Starting /dee2/code/volunteer_pipeline.sh SRR8450141 current disk space = 1552302858240 free memory = 1604605652 SRR8450141 SRAfilesize 0cbeafbaad40a91717b2f3e61cb219d0 SRR8450141.sra SRR8450141.sra file validated SRR8450141 is paired end SRR8450141 is conventional basespace SRR8450141 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.10375 37.0 37.0 37.0 37.0 37.0 2 36.232 37.0 37.0 37.0 37.0 37.0 3 36.386 37.0 37.0 37.0 37.0 37.0 4 36.428 37.0 37.0 37.0 37.0 37.0 5 36.47 37.0 37.0 37.0 37.0 37.0 6 36.4485 37.0 37.0 37.0 37.0 37.0 7 36.337 37.0 37.0 37.0 37.0 37.0 8 36.436 37.0 37.0 37.0 37.0 37.0 9 36.4475 37.0 37.0 37.0 37.0 37.0 10-14 36.467 37.0 37.0 37.0 37.0 37.0 15-19 36.393299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4461 37.0 37.0 37.0 37.0 37.0 25-29 36.3323 37.0 37.0 37.0 37.0 37.0 30-34 36.39 37.0 37.0 37.0 37.0 37.0 35-39 36.3081 37.0 37.0 37.0 37.0 37.0 40-44 36.3072 37.0 37.0 37.0 37.0 37.0 45-49 36.2917 37.0 37.0 37.0 37.0 37.0 50-54 36.2689 37.0 37.0 37.0 37.0 37.0 55-59 36.2053 37.0 37.0 37.0 37.0 37.0 60-64 36.2268 37.0 37.0 37.0 37.0 37.0 65-69 36.105599999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2372 37.0 37.0 37.0 37.0 37.0 75-79 36.22429999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.2124 37.0 37.0 37.0 37.0 37.0 85-89 36.1859 37.0 37.0 37.0 37.0 37.0 90-94 36.134699999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1091 37.0 37.0 37.0 37.0 37.0 100-104 36.0209 37.0 37.0 37.0 37.0 37.0 105-109 36.069300000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.9764 37.0 37.0 37.0 37.0 37.0 115-119 35.9785 37.0 37.0 37.0 37.0 37.0 120-124 35.8928 37.0 37.0 37.0 37.0 37.0 125-129 35.804500000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.825900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8223 37.0 37.0 37.0 37.0 37.0 140-144 35.854600000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7465 37.0 37.0 37.0 37.0 37.0 150-151 35.1375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 3.0 24 0.0 25 2.0 26 7.0 27 7.0 28 18.0 29 25.0 30 33.0 31 50.0 32 61.0 33 106.0 34 137.0 35 347.0 36 2787.0 37 415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.38828851470218 9.952249308871576 9.525006282985675 35.13445589344057 2 28.825 12.65 28.375 30.15 3 22.775000000000002 16.0 22.1 39.125 4 27.825 20.674999999999997 21.475 30.025000000000002 5 28.449999999999996 25.900000000000002 21.75 23.9 6 25.224999999999998 28.549999999999997 23.5 22.725 7 20.1 23.525 36.7 19.675 8 22.025 23.724999999999998 28.299999999999997 25.95 9 21.725 21.45 31.900000000000002 24.925 10-14 24.25 25.435000000000002 24.785 25.53 15-19 24.135 23.32 25.490000000000002 27.055 20-24 23.925 24.995 24.665 26.415 25-29 24.315 24.66 24.855 26.169999999999998 30-34 24.355 24.335 24.93 26.38 35-39 24.779999999999998 23.97 24.9 26.35 40-44 24.55 23.885 24.79 26.775 45-49 24.45 23.765 25.419999999999998 26.365 50-54 24.5 24.26 24.83 26.41 55-59 25.035 24.05 24.529999999999998 26.384999999999998 60-64 24.575 24.154999999999998 24.915000000000003 26.355 65-69 25.009999999999998 24.310000000000002 24.26 26.419999999999998 70-74 25.319999999999997 23.955000000000002 24.545 26.179999999999996 