Starting /dee2/code/volunteer_pipeline.sh SRR8450145 current disk space = 1551809130496 free memory = 1602240764 SRR8450145 SRAfilesize 98411aac9b9227f9392b4f8d61716a68 SRR8450145.sra SRR8450145.sra file validated SRR8450145 is paired end SRR8450145 is conventional basespace SRR8450145 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450145_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.122 37.0 37.0 37.0 37.0 37.0 2 36.258 37.0 37.0 37.0 37.0 37.0 3 36.3125 37.0 37.0 37.0 37.0 37.0 4 36.4485 37.0 37.0 37.0 37.0 37.0 5 36.506 37.0 37.0 37.0 37.0 37.0 6 36.492 37.0 37.0 37.0 37.0 37.0 7 36.5055 37.0 37.0 37.0 37.0 37.0 8 36.4435 37.0 37.0 37.0 37.0 37.0 9 36.4095 37.0 37.0 37.0 37.0 37.0 10-14 36.4837 37.0 37.0 37.0 37.0 37.0 15-19 36.4447 37.0 37.0 37.0 37.0 37.0 20-24 36.429100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3106 37.0 37.0 37.0 37.0 37.0 30-34 36.348200000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3443 37.0 37.0 37.0 37.0 37.0 40-44 36.3218 37.0 37.0 37.0 37.0 37.0 45-49 36.2356 37.0 37.0 37.0 37.0 37.0 50-54 36.3147 37.0 37.0 37.0 37.0 37.0 55-59 36.2208 37.0 37.0 37.0 37.0 37.0 60-64 36.1726 37.0 37.0 37.0 37.0 37.0 65-69 35.9802 37.0 37.0 37.0 37.0 37.0 70-74 36.1458 37.0 37.0 37.0 37.0 37.0 75-79 36.247 37.0 37.0 37.0 37.0 37.0 80-84 36.251200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1719 37.0 37.0 37.0 37.0 37.0 90-94 36.1749 37.0 37.0 37.0 37.0 37.0 95-99 36.123599999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.043699999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.083 37.0 37.0 37.0 37.0 37.0 110-114 36.0175 37.0 37.0 37.0 37.0 37.0 115-119 36.035900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.96509999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.914 37.0 37.0 37.0 37.0 37.0 130-134 35.85809999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.859 37.0 37.0 37.0 37.0 37.0 140-144 35.8309 37.0 37.0 37.0 37.0 37.0 145-149 35.7725 37.0 37.0 37.0 37.0 37.0 150-151 35.187 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 3.0 26 3.0 27 7.0 28 17.0 29 22.0 30 39.0 31 47.0 32 64.0 33 87.0 34 150.0 35 355.0 36 2738.0 37 464.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.319116909182135 10.110386352232815 7.4761665830406425 34.094330155544405 2 26.738369184592298 14.48224112056028 29.48974487243622 29.289644822411205 3 24.0 16.825000000000003 23.375 35.8 4 26.224999999999998 23.674999999999997 21.5 28.599999999999998 5 29.725 27.450000000000003 21.925 20.9 6 24.2 29.7 23.5 22.6 7 19.125 23.7 35.975 21.2 8 22.875 23.65 28.125 25.35 9 22.425 21.224999999999998 32.375 23.974999999999998 10-14 24.595 25.115 24.310000000000002 25.979999999999997 15-19 24.33 24.555 24.925 26.19 20-24 24.54 24.21 25.14 26.11 25-29 24.21 24.495 24.775 26.52 30-34 24.279999999999998 24.605 24.175 26.939999999999998 35-39 24.065 24.365000000000002 25.1 26.47 40-44 24.19 24.37 25.330000000000002 26.11 45-49 24.425 23.825 24.91 26.840000000000003 50-54 25.09 24.07 24.45 26.39 55-59 24.515 24.285 24.89 26.31 60-64 24.955 23.400000000000002 25.61 26.035000000000004 65-69 25.074999999999996 25.009999999999998 23.575 26.340000000000003 70-74 25.590000000000003 24.2 24.295 25.915 75-79 25.755 23.95 23.515 26.779999999999998 80-84 26.224999999999998 23.565 24.125 