Starting /dee2/code/volunteer_pipeline.sh SRR8450143 current disk space = 1551825641472 free memory = 1599132536 SRR8450143 SRAfilesize 1885191097ff6aac8ce738249075374c SRR8450143.sra SRR8450143.sra file validated SRR8450143 is paired end SRR8450143 is conventional basespace SRR8450143 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20575 37.0 37.0 37.0 37.0 37.0 2 36.246 37.0 37.0 37.0 37.0 37.0 3 36.3415 37.0 37.0 37.0 37.0 37.0 4 36.4595 37.0 37.0 37.0 37.0 37.0 5 36.362 37.0 37.0 37.0 37.0 37.0 6 36.513 37.0 37.0 37.0 37.0 37.0 7 36.3415 37.0 37.0 37.0 37.0 37.0 8 36.4825 37.0 37.0 37.0 37.0 37.0 9 36.418 37.0 37.0 37.0 37.0 37.0 10-14 36.4682 37.0 37.0 37.0 37.0 37.0 15-19 36.3534 37.0 37.0 37.0 37.0 37.0 20-24 36.4187 37.0 37.0 37.0 37.0 37.0 25-29 36.28779999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3218 37.0 37.0 37.0 37.0 37.0 35-39 36.2651 37.0 37.0 37.0 37.0 37.0 40-44 36.3151 37.0 37.0 37.0 37.0 37.0 45-49 36.2221 37.0 37.0 37.0 37.0 37.0 50-54 36.187000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2018 37.0 37.0 37.0 37.0 37.0 60-64 36.129999999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0258 37.0 37.0 37.0 37.0 37.0 70-74 36.1194 37.0 37.0 37.0 37.0 37.0 75-79 36.146 37.0 37.0 37.0 37.0 37.0 80-84 36.1529 37.0 37.0 37.0 37.0 37.0 85-89 36.096199999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1088 37.0 37.0 37.0 37.0 37.0 95-99 36.036500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.006299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9786 37.0 37.0 37.0 37.0 37.0 110-114 35.897800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.956900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.762100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.763600000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.7374 37.0 37.0 37.0 37.0 37.0 135-139 35.7084 37.0 37.0 37.0 37.0 37.0 140-144 35.761 37.0 37.0 37.0 37.0 37.0 145-149 35.6436 37.0 37.0 37.0 37.0 37.0 150-151 35.1085 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 4.0 25 6.0 26 5.0 27 15.0 28 22.0 29 30.0 30 31.0 31 52.0 32 69.0 33 87.0 34 151.0 35 356.0 36 2756.0 37 413.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.91162440371579 13.206126035651518 9.26437358774793 33.61787597288476 2 26.28814407203602 14.48224112056028 29.114557278639317 30.115057528764382 3 22.3 20.3 24.025 33.375 4 25.8 25.924999999999997 21.425 26.85 5 26.625 27.900000000000002 23.05 22.425 6 24.975 30.275000000000002 23.5 21.25 7 18.099999999999998 21.7 39.300000000000004 20.9 8 22.625 23.150000000000002 27.025 27.200000000000003 9 22.6 21.65 29.299999999999997 26.450000000000003 10-14 23.665 25.365 24.545 26.424999999999997 15-19 23.849999999999998 24.525 25.569999999999997 26.055 20-24 23.935000000000002 24.82 25.275 25.97 25-29 24.33 24.21 25.224999999999998 26.235000000000003 30-34 24.279999999999998 24.595 25.31 25.814999999999998 35-39 24.215 24.615000000000002 24.654999999999998 26.515 40-44 24.154999999999998 24.295 25.415 26.135 45-49 23.995 24.46 25.28 26.265 50-54 24.310000000000002 23.82 24.755 27.115000000000002 55-59 24.62 24.125 24.825 26.43 60-64 24.565 24.865000000000002 