75-79 25.28 24.099999999999998 24.47 26.150000000000002 80-84 25.025 23.45 24.485 27.04 85-89 24.83 24.275 24.46 26.435 90-94 25.3 24.060000000000002 24.895 25.745 95-99 26.035000000000004 23.48 24.0 26.484999999999996 100-104 25.22 24.145 24.560000000000002 26.075 105-109 25.025 23.095 24.87 27.01 110-114 25.185000000000002 23.49 24.615000000000002 26.71 115-119 25.674999999999997 23.01 24.265 27.05 120-124 25.290000000000003 23.97 24.26 26.479999999999997 125-129 25.540000000000003 24.29 23.895 26.275 130-134 25.775 23.47 24.425 26.33 135-139 25.990000000000002 23.51 23.825 26.674999999999997 140-144 25.525 23.62 24.13 26.724999999999998 145-149 25.61 23.035 24.265 27.089999999999996 150-151 26.087500000000002 23.1125 24.5625 26.237500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 2.0 28 1.5 29 4.0 30 5.0 31 8.0 32 15.5 33 16.5 34 17.0 35 25.5 36 35.0 37 50.5 38 64.0 39 80.0 40 97.0 41 109.0 42 141.0 43 158.0 44 165.5 45 181.5 46 180.5 47 178.5 48 178.0 49 165.0 50 147.0 51 148.0 52 135.0 53 112.0 54 114.0 55 108.5 56 103.0 57 105.0 58 94.0 59 86.5 60 92.0 61 88.5 62 76.5 63 79.0 64 77.5 65 70.5 66 69.5 67 65.5 68 57.5 69 51.0 70 50.0 71 39.5 72 36.0 73 35.5 74 22.5 75 15.0 76 13.0 77 11.0 78 7.0 79 3.5 80 2.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.87043892120572 89.7 2 4.732945531464834 8.95 3 0.31729243786356426 0.8999999999999999 4 0.052882072977260705 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026441036488630353 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGCGGTATCTCGTAT 10 0.25 TruSeq Adapter, Index 3 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1625 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.9624999999999999 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.3499999999999996 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 50-54 CGGAAGA 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR8450141 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7525 37.0 37.0 37.0 37.0 37.0 2 35.2985 37.0 37.0 37.0 37.0 37.0 3 35.421 37.0 37.0 37.0 37.0 37.0 4 35.318 37.0 37.0 37.0 37.0 37.0 5 35.3565 37.0 37.0 37.0 37.0 37.0 6 35.327 37.0 37.0 37.0 37.0 37.0 7 35.2905 37.0 37.0 37.0 37.0 37.0 8 35.375 37.0 37.0 37.0 37.0 37.0 9 35.254 37.0 37.0 37.0 37.0 37.0 10-14 35.17700000000001 37.0 37.0 37.0 32.2 37.0 15-19 35.1312 37.0 37.0 37.0 29.8 37.0 20-24 35.05029999999999 37.0 37.0 37.0 29.8 37.0 25-29 34.937 37.0 37.0 37.0 25.0 37.0 30-34 34.8955 37.0 37.0 37.0 25.0 37.0 35-39 34.8535 37.0 37.0 37.0 27.4 37.0 40-44 34.8044 37.0 37.0 37.0 25.0 37.0 45-49 34.7154 37.0 37.0 37.0 25.0 37.0 50-54 34.578100000000006 37.0 37.0 37.0 25.0 37.0 55-59 34.6803 37.0 37.0 37.0 25.0 37.0 60-64 34.6708 37.0 37.0 37.0 25.0 37.0 65-69 34.606700000000004 37.0 37.0 37.0 25.0 37.0 70-74 34.50600000000001 37.0 37.0 37.0 25.0 37.0 75-79 34.5683 37.0 37.0 37.0 25.0 37.0 80-84 34.471199999999996 37.0 37.0 37.0 25.0 37.0 85-89 34.5223 37.0 37.0 37.0 25.0 37.0 90-94 34.4037 37.0 37.0 37.0 25.0 37.0 95-99 34.445100000000004 37.0 37.0 37.0 25.0 37.0 100-104 34.5389 37.0 37.0 37.0 25.0 37.0 105-109 34.5253 37.0 37.0 37.0 25.0 37.0 110-114 34.446999999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.4137 