26.085 85-89 25.965 23.695 24.41 25.929999999999996 90-94 26.105 23.549999999999997 23.77 26.575 95-99 26.25 23.325000000000003 23.625 26.8 100-104 26.43 23.21 23.905 26.455000000000002 105-109 25.485000000000003 22.965 24.474999999999998 27.075 110-114 26.515 23.465 24.04 25.979999999999997 115-119 26.05 23.52 24.185000000000002 26.245 120-124 26.015 23.244999999999997 23.669999999999998 27.07 125-129 25.88 22.68 24.545 26.895000000000003 130-134 26.169999999999998 23.665 23.565 26.6 135-139 25.39 22.97 23.62 28.02 140-144 25.874999999999996 23.29 24.005000000000003 26.83 145-149 25.69 22.285 24.685000000000002 27.339999999999996 150-151 25.887500000000003 23.724999999999998 23.3375 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 2.0 27 2.0 28 1.5 29 6.0 30 10.5 31 11.0 32 13.0 33 19.0 34 25.5 35 29.5 36 39.5 37 57.0 38 67.0 39 77.0 40 102.5 41 127.5 42 135.0 43 156.5 44 167.0 45 165.0 46 181.5 47 183.0 48 158.0 49 142.5 50 155.0 51 159.5 52 140.5 53 116.5 54 97.0 55 90.0 56 89.0 57 82.5 58 75.5 59 81.5 60 89.5 61 81.0 62 77.0 63 73.0 64 76.5 65 77.0 66 71.5 67 64.0 68 52.0 69 59.5 70 62.5 71 51.5 72 40.5 73 38.0 74 29.5 75 25.5 76 22.5 77 11.5 78 10.5 79 7.0 80 4.0 81 3.5 82 1.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0066401062417 89.425 2 4.51527224435591 8.5 3 0.37184594953519257 1.05 4 0.05312084993359894 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05312084993359894 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTCAGTTATCTCGTAT 23 0.575 TruSeq Adapter, Index 23 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTCAGTTATCGCGTAT 10 0.25 TruSeq Adapter, Index 23 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0125 116-117 0.5875 0.0 0.0 0.0 0.025 118-119 0.6375 0.0 0.0 0.0 0.025 120-121 0.6625000000000001 0.0 0.0 0.0 0.025 122-123 0.75 0.0 0.0 0.0 0.025 124-125 0.775 0.0 0.0 0.0 0.025 126-127 0.8125 0.0 0.0 0.0 0.025 128-129 1.0 0.0 0.0 0.0 0.025 130-131 1.2625000000000002 0.0 0.0 0.0 0.025 132-133 1.3624999999999998 0.0 0.0 0.0 0.025 134-135 1.475 0.0 0.0 0.0 0.025 136-137 1.6 0.0 0.0 0.0 0.025 138-139 1.7000000000000002 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGCCG 10 0.006830828 145.0 145 >>END_MODULE SRR8450145 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450145_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7235 37.0 37.0 37.0 37.0 37.0 2 35.2935 37.0 37.0 37.0 37.0 37.0 3 35.281 37.0 37.0 37.0 37.0 37.0 4 35.3845 37.0 37.0 37.0 37.0 37.0 5 35.242 37.0 37.0 37.0 37.0 37.0 6 35.173 37.0 37.0 37.0 37.0 37.0 7 35.2195 37.0 37.0 37.0 37.0 37.0 8 35.0875 37.0 37.0 37.0 37.0 37.0 9 35.114 37.0 37.0 37.0 25.0 37.0 10-14 34.9128 37.0 37.0 37.0 25.0 37.0 15-19 34.909200000000006 37.0 37.0 37.0 25.0 37.0 20-24 34.7923 37.0 37.0 37.0 25.0 37.0 25-29 34.558299999999996 37.0 37.0 37.0 25.0 37.0 30-34 34.5387 37.0 37.0 37.0 25.0 37.0 35-39 34.5612 37.0 37.0 37.0 25.0 37.0 40-44 34.440099999999994 37.0 37.0 37.0 25.0 37.0 45-49 34.4407 37.0 37.0 37.0 25.0 37.0 50-54 34.2919 37.0 37.0 37.0 25.0 37.0 55-59 34.3612 37.0 37.0 37.0 25.0 37.0 60-64 34.3682 37.0 37.0 37.0 25.0 37.0 65-69 34.362300000000005 37.0 37.0 37.0 25.0 37.0 70-74 34.2539 37.0 37.0 37.0 25.0 37.0 75-79 34.22539999999999 37.0 37.0 37.0 25.0 37.0 80-84 34.3196 37.0 37.0 37.0 25.0 37.0 85-89 34.2821 37.0 37.0 