Starting /dee2/code/volunteer_pipeline.sh SRR8450144 current disk space = 1552030560256 free memory = 1605182772 SRR8450144 SRAfilesize 9cd70714455f870410f99efd208a4cd9 SRR8450144.sra SRR8450144.sra file validated SRR8450144 is paired end SRR8450144 is conventional basespace SRR8450144 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1605 37.0 37.0 37.0 37.0 37.0 2 36.37 37.0 37.0 37.0 37.0 37.0 3 36.3975 37.0 37.0 37.0 37.0 37.0 4 36.384 37.0 37.0 37.0 37.0 37.0 5 36.487 37.0 37.0 37.0 37.0 37.0 6 36.488 37.0 37.0 37.0 37.0 37.0 7 36.3295 37.0 37.0 37.0 37.0 37.0 8 36.3795 37.0 37.0 37.0 37.0 37.0 9 36.371 37.0 37.0 37.0 37.0 37.0 10-14 36.427800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.3876 37.0 37.0 37.0 37.0 37.0 20-24 36.4057 37.0 37.0 37.0 37.0 37.0 25-29 36.3471 37.0 37.0 37.0 37.0 37.0 30-34 36.338499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.295100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.291999999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.281499999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.2787 37.0 37.0 37.0 37.0 37.0 55-59 36.2528 37.0 37.0 37.0 37.0 37.0 60-64 36.1931 37.0 37.0 37.0 37.0 37.0 65-69 36.1297 37.0 37.0 37.0 37.0 37.0 70-74 36.2204 37.0 37.0 37.0 37.0 37.0 75-79 36.195299999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.189800000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.194199999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.169500000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.1178 37.0 37.0 37.0 37.0 37.0 100-104 36.0477 37.0 37.0 37.0 37.0 37.0 105-109 36.0387 37.0 37.0 37.0 37.0 37.0 110-114 35.988099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.947700000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.903600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8842 37.0 37.0 37.0 37.0 37.0 130-134 35.7989 37.0 37.0 37.0 37.0 37.0 135-139 35.8091 37.0 37.0 37.0 37.0 37.0 140-144 35.773 37.0 37.0 37.0 37.0 37.0 145-149 35.77239999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.23075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 4.0 26 4.0 27 17.0 28 15.0 29 32.0 30 23.0 31 50.0 32 71.0 33 95.0 34 155.0 35 341.0 36 2692.0 37 499.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.153189352084375 12.004018081366148 9.090909090909092 33.75188347564038 2 27.275 13.075000000000001 27.85 31.8 3 24.175 17.45 22.8 35.575 4 27.525 22.900000000000002 20.4 29.175 5 27.775 26.775 22.05 23.400000000000002 6 25.95 29.325000000000003 22.175 22.55 7 20.025000000000002 23.150000000000002 36.525 20.3 8 23.75 22.825 26.900000000000002 26.525 9 22.3 21.25 29.25 27.200000000000003 10-14 24.240000000000002 24.705 24.79 26.265 15-19 24.945 24.11 24.62 26.325 20-24 24.23 24.265 25.085 26.419999999999998 25-29 24.490000000000002 23.875 24.765 26.87 30-34 24.985 24.135 24.645 26.235000000000003 35-39 24.965 24.165 24.67 26.200000000000003 40-44 25.324999999999996 23.549999999999997 24.36 26.765 45-49 24.67 24.224999999999998 24.54 26.565 50-54 25.055 23.91 23.805 27.229999999999997 55-59 25.56 23.674999999999997 23.745 27.02 60-64 25.845000000000002 23.919999999999998 23.75 26.484999999999996 65-69 24.845 23.595 24.15 27.41 70-74 24.88 23.185 24.32 27.615000000000002 75-79 24.93 23.415 24.685000000000002 26.97 80-84 25.995 23.26 23.880000000000003 26.865 85-89 25.665 23.325000000000003 23.335 27.675 90-94 25.46 23.31 24.21 27.02 95-99 25.435000000000002 23.255 24.14 27.169999999999998 100-104 26.125 23.54 23.595 26.740000000000002 105-109 26.395000000000003 23.205000000000002 23.34 27.060000000000002 110-114 25.665 23.455000000000002 23.75 27.13 115-119 25.94 23.5 23.49 27.07 120-124 25.715 22.455 24.065 27.765 125-129 25.569999999999997 22.869999999999997 23.715 27.845 130-134 26.669999999999998 23.015 23.265 27.05 135-139 25.064999999999998 23.47 24.03 27.435 140-144 26.064999999999998 22.835 23.669999999999998 27.43 145-149 26.534999999999997 23.27 23.02 27.175 150-151 26.674999999999997 22.900000000000002 23.025000000000002 27.