37.0 37.0 37.0 25.0 37.0 120-124 34.330799999999996 37.0 37.0 37.0 25.0 37.0 125-129 34.237 37.0 37.0 37.0 25.0 37.0 130-134 34.1415 37.0 37.0 37.0 25.0 37.0 135-139 34.1653 37.0 37.0 37.0 25.0 37.0 140-144 33.8673 37.0 37.0 37.0 22.2 37.0 145-149 33.941500000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.1635 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 16.0 14 20.0 15 27.0 16 16.0 17 17.0 18 13.0 19 12.0 20 14.0 21 25.0 22 25.0 23 28.0 24 24.0 25 20.0 26 22.0 27 26.0 28 29.0 29 58.0 30 50.0 31 68.0 32 83.0 33 140.0 34 249.0 35 632.0 36 2219.0 37 166.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.7 18.15 11.175 30.975 2 34.525 21.2 20.9 23.375 3 27.750000000000004 23.65 24.625 23.974999999999998 4 31.5 25.974999999999998 18.6 23.925 5 31.95 28.175 18.6 21.275 6 26.75 32.324999999999996 18.475 22.45 7 26.5 20.0 30.075000000000003 23.425 8 28.65 20.674999999999997 22.400000000000002 28.275 9 26.724999999999998 22.1 24.4 26.775 10-14 29.09 24.825 20.805 25.28 15-19 27.855 24.245 22.1 25.8 20-24 28.044999999999998 24.805 21.595 25.555 25-29 27.935 25.03 21.525 25.509999999999998 30-34 27.495000000000005 24.65 21.775 26.08 35-39 27.084999999999997 25.259999999999998 21.485000000000003 26.169999999999998 40-44 27.29 24.85 21.945 25.915 45-49 27.77 25.230000000000004 21.77 25.230000000000004 50-54 26.979999999999997 25.985000000000003 21.83 25.205 55-59 27.015 25.240000000000002 21.845 25.900000000000002 60-64 27.675 24.7 21.805 25.82 65-69 27.485 25.105 21.8 25.61 70-74 27.400000000000002 25.035 21.575 25.990000000000002 75-79 27.215 25.22 21.615000000000002 25.95 80-84 26.865 25.1 22.12 25.915 85-89 28.065 24.779999999999998 21.75 25.405 90-94 27.405 25.369999999999997 21.759999999999998 25.465 95-99 27.26 24.805 22.505 25.430000000000003 100-104 26.884999999999998 24.915000000000003 22.29 25.91 105-109 27.165 25.230000000000004 22.445 25.16 110-114 27.41 25.915 21.310000000000002 25.365 115-119 27.029999999999998 25.64 21.945 25.385 120-124 26.955000000000002 25.814999999999998 22.3 24.93 125-129 27.445000000000004 25.645 22.23 24.68 130-134 27.800000000000004 25.4 22.12 24.68 135-139 27.73 25.7 22.465 24.104999999999997 140-144 27.55 26.14 22.025 24.285 145-149 27.644999999999996 26.415 21.665 24.275 150-151 27.200000000000003 26.674999999999997 21.1875 24.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 2.0 8 2.0 9 0.0 10 1.5 11 2.0 12 1.5 13 1.5 14 1.0 15 1.0 16 0.5 17 1.5 18 1.5 19 1.0 20 2.5 21 4.0 22 4.0 23 2.5 24 1.5 25 3.5 26 3.5 27 1.0 28 4.5 29 8.0 30 9.0 31 11.0 32 15.0 33 17.0 34 18.5 35 23.0 36 27.5 37 47.0 38 61.5 39 65.0 40 74.5 41 94.5 42 115.0 43 135.0 44 150.5 45 154.5 46 154.0 47 140.5 48 137.0 49 140.0 50 132.0 51 120.0 52 107.0 53 98.5 54 107.5 55 107.5 56 96.5 57 97.0 58 101.5 59 101.0 60 105.5 61 106.0 62 95.0 63 92.0 64 82.0 65 70.5 66 77.0 67 78.0 68 77.0 69 80.0 70 70.0 71 53.5 72 56.0 73 57.0 74 35.0 75 23.5 76 19.0 77 14.0 78 9.5 79 5.0 80 4.5 81 5.0 82 5.0 83 5.5 84 3.5 85 1.5 86 5.0 87 6.0 88 3.5 89 1.5 90 0.0 91 2.0 92 3.5 93 3.5 94 4.0 95 3.0 96 2.5 97 4.0 98 3.5 99 2.