Starting /dee2/code/volunteer_pipeline.sh SRR8450142 current disk space = 1552298049536 free memory = 1604629032 SRR8450142 SRAfilesize d701874677cca76847c134437be520f2 SRR8450142.sra SRR8450142.sra file validated SRR8450142 is paired end SRR8450142 is conventional basespace SRR8450142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.05475 37.0 37.0 37.0 37.0 37.0 2 36.2095 37.0 37.0 37.0 37.0 37.0 3 36.481 37.0 37.0 37.0 37.0 37.0 4 36.412 37.0 37.0 37.0 37.0 37.0 5 36.4895 37.0 37.0 37.0 37.0 37.0 6 36.475 37.0 37.0 37.0 37.0 37.0 7 36.369 37.0 37.0 37.0 37.0 37.0 8 36.4855 37.0 37.0 37.0 37.0 37.0 9 36.4155 37.0 37.0 37.0 37.0 37.0 10-14 36.5124 37.0 37.0 37.0 37.0 37.0 15-19 36.4112 37.0 37.0 37.0 37.0 37.0 20-24 36.4811 37.0 37.0 37.0 37.0 37.0 25-29 36.3903 37.0 37.0 37.0 37.0 37.0 30-34 36.4004 37.0 37.0 37.0 37.0 37.0 35-39 36.369499999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.376099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.352599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3212 37.0 37.0 37.0 37.0 37.0 55-59 36.292500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2762 37.0 37.0 37.0 37.0 37.0 65-69 36.1929 37.0 37.0 37.0 37.0 37.0 70-74 36.27910000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.24499999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3084 37.0 37.0 37.0 37.0 37.0 85-89 36.1706 37.0 37.0 37.0 37.0 37.0 90-94 36.249 37.0 37.0 37.0 37.0 37.0 95-99 36.1452 37.0 37.0 37.0 37.0 37.0 100-104 36.081900000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.0647 37.0 37.0 37.0 37.0 37.0 110-114 36.0276 37.0 37.0 37.0 37.0 37.0 115-119 36.0538 37.0 37.0 37.0 37.0 37.0 120-124 35.9825 37.0 37.0 37.0 37.0 37.0 125-129 35.97539999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.902 37.0 37.0 37.0 37.0 37.0 135-139 35.905 37.0 37.0 37.0 37.0 37.0 140-144 35.8853 37.0 37.0 37.0 37.0 37.0 145-149 35.8622 37.0 37.0 37.0 37.0 37.0 150-151 35.290000000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 6.0 27 8.0 28 11.0 29 23.0 30 28.0 31 49.0 32 58.0 33 80.0 34 141.0 35 357.0 36 2837.0 37 400.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.78936759889141 12.320483749055178 8.868732678256487 35.02141597379693 2 26.23811905952976 12.481240620310155 28.864432216108053 32.416208104052025 3 23.3 15.875 21.825 39.0 4 27.125 22.275 20.525 30.075000000000003 5 29.125 25.85 21.575 23.45 6 25.5 30.025000000000002 22.45 22.025 7 19.45 25.624999999999996 34.949999999999996 19.975 8 22.225 23.875 27.750000000000004 26.150000000000002 9 20.825 21.099999999999998 31.175000000000004 26.900000000000002 10-14 24.85 25.040000000000003 24.93 25.180000000000003 15-19 23.97 24.01 25.264999999999997 26.755000000000003 20-24 24.45 23.9 24.825 26.825 25-29 24.875 23.965 24.779999999999998 26.38 30-34 25.174999999999997 24.015 24.75 26.06 35-39 24.560000000000002 24.29 24.58 26.57 40-44 24.695 23.96 24.91 26.435 45-49 24.375 24.19 24.035 27.400000000000002 50-54 24.59 24.01 24.765 26.634999999999998 55-59 25.03 23.990000000000002 24.515 26.465 60-64 24.855 23.45 24.58 27.115000000000002 65-69 24.875 24.47 23.915 26.740000000000002 70-74 24.855 23.995 24.465 26.685 75-79 25.135 22.884999999999998 24.665 27.315 80-84 25.255 23.955000000000002 24.235 26.555 85-89 25.28 23.849999999999998 24.12 26.75 90-94 24.95 23.599999999999998 24.295 27.155 95-99 25.28 23.775 24.32 26.625 100-104 24.995 23.72 24.255 27.029999999999998 105-109 24.945 24.104999999999997 24.265 26.685 110-114 25.185000000000002 23.565 24.59 26.66 115-119 25.665 23.205000000000002 24.38 26.75 120-124 25.595000000000002 23.26 24.240000000000002 26.905 125-129 25.94 23.525 24.169999999999998 26.365 130-134 25.515 23.315 24.825 26.345000000000002 135-139 26.14 23.09 24.08 26.69 140-144 26.125 23.57 23.925 26.38 145-149 25.44 23.189999999999998 24.635 26.735 150-151 25.650000000000002 22.537499999999998 24.775 27.037499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 3.0 28 4.0 29 4.5 30 6.0 31 8.0 32 10.0 33 13.0 34 20.0 35 34.5 36 35.5 37 32.5 38 63.5 39 82.0 40 91.5 41 110.5 42 135.0 43 160.0 44 162.0 45 169.0 46 188.0 47 187.0 48 165.5 49 165.0 50 152.5 51 135.5 52 135.5 53 122.0 54 111.5 55 101.0 56 102.5 57 109.5 58 93.0 59 84.0 60 89.0 61 89.5 62 79.0 63 69.5 64 67.5 65 71.0 66 72.0 67 66.5 68 64.5 69 58.5 70 50.0 71 41.0 72 40.0 73 34.5 74 29.5 75 24.0 76 12.5 77 14.0 78 12.0 79 7.0 80 5.5 81 2.