37.0 25.0 37.0 90-94 34.325900000000004 37.0 37.0 37.0 25.0 37.0 95-99 34.2665 37.0 37.0 37.0 25.0 37.0 100-104 34.3318 37.0 37.0 37.0 25.0 37.0 105-109 34.3129 37.0 37.0 37.0 25.0 37.0 110-114 34.3563 37.0 37.0 37.0 25.0 37.0 115-119 34.227199999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.1655 37.0 37.0 37.0 25.0 37.0 125-129 34.163700000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.102999999999994 37.0 37.0 37.0 25.0 37.0 135-139 34.0218 37.0 37.0 37.0 25.0 37.0 140-144 33.7971 37.0 37.0 37.0 22.2 37.0 145-149 33.860499999999995 37.0 37.0 37.0 25.0 37.0 150-151 32.91975 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 15.0 14 32.0 15 23.0 16 18.0 17 18.0 18 15.0 19 12.0 20 11.0 21 24.0 22 36.0 23 51.0 24 28.0 25 23.0 26 36.0 27 32.0 28 24.0 29 33.0 30 50.0 31 68.0 32 104.0 33 156.0 34 245.0 35 638.0 36 2146.0 37 159.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.324999999999996 15.975 10.5 29.2 2 33.85 20.724999999999998 23.225 22.2 3 26.924999999999997 22.625 25.85 24.6 4 32.9 26.950000000000003 16.975 23.175 5 31.974999999999998 29.875 17.775 20.375 6 28.4 30.75 18.9 21.95 7 27.3 19.375 28.449999999999996 24.875 8 28.125 21.349999999999998 22.525000000000002 28.000000000000004 9 28.499999999999996 22.325 23.275000000000002 25.900000000000002 10-14 29.37 24.65 20.625 25.355 15-19 29.125 23.235 22.09 25.55 20-24 28.57 24.605 21.740000000000002 25.085 25-29 27.955000000000002 25.215 21.845 24.985 30-34 27.76 25.605 21.91 24.725 35-39 28.055000000000003 25.66 21.385 24.9 40-44 27.525 25.865 21.38 25.230000000000004 45-49 27.77 24.895 21.94 25.395 50-54 27.544999999999998 25.569999999999997 21.87 25.014999999999997 55-59 27.96 25.019999999999996 21.475 25.545 60-64 28.139999999999997 25.415 21.61 24.834999999999997 65-69 27.55 25.525 22.155 24.77 70-74 27.71 25.290000000000003 21.7 25.3 75-79 27.595 25.305 21.87 25.230000000000004 80-84 27.67 25.014999999999997 21.725 25.590000000000003 85-89 28.050000000000004 25.540000000000003 21.555 24.855 90-94 27.765 25.11 21.695 25.430000000000003 95-99 28.04 25.174999999999997 21.925 24.86 100-104 28.675 25.135 21.45 24.740000000000002 105-109 28.305000000000003 25.290000000000003 21.6 24.805 110-114 27.76 25.124999999999996 21.745 25.369999999999997 115-119 28.139999999999997 25.130000000000003 21.36 25.369999999999997 120-124 28.26 25.005 21.84 24.895 125-129 28.285 24.915000000000003 21.990000000000002 24.81 130-134 28.74 25.46 21.495 24.305 135-139 28.405 25.825 21.345 24.425 140-144 28.93 25.45 21.175 24.445 145-149 28.95 24.9 21.72 24.43 150-151 28.15 25.4375 21.337500000000002 25.074999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.5 8 1.5 9 1.5 10 3.0 11 3.5 12 3.5 13 2.5 14 3.0 15 4.0 16 3.5 17 3.0 18 3.0 19 4.5 20 4.5 21 3.0 22 3.0 23 4.0 24 2.5 25 4.5 26 6.5 27 7.5 28 7.5 29 6.5 30 10.0 31 11.5 32 12.0 33 16.5 34 18.5 35 27.0 36 40.0 37 47.5 38 59.5 39 76.5 40 94.5 41 106.5 42 117.0 43 138.5 44 150.5 45 144.5 46 136.5 47 124.5 48 128.5 49 130.0 50 127.0 51 117.5 52 117.5 53 105.5 54 91.5 55 104.5 56 93.5 57 88.5 58 86.5 59 78.0 60 76.0 61 74.0 62 76.5 63 85.5 64 88.0 65 80.0 66 79.0 67 80.5 68 82.5 69 84.0 70 71.5 71 60.5 72 54.0 73 50.0 74 45.0 75 40.0 76 30.0 77 18.5 78 14.0 79 10.5 80 10.0 81 6.5 82 4.5 83 5.0 84 4.0 85 4.0 86 3.0 87 2.0 88 2.0 89 3.5 90 4.5 91 4.0 92 3.0 93 3.0 94 3.5 95 2.5 96 4.5 97 6.0 98 4.5 99 4.5 100 13.