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.3050397877984 89.825 2 4.137931034482759 7.8 3 0.42440318302387264 1.2 4 0.05305039787798408 0.2 5 0.0 0.0 6 0.02652519893899204 0.15 7 0.02652519893899204 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02652519893899204 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 26 0.65 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 1.95 0.0 0.0 0.0 0.0 134-135 2.1500000000000004 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138-139 2.5875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 10 0.006830828 145.0 145 CGGAAGA 25 4.977651E-4 29.0 140-144 >>END_MODULE Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra Read 1704614 spots for SRR8450141.sra Written 1704614 spots for SRR8450141.sra Read 1704613 spots for SRR8450141.sra Written 1704613 spots for SRR8450141.sra SRR ids: ['SRR8450141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9u3dqx92 SRR8450141.sra spots: 34092261 blocks: [[1, 1704613], [1704614, 3409226], [3409227, 5113839], [5113840, 6818452], [6818453, 8523065], [8523066, 10227678], [10227679, 11932291], [11932292, 13636904], [13636905, 15341517], [15341518, 17046130], [17046131, 18750743], [18750744, 20455356], [20455357, 22159969], [22159970, 23864582], [23864583, 25569195], [25569196, 27273808], [27273809, 28978421], [28978422, 30683034], [30683035, 32387647], [32387648, 34092261]] SRR8450141 file size 11531048 SRR8450141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450141 SRR8450141_1.fastq SRR8450141_2.fastq Input file: SRR8450141_1.fastq Paired file: SRR8450141_2.fastq trimmed: SRR8450141-trimmed-pair1.fastq, SRR8450141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:53:10 2024 >> started Fri Dec 6 09:55:10 2024 >> done (120.583s) 34092261 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 71858 ( 0.21%) empty read pairs filtered out after trimming by size control 34020330 (99.79%) read pairs available; of these: 1285171 ( 3.78%) trimmed read pairs available after processing 32735159 (96.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 8 0.00% 21 5 0.00% 22 8 0.00% 23 14 0.00% 24 12 0.00% 25 16 0.00% 26 10 0.00% 27 7 0.00% 28 16 0.00% 29 23 0.00% 30 18 0.00% 31 26 0.00% 32 15 0.00% 33 24 0.00% 34 16 0.00% 35 38 0.00% 36 22 0.00% 37 33 0.00% 38 28 0.00% 39 30 0.00% 40 27 0.00% 41 26 0.00% 42 35 0.00% 43 43 0.00% 44 30 0.00% 45 32 0.00% 46 41 0.00% 47 42 0.00% 48 37 0.00% 49 48 0.00% 50 46 0.00% 51 50 0.00% 52 39 0.00% 53 80 0.00% 54 60 0.00% 55 61 0.00% 56 73 0.00% 57 67 0.00% 58 65 0.00% 59 89 0.00% 60 72 0.00% 61 84 0.00% 62 118 0.00% 63 107 0.00% 64 119 0.00% 65 127 0.00% 66 156 0.00% 67 172 0.00% 68 162 0.00% 69 194 0.00% 70 218 0.00% 71 254 0.00% 72 307 0.00% 73 311 0.00% 74 391 0.00% 75 380 0.00% 76 445 0.00% 77 493 0.00% 78 555 0.00% 79 634 0.00% 80 685 0.00% 81 866 0.00% 82 920 0.00% 83 986 0.00% 84 1220 0.00% 85 1308 0.00% 86 1557 0.00% 87 1650 0.00% 88 1705 0.01% 89 2011 0.01% 90 2112 0.01% 91 2389 0.01% 92 2696 0.01% 93 2960 0.01% 94 3203 0.01% 95 3540 0.01% 96 3882 0.01% 97 4048 0.01% 98 4594 0.01% 99 4763 0.01% 100 5315 0.02% 101 5758 0.02% 102 6167 0.02% 103 6681 0.02% 104 7037 0.02% 105 7611 0.02% 106 8019 0.02% 107 8525 0.03% 108 9242 0.03% 109 9845 0.03% 110 