23.78 26.790000000000003 65-69 24.04 24.46 24.57 26.93 70-74 24.555 24.345 24.834999999999997 26.265 75-79 24.79 23.815 24.52 26.875 80-84 25.41 24.385 23.630000000000003 26.575 85-89 25.1 24.675 24.015 26.21 90-94 24.625 24.41 24.560000000000002 26.405 95-99 24.654999999999998 24.32 24.47 26.555 100-104 24.68 24.07 24.005000000000003 27.245 105-109 25.135 23.615 24.715 26.534999999999997 110-114 25.685000000000002 24.285 23.685000000000002 26.345000000000002 115-119 25.255 24.060000000000002 23.794999999999998 26.889999999999997 120-124 25.6 23.75 24.05 26.6 125-129 25.590000000000003 23.93 24.335 26.145000000000003 130-134 24.765 23.69 24.435000000000002 27.11 135-139 24.959999999999997 23.830000000000002 23.849999999999998 27.36 140-144 26.045 23.474999999999998 24.104999999999997 26.375 145-149 25.635 24.11 24.060000000000002 26.195 150-151 25.25 24.087500000000002 24.025 26.637499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 4.0 29 7.5 30 7.5 31 11.0 32 15.5 33 23.5 34 29.5 35 28.0 36 33.5 37 53.0 38 70.0 39 86.0 40 113.0 41 125.0 42 143.5 43 166.0 44 176.5 45 174.0 46 163.0 47 173.0 48 175.0 49 173.0 50 158.0 51 144.5 52 142.0 53 117.0 54 106.5 55 98.0 56 88.5 57 93.5 58 88.0 59 85.0 60 79.0 61 68.5 62 66.5 63 65.5 64 67.5 65 77.0 66 83.0 67 67.5 68 52.0 69 46.5 70 39.5 71 41.0 72 41.5 73 29.5 74 24.5 75 26.5 76 17.5 77 8.0 78 6.0 79 5.0 80 4.0 81 1.5 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.72987288135593 89.425 2 4.766949152542373 9.0 3 0.3707627118644068 1.05 4 0.1059322033898305 0.4 5 0.026483050847457626 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5375 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTACCA 10 0.006830828 145.0 2 >>END_MODULE SRR8450143 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.802 37.0 37.0 37.0 37.0 37.0 2 35.165 37.0 37.0 37.0 37.0 37.0 3 34.9745 37.0 37.0 37.0 25.0 37.0 4 35.1895 37.0 37.0 37.0 37.0 37.0 5 34.9665 37.0 37.0 37.0 25.0 37.0 6 34.872 37.0 37.0 37.0 25.0 37.0 7 34.8605 37.0 37.0 37.0 25.0 37.0 8 34.908 37.0 37.0 37.0 25.0 37.0 9 34.8775 37.0 37.0 37.0 25.0 37.0 10-14 34.7363 37.0 37.0 37.0 25.0 37.0 15-19 34.6572 37.0 37.0 37.0 25.0 37.0 20-24 34.63420000000001 37.0 37.0 37.0 25.0 37.0 25-29 34.487 37.0 37.0 37.0 25.0 37.0 30-34 34.401500000000006 37.0 37.0 37.0 25.0 37.0 35-39 34.3997 37.0 37.0 37.0 25.0 37.0 40-44 34.326699999999995 37.0 37.0 37.0 25.0 37.0 45-49 34.3469 37.0 37.0 37.0 25.0 37.0 50-54 34.1872 37.0 37.0 37.0 25.0 37.0 55-59 34.2385 37.0 37.0 37.0 25.0 37.0 60-64 34.2017 37.0 37.0 37.0 25.0 37.0 65-69 34.2506 37.0 37.0 37.0 25.0 37.0 70-74 34.143 37.0 37.0 37.0 25.0 37.0 75-79 34.1407 37.0 37.0 37.0 25.0 37.0 80-84 34.2117 37.0 37.0 37.0 25.0 37.0 85-89 34.068999999999996 37.0 37.0 37.0 25.0 37.0 90-94 34.0322 37.0 37.0 37.0 25.0 37.0 95-99 34.0364 37.0 37.0 37.0 25.0 37.0 100-104 34.0597 37.0 37.0 37.0 25.0 37.0 105-109 34.076299999999996 37.0 37.0 37.0 25.0 37.0 110-114 34.0052 37.0 37.0 37.0 25.0 37.0 115-119 33.959199999999996 37.0 37.0 37.0 25.0 37.0 120-124 33.952299999999994 37.0 37.0 37.0 25.0 37.0 125-129 33.8382 37.0 37.0 37.0 25.0 37.0 130-134 33.7443 37.0 37.0 37.0 25.0 37.0 135-139 33.7645 37.0 37.0 37.0 25.0 37.0 140-144 33.5412 37.0 37.0 37.0 22.2 37.0 145-149 33.439800000000005 37.0 37.0 37.0 16.6 37.0 150-151 32.925 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 25.0 14 29.0 15 27.0 16 21.0 17 29.0 18 20.0 19 13.0 20 24.0 21 47.0 22 47.0 23 54.0 24 38.0 25 31.0 26 28.0 27 27.0 28 28.0 29 29.0 30 42.0 31 50.0 32 72.0 33 110.0 34 225.0 35 487.0 36 2280.0 37 214.