Starting /dee2/code/volunteer_pipeline.sh SRR8450146 current disk space = 1551807369216 free memory = 1602235456 SRR8450146 SRAfilesize 9cfa2ed5c83a606278dbeae8cd16a5aa SRR8450146.sra SRR8450146.sra file validated SRR8450146 is paired end SRR8450146 is conventional basespace SRR8450146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.26875 37.0 37.0 37.0 37.0 37.0 2 36.25475 37.0 37.0 37.0 37.0 37.0 3 36.372 37.0 37.0 37.0 37.0 37.0 4 36.4425 37.0 37.0 37.0 37.0 37.0 5 36.4205 37.0 37.0 37.0 37.0 37.0 6 36.4095 37.0 37.0 37.0 37.0 37.0 7 36.426 37.0 37.0 37.0 37.0 37.0 8 36.475 37.0 37.0 37.0 37.0 37.0 9 36.376 37.0 37.0 37.0 37.0 37.0 10-14 36.4841 37.0 37.0 37.0 37.0 37.0 15-19 36.424400000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4329 37.0 37.0 37.0 37.0 37.0 25-29 36.354 37.0 37.0 37.0 37.0 37.0 30-34 36.339299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.365300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3224 37.0 37.0 37.0 37.0 37.0 45-49 36.254999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2347 37.0 37.0 37.0 37.0 37.0 55-59 36.210499999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.1214 37.0 37.0 37.0 37.0 37.0 65-69 36.044799999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.228899999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2313 37.0 37.0 37.0 37.0 37.0 80-84 36.211600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1584 37.0 37.0 37.0 37.0 37.0 90-94 36.1811 37.0 37.0 37.0 37.0 37.0 95-99 36.156699999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.0865 37.0 37.0 37.0 37.0 37.0 105-109 36.1101 37.0 37.0 37.0 37.0 37.0 110-114 35.9871 37.0 37.0 37.0 37.0 37.0 115-119 35.97240000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.9605 37.0 37.0 37.0 37.0 37.0 125-129 35.9605 37.0 37.0 37.0 37.0 37.0 130-134 35.8504 37.0 37.0 37.0 37.0 37.0 135-139 35.846900000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.837900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8231 37.0 37.0 37.0 37.0 37.0 150-151 35.255250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 3.0 25 2.0 26 5.0 27 5.0 28 15.0 29 27.0 30 39.0 31 57.0 32 59.0 33 83.0 34 147.0 35 327.0 36 2770.0 37 457.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.6048609371085 12.12728639438737 9.045352042094713 32.22250062640942 2 27.28182045511378 13.653413353338333 27.33183295823956 31.732933233308323 3 22.825 18.375 24.15 34.65 4 26.125 23.075000000000003 22.1 28.7 5 28.4 25.900000000000002 23.150000000000002 22.55 6 23.25 29.825000000000003 23.5 23.425 7 19.55 22.175 37.25 21.025 8 22.45 23.724999999999998 27.525 26.3 9 21.275 21.4 31.874999999999996 25.45 10-14 24.605 24.834999999999997 24.905 25.655 15-19 24.575 24.245 25.5 25.679999999999996 20-24 24.735 24.16 25.52 25.585 25-29 24.675 24.085 24.55 26.69 30-34 24.529999999999998 24.654999999999998 24.86 25.955000000000002 35-39 24.07 24.224999999999998 25.22 26.484999999999996 40-44 25.245 23.630000000000003 23.895 27.229999999999997 