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.73967590172504 91.57499999999999 2 4.025091479351803 7.7 3 0.18295870360690017 0.525 4 0.052273915316257184 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9125 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2125 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.5750000000000002 0.0 0.0 0.0 0.0 136-137 1.6875 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAACC 10 0.006830828 145.0 7 >>END_MODULE SRR8450142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.108 37.0 37.0 37.0 37.0 37.0 2 35.7075 37.0 37.0 37.0 37.0 37.0 3 35.849 37.0 37.0 37.0 37.0 37.0 4 35.8235 37.0 37.0 37.0 37.0 37.0 5 35.6835 37.0 37.0 37.0 37.0 37.0 6 35.631 37.0 37.0 37.0 37.0 37.0 7 35.748 37.0 37.0 37.0 37.0 37.0 8 35.717 37.0 37.0 37.0 37.0 37.0 9 35.6275 37.0 37.0 37.0 37.0 37.0 10-14 35.5294 37.0 37.0 37.0 37.0 37.0 15-19 35.471399999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.4688 37.0 37.0 37.0 37.0 37.0 25-29 35.3046 37.0 37.0 37.0 37.0 37.0 30-34 35.359300000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.3934 37.0 37.0 37.0 37.0 37.0 40-44 35.26460000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.2273 37.0 37.0 37.0 37.0 37.0 50-54 35.2011 37.0 37.0 37.0 37.0 37.0 55-59 35.205799999999996 37.0 37.0 37.0 34.6 37.0 60-64 35.21959999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.161699999999996 37.0 37.0 37.0 34.6 37.0 70-74 35.159200000000006 37.0 37.0 37.0 32.2 37.0 75-79 35.113800000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.0764 37.0 37.0 37.0 34.6 37.0 85-89 34.9349 37.0 37.0 37.0 25.0 37.0 90-94 35.004200000000004 37.0 37.0 37.0 27.4 37.0 95-99 34.9032 37.0 37.0 37.0 25.0 37.0 100-104 34.990700000000004 37.0 37.0 37.0 25.0 37.0 105-109 35.0161 37.0 37.0 37.0 27.4 37.0 110-114 34.9781 37.0 37.0 37.0 25.0 37.0 115-119 34.8692 37.0 37.0 37.0 25.0 37.0 120-124 34.874700000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.8697 37.0 37.0 37.0 25.0 37.0 130-134 34.7713 37.0 37.0 37.0 25.0 37.0 135-139 34.744 37.0 37.0 37.0 25.0 37.0 140-144 34.48009999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.6571 37.0 37.0 37.0 25.0 37.0 150-151 33.7285 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 10.0 14 21.0 15 21.0 16 9.0 17 15.0 18 9.0 19 10.0 20 12.0 21 13.0 22 16.0 23 24.0 24 20.0 25 16.0 26 12.0 27 17.0 28 27.0 29 22.0 30 32.0 31 41.0 32 74.0 33 131.0 34 215.0 35 535.0 36 2478.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.949999999999996 17.724999999999998 10.325 31.0 2 34.1 22.125 21.6 22.175 3 26.900000000000002 25.4 23.724999999999998 23.974999999999998 4 29.325000000000003 28.449999999999996 17.775 24.45 5 30.95 28.799999999999997 17.474999999999998 22.775000000000002 6 25.924999999999997 33.875 18.325 21.875 7 25.424999999999997 20.275000000000002 29.225 25.074999999999996 8 28.825 22.225 20.125 28.825 9 25.775 23.3 23.849999999999998 27.075 10-14 27.994999999999997 24.965 20.91 26.13 15-19 27.63 24.15 22.189999999999998 26.029999999999998 20-24 26.340000000000003 25.06 22.24 26.36 25-29 27.505000000000003 25.365 21.185000000000002 25.945 30-34 25.995 25.869999999999997 21.86 26.275 35-39 26.334999999999997 25.3 22.015 26.35 40-44 26.889999999999997 25.305 21.595 26.21 45-49 26.905 25.419999999999998 21.675 26.0 50-54 26.540000000000003 25.424999999999997 22.13 25.905 55-59 27.034999999999997 25.195 21.955 25.814999999999998 