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.40992305651366 89.9 2 4.112496683470416 7.75 3 0.371451313345715 1.05 4 0.07959671000265323 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02653223666755107 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 40 1.0 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.2625000000000002 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.6749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCAA 10 0.006830828 145.0 1 GGGACGA 10 0.006830828 145.0 8 >>END_MODULE Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463893 spots for SRR8450145.sra Written 1463893 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra Read 1463884 spots for SRR8450145.sra Written 1463884 spots for SRR8450145.sra SRR ids: ['SRR8450145.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bfswf0qg SRR8450145.sra spots: 29277689 blocks: [[1, 1463884], [1463885, 2927768], [2927769, 4391652], [4391653, 5855536], [5855537, 7319420], [7319421, 8783304], [8783305, 10247188], [10247189, 11711072], [11711073, 13174956], [13174957, 14638840], [14638841, 16102724], [16102725, 17566608], [17566609, 19030492], [19030493, 20494376], [20494377, 21958260], [21958261, 23422144], [23422145, 24886028], [24886029, 26349912], [26349913, 27813796], [27813797, 29277689]] SRR8450145 file size 9899547 SRR8450145 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450145 SRR8450145_1.fastq SRR8450145_2.fastq Input file: SRR8450145_1.fastq Paired file: SRR8450145_2.fastq trimmed: SRR8450145-trimmed-pair1.fastq, SRR8450145-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:05:56 2024 >> started Fri Dec 6 10:06:42 2024 >> done (45.945s) 29277689 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 266281 ( 0.91%) empty read pairs filtered out after trimming by size control 29011315 (99.09%) read pairs available; of these: 900888 ( 3.11%) trimmed read pairs available after processing 28110427 (96.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 15 0.00% 21 7 0.00% 22 5 0.00% 23 13 0.00% 24 12 0.00% 25 12 0.00% 26 8 0.00% 27 15 0.00% 28 17 0.00% 29 15 0.00% 30 21 0.00% 31 27 0.00% 32 22 0.00% 33 19 0.00% 34 18 0.00% 35 21 0.00% 36 24 0.00% 37 24 0.00% 38 29 0.00% 39 22 0.00% 40 30 0.00% 41 26 0.00% 42 27 0.00% 43 23 0.00% 44 29 0.00% 45 40 0.00% 46 39 0.00% 47 52 0.00% 48 39 0.00% 49 44 0.00% 50 58 0.00% 51 52 0.00% 52 61 0.00% 53 72 0.00% 54 59 0.00% 55 59 0.00% 56 74 0.00% 57 60 0.00% 58 66 0.00% 59 83 0.00% 60 85 0.00% 61 82 0.00% 62 103 0.00% 63 104 0.00% 64 109 0.00% 65 116 0.00% 66 126 0.00% 67 138 0.00% 68 147 0.00% 69 156 0.00% 70 198 0.00% 71 190 0.00% 72 208 0.00% 73 269 0.00% 74 296 0.00% 75 304 0.00% 76 338 0.00% 77 362 0.00% 78 409 0.00% 79 446 0.00% 80 541 0.00% 81 578 0.00% 82 620 0.00% 83 698 0.00% 84 751 0.00% 85 890 0.00% 86 935 0.00% 87 1015 0.00% 88 1204 0.00% 89 1284 0.00% 90 1371 0.00% 91 1523 0.01% 92 1751 0.01% 93 1922 0.01% 94 2138 0.01% 95 2445 0.01% 96 2642 0.01% 97 2727 0.01% 98 2877 0.01% 99 3256 0.01% 100 3419 0.01% 101 3904 0.01% 102 4146 0.01% 103 4600 0.02% 104 4884 0.02% 105 5286 0.02% 106 5577 0.02% 107 5806 0.02% 108 6377 0.02% 109 6723 0.02% 110 7075 0.02% 111 7476 0.03% 112 