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.675000000000004 17.65 10.625 29.049999999999997 2 36.85 19.55 22.175 21.425 3 28.799999999999997 22.8 25.2 23.200000000000003 4 31.2 28.65 17.05 23.1 5 32.475 29.099999999999998 18.099999999999998 20.325 6 28.65 32.175 17.275 21.9 7 28.050000000000004 18.2 29.599999999999998 24.15 8 27.900000000000002 21.85 20.025000000000002 30.225 9 27.800000000000004 22.725 23.724999999999998 25.75 10-14 29.565 24.89 20.150000000000002 25.395 15-19 28.99 25.455 21.14 24.415 20-24 27.97 25.745 20.875 25.41 25-29 28.194999999999997 25.569999999999997 20.64 25.595000000000002 30-34 27.339999999999996 26.215 21.205 25.240000000000002 35-39 27.055 25.83 21.59 25.525 40-44 27.255000000000003 26.21 21.37 25.165 45-49 26.66 26.375 21.135 25.83 50-54 27.200000000000003 26.745 21.195 24.86 55-59 27.515 26.590000000000003 20.805 25.09 60-64 26.735 26.215 21.705 25.345000000000002 65-69 27.415 26.045 21.475 25.064999999999998 70-74 27.295 26.21 21.065 25.430000000000003 75-79 27.18 26.340000000000003 21.005 25.474999999999998 80-84 26.889999999999997 26.450000000000003 21.435000000000002 25.224999999999998 85-89 27.005000000000003 26.655 21.205 25.135 90-94 26.58 27.284999999999997 21.060000000000002 25.074999999999996 95-99 26.57 26.669999999999998 21.9 24.86 100-104 27.38 26.369999999999997 21.584999999999997 24.665 105-109 26.424999999999997 26.56 22.07 24.945 110-114 27.134999999999998 26.33 21.279999999999998 25.255 115-119 27.115000000000002 26.76 21.52 24.605 120-124 27.025 27.029999999999998 21.515 24.43 125-129 26.965 26.865 21.685 24.485 130-134 27.639999999999997 26.97 20.945 24.445 135-139 27.095000000000002 26.97 21.61 24.325 140-144 26.924999999999997 27.415 21.535 24.125 145-149 27.41 27.305 21.455 23.830000000000002 150-151 27.537499999999998 26.5625 21.975 23.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 2.5 7 4.5 8 2.5 9 2.0 10 3.5 11 2.0 12 4.0 13 6.5 14 5.5 15 4.0 16 4.0 17 5.0 18 4.5 19 3.5 20 3.5 21 3.5 22 2.0 23 2.5 24 6.5 25 9.0 26 11.0 27 9.5 28 7.0 29 6.5 30 8.0 31 10.5 32 10.5 33 14.0 34 19.5 35 26.0 36 37.0 37 44.5 38 44.5 39 61.5 40 88.0 41 104.5 42 112.0 43 126.0 44 137.0 45 142.0 46 146.0 47 141.5 48 143.0 49 136.5 50 131.5 51 128.0 52 119.5 53 120.5 54 112.5 55 106.0 56 91.5 57 85.5 58 90.0 59 87.0 60 97.0 61 96.5 62 85.0 63 89.5 64 90.5 65 80.5 66 80.5 67 73.5 68 67.0 69 63.5 70 61.5 71 61.0 72 52.0 73 42.0 74 37.5 75 29.5 76 23.0 77 19.5 78 14.5 79 10.0 80 5.5 81 5.0 82 4.0 83 3.5 84 2.5 85 2.0 86 1.5 87 1.0 88 3.5 89 2.5 90 0.5 91 1.5 92 2.5 93 2.0 94 0.5 95 0.5 96 1.5 97 3.0 98 4.0 99 7.0 100 17.