60-64 26.605 25.025 22.045 26.325 65-69 27.155 25.119999999999997 21.845 25.88 70-74 28.04 24.965 21.125 25.869999999999997 75-79 26.655 24.845 22.400000000000002 26.1 80-84 26.705000000000002 25.569999999999997 21.92 25.805 85-89 27.58 24.87 21.36 26.19 90-94 27.284999999999997 25.105 22.305 25.305 95-99 26.945000000000004 25.305 22.345000000000002 25.405 100-104 27.555000000000003 24.825 21.834999999999997 25.785000000000004 105-109 26.25 25.5 22.43 25.82 110-114 27.325 25.45 22.035 25.19 115-119 27.955000000000002 25.165 21.48 25.4 120-124 27.065 25.64 21.78 25.515 125-129 26.715 26.14 21.925 25.22 130-134 27.37 25.040000000000003 21.990000000000002 25.6 135-139 26.765 25.3 22.42 25.515 140-144 27.3 25.745 22.18 24.775 145-149 27.855 25.629999999999995 21.7 24.815 150-151 27.0625 25.4875 21.712500000000002 25.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 2.0 7 2.0 8 1.5 9 1.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 2.5 17 2.0 18 1.0 19 2.5 20 3.5 21 4.0 22 3.5 23 2.5 24 1.5 25 1.5 26 3.0 27 6.0 28 7.0 29 4.0 30 5.5 31 11.0 32 11.5 33 13.0 34 16.0 35 20.5 36 28.5 37 37.5 38 52.0 39 71.5 40 78.5 41 106.0 42 126.0 43 122.0 44 144.0 45 157.5 46 146.0 47 135.5 48 143.5 49 142.5 50 139.0 51 131.5 52 115.5 53 113.0 54 118.0 55 116.5 56 113.0 57 115.5 58 98.5 59 83.5 60 91.0 61 88.0 62 82.0 63 87.0 64 82.0 65 74.5 66 71.5 67 72.0 68 73.0 69 79.5 70 85.5 71 73.0 72 56.5 73 47.0 74 40.0 75 33.0 76 22.5 77 14.0 78 10.0 79 9.5 80 8.0 81 3.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.5 87 0.5 88 1.5 89 2.5 90 2.5 91 1.5 92 0.5 93 1.0 94 1.0 95 0.5 96 1.0 97 1.0 98 2.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7251507998951 91.25 2 3.9601363755573042 7.55 3 0.23603461841070023 0.675 4 0.05245213742460005 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026226068712300026 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.4874999999999998 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.7625000000000002 0.0 0.0 0.0 0.0 138-139 1.9874999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638258 spots for SRR8450142.sra Written 1638258 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra Read 1638255 spots for SRR8450142.sra Written 1638255 spots for SRR8450142.sra SRR ids: ['SRR8450142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hb4u677d SRR8450142.sra spots: 32765103 blocks: [[1, 1638255], [1638256, 3276510], [3276511, 4914765], [4914766, 6553020], [6553021, 8191275], [8191276, 9829530], [9829531, 11467785], [11467786, 13106040], [13106041, 14744295], [14744296, 16382550], [16382551, 18020805], [18020806, 19659060], [19659061, 21297315], [21297316, 22935570], [22935571, 24573825], [24573826, 26212080], [26212081, 27850335], [27850336, 29488590], [29488591, 31126845], [31126846, 32765103]] SRR8450142 file size 11081317 SRR8450142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450142 SRR8450142_1.fastq SRR8450142_2.fastq Input file: SRR8450142_1.fastq Paired file: SRR8450142_2.fastq trimmed: SRR8450142-trimmed-pair1.fastq, SRR8450142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:52:04 2024 >> started Fri Dec 6 09:52:46 2024 >> done (41.606s) 32765103 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 16910 ( 0.05%) empty read pairs filtered out after trimming by size control 32748148 (99.95%) read pairs available; of these: 1033652 ( 3.16%) trimmed read pairs available after processing 31714496 (96.