8074 0.03% 113 8453 0.03% 114 9123 0.03% 115 9572 0.03% 116 10140 0.03% 117 10552 0.04% 118 10961 0.04% 119 11290 0.04% 120 11840 0.04% 121 12546 0.04% 122 13300 0.05% 123 13927 0.05% 124 14980 0.05% 125 15424 0.05% 126 16261 0.06% 127 16882 0.06% 128 17219 0.06% 129 17889 0.06% 130 18460 0.06% 131 19048 0.07% 132 20179 0.07% 133 20975 0.07% 134 21702 0.07% 135 22848 0.08% 136 23681 0.08% 137 24772 0.09% 138 25010 0.09% 139 25969 0.09% 140 26478 0.09% 141 27385 0.09% 142 28623 0.10% 143 29547 0.10% 144 30785 0.11% 145 31568 0.11% 146 32901 0.11% 147 33706 0.12% 148 34585 0.12% 149 35930 0.12% 150 36324 0.13% 151 28110427 96.89% 29011315 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=35 prefix-density=0.33 prefix-fanout=2.5 sequence=CGGCCGTTCTTGATCTCCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=41.82 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=11.7 sequence=TTCTCCTTGGCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=33 prefix-density=0.29 prefix-fanout=2.0 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=13 fanout-score=115.11 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=15.3 sequence=CCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTA SRR8450145 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:07:50 Started mapping on | Dec 06 10:07:50 Finished on | Dec 06 10:11:46 Mapping speed, Million of reads per hour | 442.55 Number of input reads | 29011315 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 26126047 Uniquely mapped reads % | 90.05% Average mapped length | 299.39 Number of splices: Total | 26567177 Number of splices: Annotated (sjdb) | 24822998 Number of splices: GT/AG | 26188934 Number of splices: GC/AG | 321442 Number of splices: AT/AC | 10443 Number of splices: Non-canonical | 46358 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271129 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 25809 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.25% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2614139 2614139 2614139 N_multimapping 271129 271129 271129 N_noFeature 946035 25331298 1203898 N_ambiguous 667300 4689 131426 UnstrandedReadsAssigned:24512712 PositiveStrandReadsAssigned:790060 NegativeStrandReadsAssigned:24790723 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450145 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450145-trimmed-pair1.fastq SRR8450145-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,011,315 reads, 26,127,850 reads pseudoaligned [quant] estimated average fragment length: 319.856 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR8450145.ke.tsv 35125 SRR8450145.se.tsv 88098 total ==> SRR8450145.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 618.039 0 0 PNS24247 1044 725.144 68.2377 5.30738 PNS24249 1928 1609.14 305.836 10.7195 PNS24246 1044 725.144 68.2377 5.30738 PNS24248 1044 725.144 68.2377 5.30738 PNS24244 1471 1152.14 61.4511 3.00818 PNS24243 293 74.7409 0 0 KQK14069 1603 1284.14 12103.7 531.6 KQK14071 474 194.615 187.149 54.2366 ==> SRR8450145.se.tsv <== BRADI_1g14170v3 12630 BRADI_1g53295v3 265 BRADI_1g59795v3 405 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 253 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 386 BRADI_1g48960v3 0 SRR8450145 completed mapping pipeline successfully