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 2.5 30 6.0 31 7.0 32 5.5 33 13.5 34 21.0 35 25.0 36 40.0 37 53.0 38 64.5 39 84.5 40 93.5 41 115.0 42 134.0 43 131.0 44 133.5 45 147.0 46 161.5 47 167.0 48 161.5 49 148.5 50 143.0 51 140.0 52 145.0 53 145.0 54 123.0 55 111.5 56 118.0 57 108.0 58 94.5 59 94.5 60 102.0 61 97.0 62 85.0 63 76.5 64 69.5 65 78.5 66 80.5 67 70.0 68 58.5 69 55.0 70 55.5 71 47.5 72 38.0 73 30.5 74 25.5 75 24.0 76 21.0 77 15.5 78 10.0 79 5.5 80 4.0 81 4.0 82 2.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 94.36209634727369 89.125 2 5.426151402858656 10.25 3 0.18528321863419797 0.525 4 0.02646903123345686 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGGCT 10 0.006830828 145.0 1 >>END_MODULE SRR8450144 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450144_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9995 37.0 37.0 37.0 37.0 37.0 2 35.6035 37.0 37.0 37.0 37.0 37.0 3 35.688 37.0 37.0 37.0 37.0 37.0 4 35.685 37.0 37.0 37.0 37.0 37.0 5 35.634 37.0 37.0 37.0 37.0 37.0 6 35.651 37.0 37.0 37.0 37.0 37.0 7 35.555 37.0 37.0 37.0 37.0 37.0 8 35.6615 37.0 37.0 37.0 37.0 37.0 9 35.602 37.0 37.0 37.0 37.0 37.0 10-14 35.447799999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.418400000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.3097 37.0 37.0 37.0 37.0 37.0 25-29 35.276300000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.272600000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.2291 37.0 37.0 37.0 37.0 37.0 40-44 35.1674 37.0 37.0 37.0 37.0 37.0 45-49 35.112199999999994 37.0 37.0 37.0 32.2 37.0 50-54 35.0385 37.0 37.0 37.0 27.4 37.0 55-59 35.0705 37.0 37.0 37.0 32.2 37.0 60-64 35.0629 37.0 37.0 37.0 32.2 37.0 65-69 34.9971 37.0 37.0 37.0 27.4 37.0 70-74 34.9026 37.0 37.0 37.0 25.0 37.0 75-79 34.8966 37.0 37.0 37.0 27.4 37.0 80-84 34.900800000000004 37.0 37.0 37.0 25.0 37.0 85-89 34.825100000000006 37.0 37.0 37.0 25.0 37.0 90-94 34.760200000000005 37.0 37.0 37.0 25.0 37.0 95-99 34.7721 37.0 37.0 37.0 25.0 37.0 100-104 34.773900000000005 37.0 37.0 37.0 25.0 37.0 105-109 34.7888 37.0 37.0 37.0 25.0 37.0 110-114 34.7004 37.0 37.0 37.0 25.0 37.0 115-119 34.721199999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.61150000000001 37.0 37.0 37.0 25.0 37.0 125-129 34.5965 37.0 37.0 37.0 25.0 37.0 130-134 34.5029 37.0 37.0 37.0 25.0 37.0 135-139 34.508599999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.3369 37.0 37.0 37.0 25.0 37.0 145-149 34.313900000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.639250000000004 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 12.0 14 21.0 15 19.0 16 12.0 17 9.0 18 12.0 19 13.0 20 16.0 21 27.0 22 27.0 23 26.0 24 24.0 25 23.0 26 15.0 27 20.0 28 16.0 29 37.0 30 43.0 31 47.0 32 65.0 33 132.0 34 196.0 35 537.0 36 2404.0 37 247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8 17.05 11.15 30.0 2 34.525 21.0 21.099999999999998 23.375 3 27.525 23.7 24.85 23.925 4 30.175 26.575 18.65 24.6 5 32.35 28.075 16.85 22.725 6 27.625 31.924999999999997 17.65 22.8 7 26.950000000000003 19.25 29.825000000000003 23.974999999999998 8 28.999999999999996 22.325 20.225 28.449999999999996 9 26.700000000000003 22.650000000000002 23.75 26.900000000000002 10-14 28.43 25.085 20.369999999999997 26.115 15-19 27.575 25.305 20.995 26.125 20-24 28.17 24.72 21.565 25.545 25-29 27.515 24.89 21.14 26.455000000000002 30-34 27.474999999999998 25.480000000000004 21.02 26.025 35-39 27.765 25.509999999999998 20.57 26.155 40-44 27.860000000000003 25.35 21.085 25.705 45-49 27.900000000000002 24.75 21.18 26.169999999999998 50-54 28.515 24.884999999999998 21.060000000000002 25.540000000000003 55-59 28.32 24.485 21.11 26.085 60-64 27.85 24.985 21.105 26.06 65-69 27.46 24.905 21.490000000000002 26.145000000000003 70-74 27.985 24.55 21.555 25.91 75-79 27.115000000000002 25.03 21.245 26.61 80-84 28.235 25.014999999999997 20.745 