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 6 0.00% 21 6 0.00% 22 8 0.00% 23 8 0.00% 24 4 0.00% 25 9 0.00% 26 12 0.00% 27 14 0.00% 28 16 0.00% 29 10 0.00% 30 17 0.00% 31 11 0.00% 32 24 0.00% 33 15 0.00% 34 15 0.00% 35 21 0.00% 36 21 0.00% 37 18 0.00% 38 33 0.00% 39 17 0.00% 40 26 0.00% 41 30 0.00% 42 21 0.00% 43 25 0.00% 44 26 0.00% 45 32 0.00% 46 35 0.00% 47 28 0.00% 48 23 0.00% 49 23 0.00% 50 33 0.00% 51 35 0.00% 52 48 0.00% 53 34 0.00% 54 46 0.00% 55 38 0.00% 56 44 0.00% 57 47 0.00% 58 53 0.00% 59 53 0.00% 60 57 0.00% 61 89 0.00% 62 93 0.00% 63 69 0.00% 64 79 0.00% 65 99 0.00% 66 105 0.00% 67 118 0.00% 68 128 0.00% 69 118 0.00% 70 148 0.00% 71 169 0.00% 72 172 0.00% 73 224 0.00% 74 222 0.00% 75 270 0.00% 76 318 0.00% 77 362 0.00% 78 407 0.00% 79 461 0.00% 80 491 0.00% 81 570 0.00% 82 671 0.00% 83 734 0.00% 84 870 0.00% 85 938 0.00% 86 1009 0.00% 87 1180 0.00% 88 1227 0.00% 89 1397 0.00% 90 1511 0.00% 91 1696 0.01% 92 1977 0.01% 93 2130 0.01% 94 2394 0.01% 95 2618 0.01% 96 2885 0.01% 97 3134 0.01% 98 3392 0.01% 99 3476 0.01% 100 3918 0.01% 101 4248 0.01% 102 4483 0.01% 103 4932 0.02% 104 5233 0.02% 105 5712 0.02% 106 6191 0.02% 107 6538 0.02% 108 6873 0.02% 109 7372 0.02% 110 7701 0.02% 111 8271 0.03% 112 8630 0.03% 113 9424 0.03% 114 9991 0.03% 115 10666 0.03% 116 11344 0.03% 117 11794 0.04% 118 12428 0.04% 119 12796 0.04% 120 13460 0.04% 121 14319 0.04% 122 14938 0.05% 123 15865 0.05% 124 16837 0.05% 125 17810 0.05% 126 18086 0.06% 127 19040 0.06% 128 19667 0.06% 129 20552 0.06% 130 21335 0.07% 131 22343 0.07% 132 22966 0.07% 133 24184 0.07% 134 24906 0.08% 135 26106 0.08% 136 27074 0.08% 137 27970 0.09% 138 29281 0.09% 139 30048 0.09% 140 31266 0.10% 141 32284 0.10% 142 33452 0.10% 143 34189 0.10% 144 36130 0.11% 145 37089 0.11% 146 38431 0.12% 147 39420 0.12% 148 41080 0.13% 149 42551 0.13% 150 43413 0.13% 151 31714496 96.84% 32748148 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=15 prefix-density=0.74 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=34.45 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=18 prefix-density=0.46 prefix-fanout=3.0 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=90.97 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=13.0 sequence=CCGCCGCCGCCG SRR8450142 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:55:52 Started mapping on | Dec 06 09:55:52 Finished on | Dec 06 09:59:45 Mapping speed, Million of reads per hour | 505.98 Number of input reads | 32748148 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30227792 Uniquely mapped reads % | 92.30% Average mapped length | 299.66 Number of splices: Total | 32767824 Number of splices: Annotated (sjdb) | 30766205 Number of splices: GT/AG | 32325885 Number of splices: GC/AG | 379947 Number of splices: AT/AC | 13402 Number of splices: Non-canonical | 48590 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 3.01 Insertion rate per base | 0.01% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397324 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 41094 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.48% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2123032 2123032 2123032 N_multimapping 397324 397324 397324 N_noFeature 967288 29349076 1215319 N_ambiguous 779605 4863 151624 UnstrandedReadsAssigned:28480899 PositiveStrandReadsAssigned:873853 NegativeStrandReadsAssigned:28860849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450142-trimmed-pair1.fastq SRR8450142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,748,148 reads, 29,838,441 reads pseudoaligned [quant] estimated average fragment length: 313.884 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR8450142.ke.tsv 35125 SRR8450142.se.tsv 88098 total ==> SRR8450142.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 623.841 0 0 PNS24247 1044 731.116 80.8095 4.90453 PNS24249 1928 1615.12 197.556 5.42759 PNS24246 1044 731.116 80.8095 4.90453 PNS24248 1044 731.116 80.8095 4.90453 PNS24244 1471 1158.12 73.0158 2.7976 PNS24243 293 75.0859 0 0 KQK14069 1603 1290.12 9853.15 338.897 KQK14071 474 197.907 104.499 23.43 ==> SRR8450142.se.tsv <== BRADI_1g14170v3 10089 BRADI_1g53295v3 516 BRADI_1g59795v3 342 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 513 BRADI_1g74790v3 216 BRADI_1g09890v3 0 BRADI_1g77505v3 529 BRADI_1g48960v3 0 SRR8450142 completed mapping pipeline successfully