10091 0.03% 111 10760 0.03% 112 11480 0.03% 113 12201 0.04% 114 12926 0.04% 115 13681 0.04% 116 14423 0.04% 117 14924 0.04% 118 15577 0.05% 119 16366 0.05% 120 17099 0.05% 121 17713 0.05% 122 18681 0.05% 123 19882 0.06% 124 20956 0.06% 125 22127 0.07% 126 22374 0.07% 127 23512 0.07% 128 24335 0.07% 129 25793 0.08% 130 26349 0.08% 131 27398 0.08% 132 28806 0.08% 133 29823 0.09% 134 31135 0.09% 135 32096 0.09% 136 33503 0.10% 137 34397 0.10% 138 35060 0.10% 139 36801 0.11% 140 38169 0.11% 141 39205 0.12% 142 40896 0.12% 143 42068 0.12% 144 43631 0.13% 145 45015 0.13% 146 46139 0.14% 147 48141 0.14% 148 50040 0.15% 149 50953 0.15% 150 52678 0.15% 151 32735159 96.22% 34020330 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=22 prefix-density=0.86 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=29.57 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=20 prefix-density=0.52 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=24 fanout-score=74.31 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=12.0 sequence=CCGCCGCCGCCG SRR8450141 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:56:01 Started mapping on | Dec 06 09:56:01 Finished on | Dec 06 10:00:54 Mapping speed, Million of reads per hour | 418.00 Number of input reads | 34020330 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30799131 Uniquely mapped reads % | 90.53% Average mapped length | 299.25 Number of splices: Total | 33454529 Number of splices: Annotated (sjdb) | 31394412 Number of splices: GT/AG | 33007585 Number of splices: GC/AG | 386888 Number of splices: AT/AC | 13204 Number of splices: Non-canonical | 46852 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.81 Insertion rate per base | 0.01% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428795 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 49242 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.05% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2792404 2792404 2792404 N_multimapping 428795 428795 428795 N_noFeature 1010773 29853651 1302357 N_ambiguous 805424 5186 154731 UnstrandedReadsAssigned:28982934 PositiveStrandReadsAssigned:940294 NegativeStrandReadsAssigned:29342043 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450141-trimmed-pair1.fastq SRR8450141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,020,330 reads, 30,612,817 reads pseudoaligned [quant] estimated average fragment length: 306.456 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52973 SRR8450141.ke.tsv 35125 SRR8450141.se.tsv 88098 total ==> SRR8450141.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 631.411 0 0 PNS24247 1044 738.544 96.512 5.75564 PNS24249 1928 1622.54 195.401 5.30418 PNS24246 1044 738.544 96.512 5.75564 PNS24248 1044 738.544 96.512 5.75564 PNS24244 1471 1165.54 77.0634 2.91211 PNS24243 293 77.538 1 0.568034 KQK14069 1603 1297.54 15384.4 522.213 KQK14071 474 203.25 188.939 40.9431 ==> SRR8450141.se.tsv <== BRADI_1g14170v3 15889 BRADI_1g53295v3 164 BRADI_1g59795v3 195 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 383 BRADI_1g74790v3 263 BRADI_1g09890v3 0 BRADI_1g77505v3 403 BRADI_1g48960v3 0 SRR8450141 completed mapping pipeline successfully