26.005 85-89 27.805000000000003 25.28 21.18 25.735000000000003 90-94 27.900000000000002 24.759999999999998 21.95 25.39 95-99 27.639999999999997 24.72 21.59 26.05 100-104 27.915 25.074999999999996 21.125 25.885 105-109 26.99 25.635 21.77 25.605 110-114 27.689999999999998 24.955 21.52 25.835 115-119 27.305 25.245 21.335 26.115 120-124 27.67 25.6 21.69 25.040000000000003 125-129 27.634999999999998 25.430000000000003 21.385 25.55 130-134 27.894999999999996 25.47 21.224999999999998 25.41 135-139 27.52 26.205000000000002 21.775 24.5 140-144 27.87 25.52 21.59 25.019999999999996 145-149 27.855 25.405 21.65 25.09 150-151 27.474999999999998 24.7375 22.5 25.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 1.0 5 2.0 6 1.0 7 0.0 8 2.0 9 2.0 10 1.0 11 1.0 12 0.5 13 1.5 14 2.0 15 2.0 16 3.0 17 3.5 18 2.0 19 1.0 20 1.5 21 3.5 22 4.0 23 1.5 24 1.0 25 2.5 26 3.5 27 4.0 28 3.0 29 4.5 30 6.0 31 5.5 32 7.5 33 15.0 34 17.0 35 16.0 36 23.0 37 34.0 38 50.0 39 62.5 40 81.0 41 91.5 42 99.5 43 117.0 44 127.5 45 128.0 46 130.5 47 141.0 48 140.0 49 133.0 50 136.0 51 133.5 52 121.0 53 128.0 54 116.5 55 114.5 56 115.0 57 108.0 58 107.0 59 93.0 60 93.5 61 93.5 62 105.5 63 107.5 64 94.0 65 86.5 66 82.0 67 79.5 68 82.5 69 88.5 70 75.5 71 54.5 72 49.0 73 49.5 74 38.0 75 29.0 76 27.0 77 19.0 78 11.5 79 8.5 80 9.0 81 5.5 82 3.0 83 3.0 84 0.5 85 1.5 86 2.5 87 1.5 88 0.5 89 0.5 90 1.0 91 1.5 92 2.5 93 2.5 94 2.5 95 3.0 96 3.0 97 2.5 98 2.5 99 1.5 100 10.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.2822687516565 89.875 2 4.293665518155314 8.1 3 0.34455340577789556 0.975 4 0.05300821627352239 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026504108136761195 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 34 0.8500000000000001 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.6125 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.95 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGAA 10 0.006830828 145.0 9 GACGAAC 10 0.006830828 145.0 6 TTAATTA 10 0.006830828 145.0 6 >>END_MODULE Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279189 spots for SRR8450144.sra Written 1279189 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra Read 1279186 spots for SRR8450144.sra Written 1279186 spots for SRR8450144.sra SRR ids: ['SRR8450144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gvuvsgc3 SRR8450144.sra spots: 25583723 blocks: [[1, 1279186], [1279187, 2558372], [2558373, 3837558], [3837559, 5116744], [5116745, 6395930], [6395931, 7675116], [7675117, 8954302], [8954303, 10233488], [10233489, 11512674], [11512675, 12791860], [12791861, 14071046], [14071047, 15350232], [15350233, 16629418], [16629419, 17908604], [17908605, 19187790], [19187791, 20466976], [20466977, 21746162], [21746163, 23025348], [23025349, 24304534], [24304535, 25583723]] SRR8450144 file size 8647783 SRR8450144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450144 SRR8450144_1.fastq SRR8450144_2.fastq Input file: SRR8450144_1.fastq Paired file: SRR8450144_2.fastq trimmed: SRR8450144-trimmed-pair1.fastq, SRR8450144-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:58:45 2024 >> started Fri Dec 6 09:59:15 2024 >> done (29.873s) 25583723 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 12348 ( 0.05%) empty read pairs filtered out after trimming by size control 25571345 (99.95%) read pairs available; of these: 1234173 ( 4.83%) trimmed read pairs available after processing 24337172 (95.