45-49 24.535 23.580000000000002 24.695 27.189999999999998 50-54 24.58 24.175 23.91 27.334999999999997 55-59 24.895 23.695 24.92 26.490000000000002 60-64 24.345 24.01 24.959999999999997 26.685 65-69 25.224999999999998 24.575 23.65 26.55 70-74 25.900000000000002 23.66 24.02 26.419999999999998 75-79 25.965 23.1 24.279999999999998 26.655 80-84 25.895000000000003 23.18 23.855 27.07 85-89 26.525 23.18 23.62 26.674999999999997 90-94 26.415 23.31 23.95 26.325 95-99 25.905 23.205000000000002 23.965 26.924999999999997 100-104 25.080000000000002 23.435 24.060000000000002 27.425 105-109 26.279999999999998 22.96 23.830000000000002 26.93 110-114 25.75 22.6 24.665 26.985 115-119 26.21 23.36 23.225 27.205000000000002 120-124 26.195 23.335 24.175 26.295 125-129 25.635 22.615 24.395 27.355 130-134 26.529999999999998 23.035 23.32 27.115000000000002 135-139 26.085 22.74 24.145 27.029999999999998 140-144 26.015 22.884999999999998 24.305 26.795 145-149 26.125 23.425 23.549999999999997 26.900000000000002 150-151 26.2875 23.375 23.0125 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 2.5 29 2.5 30 3.5 31 6.5 32 8.5 33 10.5 34 19.0 35 28.5 36 35.0 37 45.0 38 59.5 39 77.5 40 105.5 41 128.5 42 131.0 43 152.0 44 146.5 45 141.0 46 176.5 47 183.5 48 164.5 49 152.0 50 160.5 51 145.5 52 132.5 53 132.0 54 108.0 55 110.5 56 115.0 57 102.0 58 98.0 59 92.0 60 95.0 61 102.0 62 92.5 63 74.5 64 71.0 65 81.0 66 80.0 67 66.0 68 54.5 69 49.5 70 48.5 71 43.5 72 37.0 73 30.0 74 27.0 75 22.0 76 14.0 77 11.5 78 7.0 79 4.0 80 3.0 81 2.5 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.37483337776594 88.5 2 5.171954145561183 9.700000000000001 3 0.3199146894161557 0.8999999999999999 4 0.053319114902692616 0.2 5 0.026659557451346308 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026659557451346308 0.2 9 0.0 0.0 >10 0.026659557451346308 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTAT 15 0.375 TruSeq Adapter, Index 13 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCGCGTAT 8 0.2 TruSeq Adapter, Index 13 (97% over 37bp) GCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0125 0.0 0.0 0.0 0.025 92-93 0.025 0.0 0.0 0.0 0.025 94-95 0.025 0.0 0.0 0.0 0.025 96-97 0.025 0.0 0.0 0.0 0.025 98-99 0.05 0.0 0.0 0.0 0.025 100-101 0.0875 0.0 0.0 0.0 0.025 102-103 0.1 0.0 0.0 0.0 0.025 104-105 0.16249999999999998 0.0 0.0 0.0 0.025 106-107 0.175 0.0 0.0 0.0 0.025 108-109 0.2375 0.0 0.0 0.0 0.025 110-111 0.325 0.0 0.0 0.0 0.025 112-113 0.42500000000000004 0.0 0.0 0.0 0.025 114-115 0.5125 0.0 0.0 0.0 0.025 116-117 0.575 0.0 0.0 0.0 0.025 118-119 0.6875 0.0 0.0 0.0 0.025 120-121 0.8500000000000001 0.0 0.0 0.0 0.025 122-123 0.9875 0.0 0.0 0.0 0.025 124-125 1.2125 0.0 0.0 0.0 0.025 126-127 1.325 0.0 0.0 0.0 0.025 128-129 1.4875 0.0 0.0 0.0 0.025 130-131 1.6875 0.0 0.0 0.0 0.025 132-133 2.0625 0.0 0.0 0.0 0.025 134-135 2.2625 0.0 0.0 0.0 0.025 136-137 2.4875 0.0 0.0 0.0 0.025 138-139 2.825 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTCC 10 0.006830828 145.0 145 