [23473395, 25150065], [25150066, 26826736], [26826737, 28503407], [28503408, 30180078], [30180079, 31856749], [31856750, 33533435]] SRR8450140 file size 11341680 SRR8450140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450140 SRR8450140_1.fastq SRR8450140_2.fastq Input file: SRR8450140_1.fastq Paired file: SRR8450140_2.fastq trimmed: SRR8450140-trimmed-pair1.fastq, SRR8450140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:54:21 2024 >> started Fri Dec 6 09:56:38 2024 >> done (136.688s) 33533435 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 24961 ( 0.07%) empty read pairs filtered out after trimming by size control 33508399 (99.93%) read pairs available; of these: 1317593 ( 3.93%) trimmed read pairs available after processing 32190806 (96.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 9 0.00% 21 9 0.00% 22 7 0.00% 23 16 0.00% 24 13 0.00% 25 13 0.00% 26 19 0.00% 27 20 0.00% 28 11 0.00% 29 19 0.00% 30 15 0.00% 31 18 0.00% 32 31 0.00% 33 29 0.00% 34 23 0.00% 35 25 0.00% 36 33 0.00% 37 37 0.00% 38 26 0.00% 39 28 0.00% 40 31 0.00% 41 34 0.00% 42 48 0.00% 43 33 0.00% 44 27 0.00% 45 42 0.00% 46 45 0.00% 47 41 0.00% 48 45 0.00% 49 38 0.00% 50 64 0.00% 51 39 0.00% 52 53 0.00% 53 53 0.00% 54 46 0.00% 55 54 0.00% 56 57 0.00% 57 78 0.00% 58 71 0.00% 59 55 0.00% 60 69 0.00% 61 77 0.00% 62 122 0.00% 63 102 0.00% 64 84 0.00% 65 121 0.00% 66 98 0.00% 67 133 0.00% 68 151 0.00% 69 151 0.00% 70 176 0.00% 71 171 0.00% 72 205 0.00% 73 249 0.00% 74 276 0.00% 75 265 0.00% 76 315 0.00% 77 331 0.00% 78 341 0.00% 79 409 0.00% 80 470 0.00% 81 518 0.00% 82 627 0.00% 83 698 0.00% 84 793 0.00% 85 860 0.00% 86 980 0.00% 87 1166 0.00% 88 1218 0.00% 89 1380 0.00% 90 1560 0.00% 91 1719 0.01% 92 1866 0.01% 93 2203 0.01% 94 2439 0.01% 95 2771 0.01% 96 2836 0.01% 97 3197 0.01% 98 3550 0.01% 99 3866 0.01% 100 4223 0.01% 101 4638 0.01% 102 5147 0.02% 103 5475 0.02% 104 6181 0.02% 105 6588 0.02% 106 7197 0.02% 107 7573 0.02% 108 8317 0.02% 109 9035 0.03% 110 9352 0.03% 111 10262 0.03% 112 10631 0.03% 113 11628 0.03% 114 12678 0.04% 115 13313 0.04% 116 14279 0.04% 117 15177 0.05% 118 15546 0.05% 119 16180 0.05% 120 17247 0.05% 121 17990 0.05% 122 19035 0.06% 123 20245 0.06% 124 21509 0.06% 125 22513 0.07% 126 23511 0.07% 127 24759 0.07% 128 25605 0.08% 129 26594 0.08% 130 27460 0.08% 131 28686 0.09% 132 29976 0.09% 133 31918 0.10% 134 33124 0.10% 135 34164 0.10% 136 35849 0.11% 137 36720 0.11% 138 37644 0.11% 139 39344 0.12% 140 40245 0.12% 141 41528 0.12% 142 43327 0.13% 143 45096 0.13% 144 46645 0.14% 145 48388 0.14% 146 49953 0.15% 147 51697 0.15% 148 53387 0.16% 149 54453 0.16% 150 55634 0.17% 151 32190806 96.07% 33508399 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=25 prefix-density=0.78 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=19.01 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=21 prefix-density=0.51 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.18 sequence-density-rank=15 fanout-score=71.81 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=13.0 sequence=GCCGCCGCCGCC SRR8450140 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:57:56 Started mapping on | Dec 06 09:57:56 Finished on | Dec 06 10:02:24 Mapping speed, Million of reads per hour | 450.11 Number of input reads | 33508399 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30735081 Uniquely mapped reads % | 91.72% Average mapped length | 299.38 Number of splices: Total | 32963204 Number of splices: Annotated (sjdb) | 30987259 Number of splices: GT/AG | 32522659 Number of splices: GC/AG | 381623 Number of splices: AT/AC | 12838 Number of splices: Non-canonical | 46084 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.82 Insertion rate per base | 0.01% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342076 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 32271 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.44% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2431242 2431242 2431242 N_multimapping 342076 342076 342076 N_noFeature 889598 29830194 1161533 N_ambiguous 782953 4750 152851 UnstrandedReadsAssigned:29062530 PositiveStrandReadsAssigned:900137 NegativeStrandReadsAssigned:29420697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450140-trimmed-pair1.fastq SRR8450140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,508,399 reads, 30,528,667 reads pseudoaligned [quant] estimated average fragment length: 301.4 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR8450140.ke.tsv 35125 SRR8450140.se.tsv 88098 total ==> SRR8450140.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 636.298 0 0 PNS24247 1044 743.6 75.5966 4.49318 PNS24249 1928 1627.6 211.76 5.75026 PNS24246 1044 743.6 75.5966 4.49318 PNS24248 1044 743.6 75.5966 4.49318 PNS24244 1471 1170.6 80.4502 3.03746 PNS24243 293 78.1069 0 0 KQK14069 1603 1302.6 15412.8 522.952 KQK14071 474 205.345 148.39 31.9384 ==> SRR8450140.se.tsv <== BRADI_1g14170v3 15915 BRADI_1g53295v3 219 BRADI_1g59795v3 225 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 344 BRADI_1g74790v3 246 BRADI_1g09890v3 0 BRADI_1g77505v3 455 BRADI_1g48960v3 0 SRR8450140 completed mapping pipeline successfully