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 6 0.00% 23 3 0.00% 24 6 0.00% 25 11 0.00% 26 9 0.00% 27 7 0.00% 28 9 0.00% 29 12 0.00% 30 10 0.00% 31 15 0.00% 32 21 0.00% 33 10 0.00% 34 14 0.00% 35 13 0.00% 36 9 0.00% 37 12 0.00% 38 15 0.00% 39 18 0.00% 40 11 0.00% 41 11 0.00% 42 17 0.00% 43 10 0.00% 44 15 0.00% 45 18 0.00% 46 30 0.00% 47 31 0.00% 48 19 0.00% 49 33 0.00% 50 29 0.00% 51 29 0.00% 52 36 0.00% 53 45 0.00% 54 40 0.00% 55 41 0.00% 56 55 0.00% 57 39 0.00% 58 42 0.00% 59 58 0.00% 60 64 0.00% 61 69 0.00% 62 67 0.00% 63 67 0.00% 64 75 0.00% 65 93 0.00% 66 109 0.00% 67 105 0.00% 68 121 0.00% 69 125 0.00% 70 148 0.00% 71 164 0.00% 72 188 0.00% 73 213 0.00% 74 248 0.00% 75 279 0.00% 76 312 0.00% 77 330 0.00% 78 367 0.00% 79 453 0.00% 80 486 0.00% 81 597 0.00% 82 686 0.00% 83 750 0.00% 84 871 0.00% 85 1013 0.00% 86 1093 0.00% 87 1276 0.00% 88 1348 0.01% 89 1435 0.01% 90 1781 0.01% 91 1879 0.01% 92 2126 0.01% 93 2472 0.01% 94 2774 0.01% 95 2970 0.01% 96 3252 0.01% 97 3565 0.01% 98 3770 0.01% 99 4330 0.02% 100 4605 0.02% 101 4901 0.02% 102 5382 0.02% 103 5995 0.02% 104 6494 0.03% 105 6713 0.03% 106 7474 0.03% 107 7898 0.03% 108 8370 0.03% 109 8908 0.03% 110 9520 0.04% 111 10032 0.04% 112 10809 0.04% 113 11311 0.04% 114 12324 0.05% 115 13091 0.05% 116 13922 0.05% 117 14380 0.06% 118 15096 0.06% 119 15543 0.06% 120 16294 0.06% 121 17173 0.07% 122 18149 0.07% 123 19278 0.08% 124 20361 0.08% 125 21354 0.08% 126 22480 0.09% 127 23076 0.09% 128 24061 0.09% 129 24559 0.10% 130 25629 0.10% 131 27022 0.11% 132 27981 0.11% 133 29372 0.11% 134 30631 0.12% 135 31955 0.12% 136 33076 0.13% 137 33757 0.13% 138 34573 0.14% 139 36052 0.14% 140 36527 0.14% 141 37753 0.15% 142 39749 0.16% 143 40949 0.16% 144 42600 0.17% 145 44600 0.17% 146 45207 0.18% 147 46950 0.18% 148 47881 0.19% 149 49433 0.19% 150 50026 0.20% 151 24337172 95.17% 25571345 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=33 fanout-score=16.67 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=3.7 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.74 fanout-score-rank=36 prefix-density=0.45 prefix-fanout=1.5 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=90.08 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=2.2 sequence=CAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR8450144 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:00:03 Started mapping on | Dec 06 10:00:03 Finished on | Dec 06 10:04:32 Mapping speed, Million of reads per hour | 342.22 Number of input reads | 25571345 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 22362043 Uniquely mapped reads % | 87.45% Average mapped length | 298.95 Number of splices: Total | 22250704 Number of splices: Annotated (sjdb) | 20992770 Number of splices: GT/AG | 21952127 Number of splices: GC/AG | 259171 Number of splices: AT/AC | 7649 Number of splices: Non-canonical | 31757 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.79 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501456 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 74320 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.17% % of reads unmapped: other | 2.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2707846 2707846 2707846 N_multimapping 501456 501456 501456 N_noFeature 766569 21669008 935815 N_ambiguous 630877 2919 108378 UnstrandedReadsAssigned:20964597 PositiveStrandReadsAssigned:690116 NegativeStrandReadsAssigned:21317850 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450144 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450144-trimmed-pair1.fastq SRR8450144-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,571,345 reads, 22,322,641 reads pseudoaligned [quant] estimated average fragment length: 291.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR8450144.ke.tsv 35125 SRR8450144.se.tsv 88098 total ==> SRR8450144.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 645.697 67.2709 5.76403 PNS24247 1044 753.078 37.9757 2.78993 PNS24249 1928 1637.08 233.551 7.89299 PNS24246 1044 753.078 37.9757 2.78993 PNS24248 1044 753.078 37.9757 2.78993 PNS24244 1471 1180.08 38.2505 1.79331 PNS24243 293 81.5315 0 0 KQK14069 1603 1312.08 21658.8 913.276 KQK14071 474 211.483 212.423 55.5717 ==> SRR8450144.se.tsv <== BRADI_1g14170v3 21726 BRADI_1g53295v3 84 BRADI_1g59795v3 233 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 202 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 364 BRADI_1g48960v3 0 SRR8450144 completed mapping pipeline successfully