TCAGCCC 10 0.006830828 145.0 2 CTCAGCC 10 0.006830828 145.0 1 TCACCAA 10 0.006830828 145.0 9 >>END_MODULE SRR8450146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.029 37.0 37.0 37.0 37.0 37.0 2 35.6665 37.0 37.0 37.0 37.0 37.0 3 35.6135 37.0 37.0 37.0 37.0 37.0 4 35.5045 37.0 37.0 37.0 37.0 37.0 5 35.508 37.0 37.0 37.0 37.0 37.0 6 35.4665 37.0 37.0 37.0 37.0 37.0 7 35.2855 37.0 37.0 37.0 37.0 37.0 8 35.3955 37.0 37.0 37.0 37.0 37.0 9 35.2915 37.0 37.0 37.0 37.0 37.0 10-14 35.101099999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.0324 37.0 37.0 37.0 29.8 37.0 20-24 34.90319999999999 37.0 37.0 37.0 27.4 37.0 25-29 34.7517 37.0 37.0 37.0 25.0 37.0 30-34 34.749300000000005 37.0 37.0 37.0 25.0 37.0 35-39 34.76049999999999 37.0 37.0 37.0 25.0 37.0 40-44 34.603300000000004 37.0 37.0 37.0 25.0 37.0 45-49 34.657 37.0 37.0 37.0 25.0 37.0 50-54 34.578 37.0 37.0 37.0 25.0 37.0 55-59 34.5529 37.0 37.0 37.0 25.0 37.0 60-64 34.5501 37.0 37.0 37.0 25.0 37.0 65-69 34.5952 37.0 37.0 37.0 25.0 37.0 70-74 34.4841 37.0 37.0 37.0 25.0 37.0 75-79 34.4961 37.0 37.0 37.0 25.0 37.0 80-84 34.47109999999999 37.0 37.0 37.0 25.0 37.0 85-89 34.41179999999999 37.0 37.0 37.0 25.0 37.0 90-94 34.3868 37.0 37.0 37.0 25.0 37.0 95-99 34.3931 37.0 37.0 37.0 25.0 37.0 100-104 34.45 37.0 37.0 37.0 25.0 37.0 105-109 34.482400000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.4538 37.0 37.0 37.0 25.0 37.0 115-119 34.372699999999995 37.0 37.0 37.0 25.0 37.0 120-124 34.3081 37.0 37.0 37.0 25.0 37.0 125-129 34.2221 37.0 37.0 37.0 25.0 37.0 130-134 34.2462 37.0 37.0 37.0 25.0 37.0 135-139 34.1767 37.0 37.0 37.0 25.0 37.0 140-144 34.0886 37.0 37.0 37.0 25.0 37.0 145-149 34.021 37.0 37.0 37.0 25.0 37.0 150-151 33.377750000000006 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 18.0 14 33.0 15 33.0 16 21.0 17 17.0 18 15.0 19 17.0 20 17.0 21 31.0 22 41.0 23 35.0 24 27.0 25 23.0 26 15.0 27 11.0 28 27.0 29 25.0 30 40.0 31 60.0 32 74.0 33 119.0 34 169.0 35 520.0 36 2381.0 37 230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.074999999999996 19.15 9.725 27.05 2 35.8 20.674999999999997 21.875 21.65 3 28.999999999999996 23.400000000000002 23.75 23.849999999999998 4 31.25 28.199999999999996 17.1 23.45 5 31.55 28.475 17.150000000000002 22.825 6 29.425 31.5 17.45 21.625 7 28.125 19.75 27.625 24.5 8 29.25 22.650000000000002 19.650000000000002 28.449999999999996 9 28.549999999999997 22.75 23.875 24.825 10-14 30.470000000000002 24.759999999999998 19.48 25.290000000000003 15-19 29.360000000000003 24.165 21.27 25.205 20-24 28.910000000000004 25.34 20.369999999999997 25.380000000000003 25-29 28.665000000000003 25.615 20.715 25.005 30-34 28.17 25.235000000000003 21.26 25.335 35-39 27.35 25.965 21.145 25.540000000000003 40-44 28.294999999999998 25.61 20.57 25.525 45-49 27.74 26.255 20.59 25.415 50-54 27.834999999999997 25.88 20.965 25.319999999999997 55-59 28.17 25.485000000000003 20.93 25.415 60-64 28.595 25.275 20.665 25.465 65-69 27.700000000000003 26.279999999999998 