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.13038850452368 89.375 2 4.443853113358169 8.35 3 0.3459286854709952 0.975 4 0.05321979776476849 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026609898882384245 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 44 1.0999999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.575 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTGA 10 0.006830828 145.0 6 >>END_MODULE Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713656 spots for SRR8450143.sra Written 1713656 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra Read 1713638 spots for SRR8450143.sra Written 1713638 spots for SRR8450143.sra SRR ids: ['SRR8450143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3qig1v22 SRR8450143.sra spots: 34272778 blocks: [[1, 1713638], [1713639, 3427276], [3427277, 5140914], [5140915, 6854552], [6854553, 8568190], [8568191, 10281828], [10281829, 11995466], [11995467, 13709104], [13709105, 15422742], [15422743, 17136380], [17136381, 18850018], [18850019, 20563656], [20563657, 22277294], [22277295, 23990932], [23990933, 25704570], [25704571, 27418208], [27418209, 29131846], [29131847, 30845484], [30845485, 32559122], [32559123, 34272778]] SRR8450143 file size 11592219 SRR8450143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450143 SRR8450143_1.fastq SRR8450143_2.fastq Input file: SRR8450143_1.fastq Paired file: SRR8450143_2.fastq trimmed: SRR8450143-trimmed-pair1.fastq, SRR8450143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:09:13 2024 >> started Fri Dec 6 10:09:55 2024 >> done (41.238s) 34272778 read pairs processed; of these: 67 ( 0.00%) short read pairs filtered out after trimming by size control 23044 ( 0.07%) empty read pairs filtered out after trimming by size control 34249667 (99.93%) read pairs available; of these: 1299769 ( 3.79%) trimmed read pairs available after processing 32949898 (96.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 12 0.00% 21 8 0.00% 22 9 0.00% 23 9 0.00% 24 12 0.00% 25 9 0.00% 26 17 0.00% 27 7 0.00% 28 7 0.00% 29 9 0.00% 30 29 0.00% 31 20 0.00% 32 21 0.00% 33 20 0.00% 34 19 0.00% 35 19 0.00% 36 16 0.00% 37 20 0.00% 38 22 0.00% 39 24 0.00% 40 24 0.00% 41 20 0.00% 42 31 0.00% 43 28 0.00% 44 34 0.00% 45 31 0.00% 46 39 0.00% 47 27 0.00% 48 32 0.00% 49 44 0.00% 50 46 0.00% 51 47 0.00% 52 50 0.00% 53 47 0.00% 54 45 0.00% 55 54 0.00% 56 54 0.00% 57 70 0.00% 58 66 0.00% 59 68 0.00% 60 77 0.00% 61 77 0.00% 62 90 0.00% 63 100 0.00% 64 122 0.00% 65 131 0.00% 66 143 0.00% 67 170 0.00% 68 164 0.00% 69 176 0.00% 70 202 0.00% 71 244 0.00% 72 282 0.00% 73 331 0.00% 74 334 0.00% 75 366 0.00% 76 393 0.00% 77 480 0.00% 78 493 0.00% 79 591 0.00% 80 682 0.00% 81 785 0.00% 82 832 0.00% 83 989 0.00% 84 1097 0.00% 85 1217 0.00% 86 1283 0.00% 87 1454 0.00% 88 1600 0.00% 89 1833 0.01% 90 2022 0.01% 91 2250 0.01% 92 2642 0.01% 93 2780 0.01% 94 3174 0.01% 95 3473 0.01% 96 3672 0.01% 97 3974 0.01% 98 4186 0.01% 99 4590 0.01% 100 4934 0.01% 101 5367 0.02% 102 5846 0.02% 103 6686 0.02% 104 7083 0.02% 105 7578 0.02% 106 8285 0.02% 107 8584 0.03% 108 8800 0.03% 109 9343 0.03% 110 9769 0.03% 111 10554 0.03% 112 11632 0.03% 113 12299 0.04% 114 13300 0.04% 115 14187 0.04% 116 14624 0.04% 117 15049 0.04% 118 15713 0.05% 119 16155 0.05% 120 16901 0.05% 121 17829 0.05% 122 18841 0.06% 123 19962 0.06% 124 21446 0.06% 125 22849 0.07% 126 23554 0.07% 127 24318 0.07% 128 24593 0.07% 129 25298 0.07% 130 26032 0.08% 131 27214 0.08% 132 28805 0.08% 133 30618 0.09% 134 31933 0.09% 135 33338 0.10% 136 34481 0.10% 137 35468 0.10% 138 36037 0.11% 139 37261 0.11% 140 38139 0.11% 141 39368 0.11% 142 41438 0.12% 143 42880 0.13% 144 44887 0.13% 145 46890 0.14% 146 48723 0.14% 147 49960 0.15% 148 50751 0.15% 149 51156 0.15% 150 52333 0.15% 151 32949898 96.21% 34249667 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.19 sequence-density-rank=13 fanout-score=16.86 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=16.9 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCTCGTATGCCGTCTTCTGCTTGA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=22 prefix-density=0.81 prefix-fanout=1.7 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=22 fanout-score=70.31 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=10.5 sequence=CCGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR8450143 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:10:53 Started mapping on | Dec 06 10:10:53 Finished on | Dec 06 10:16:41 Mapping speed, Million of reads per hour | 354.31 Number of input reads | 34249667 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 29841982 Uniquely mapped reads % | 87.13% Average mapped length | 299.14 Number of splices: Total | 31246443 Number of splices: Annotated (sjdb) | 29341180 Number of splices: GT/AG | 30820643 Number of splices: GC/AG | 367548 Number of splices: AT/AC | 13405 Number of splices: Non-canonical | 44847 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.81 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385485 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 38101 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.75% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4022200 4022200 4022200 N_multimapping 385485 385485 385485 N_noFeature 921054 28952912 1147888 N_ambiguous 805994 4575 145353 UnstrandedReadsAssigned:28114934 PositiveStrandReadsAssigned:884495 NegativeStrandReadsAssigned:28548741 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450143-trimmed-pair1.fastq SRR8450143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,249,667 reads, 30,533,614 reads pseudoaligned [quant] estimated average fragment length: 305.667 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR8450143.ke.tsv 35125 SRR8450143.se.tsv 88098 total ==> SRR8450143.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 632.089 4.36703e-08 2.89736e-09 PNS24247 1044 739.333 65.1679 3.69647 PNS24249 1928 1623.33 204.27 5.27704 PNS24246 1044 739.333 65.1679 3.69647 PNS24248 1044 739.333 65.1679 3.69647 PNS24244 1471 1166.33 143.226 5.14984 PNS24243 293 78.6982 0 0 KQK14069 1603 1298.33 8966.88 289.634 KQK14071 474 204.416 104.228 21.3828 ==> SRR8450143.se.tsv <== BRADI_1g14170v3 8889 BRADI_1g53295v3 232 BRADI_1g59795v3 427 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 366 BRADI_1g74790v3 133 BRADI_1g09890v3 0 BRADI_1g77505v3 468 BRADI_1g48960v3 0 SRR8450143 completed mapping pipeline successfully