20.979999999999997 25.040000000000003 70-74 28.415000000000003 25.52 20.75 25.314999999999998 75-79 27.650000000000002 26.040000000000003 21.41 24.9 80-84 27.705000000000002 26.125 20.89 25.28 85-89 27.915 25.96 20.669999999999998 25.455 90-94 28.48 25.915 20.75 24.855 95-99 27.29 26.11 21.565 25.035 100-104 27.534999999999997 25.96 21.245 25.259999999999998 105-109 28.02 26.035000000000004 21.099999999999998 24.845 110-114 28.13 26.334999999999997 21.115000000000002 24.42 115-119 27.944999999999997 26.16 21.305 24.59 120-124 27.560000000000002 26.090000000000003 20.635 25.715 125-129 27.92 26.32 21.0 24.759999999999998 130-134 27.810000000000002 26.44 20.825 24.925 135-139 27.779999999999998 26.029999999999998 21.3 24.89 140-144 28.02 26.71 21.135 24.135 145-149 28.34 26.545 20.815 24.3 150-151 28.212500000000002 26.1125 20.5875 25.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 1.0 5 2.0 6 2.0 7 1.5 8 0.5 9 1.0 10 2.0 11 3.0 12 2.5 13 2.5 14 3.0 15 1.0 16 1.5 17 2.0 18 1.0 19 4.0 20 5.0 21 2.5 22 2.5 23 2.0 24 4.0 25 5.5 26 4.0 27 4.5 28 6.5 29 9.5 30 7.5 31 7.0 32 7.5 33 11.0 34 17.0 35 18.0 36 21.5 37 28.5 38 37.5 39 55.0 40 75.0 41 95.0 42 123.5 43 130.5 44 122.0 45 130.5 46 153.5 47 155.5 48 147.5 49 164.0 50 148.5 51 132.5 52 132.0 53 109.5 54 102.5 55 100.5 56 91.5 57 94.5 58 100.5 59 96.0 60 102.5 61 101.5 62 91.5 63 96.5 64 89.0 65 81.5 66 81.0 67 76.5 68 73.5 69 76.0 70 77.5 71 56.5 72 42.5 73 41.0 74 35.5 75 28.0 76 21.5 77 19.0 78 13.0 79 10.5 80 7.5 81 4.5 82 4.0 83 2.5 84 2.0 85 2.0 86 2.0 87 2.5 88 2.5 89 1.5 90 2.5 91 2.0 92 0.0 93 2.5 94 4.0 95 2.0 96 2.0 97 2.5 98 2.0 99 3.5 100 20.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.18104366347177 89.375 2 4.33972310969116 8.15 3 0.3993610223642172 1.125 4 0.05324813631522897 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026624068157614485 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 46 1.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCA 10 0.006830828 145.0 4 GAGAGAG 20 0.00593511 29.0 25-29 >>END_MODULE Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401604 spots for SRR8450146.sra Written 1401604 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra Read 1401591 spots for SRR8450146.sra Written 1401591 spots for SRR8450146.sra SRR ids: ['SRR8450146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5lbt08ds SRR8450146.sra spots: 28031833 blocks: [[1, 1401591], [1401592, 2803182], [2803183, 4204773], [4204774, 5606364], [5606365, 7007955], [7007956, 8409546], [8409547, 9811137], [9811138, 11212728], [11212729, 12614319], [12614320, 14015910], [14015911, 15417501], [15417502, 16819092], [16819093, 18220683], [18220684, 19622274], [19622275, 21023865], [21023866, 22425456], [22425457, 23827047], [23827048, 25228638], [25228639, 26630229], [26630230, 28031833]] SRR8450146 file size 9477368 SRR8450146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450146 SRR8450146_1.fastq SRR8450146_2.fastq Input file: SRR8450146_1.fastq Paired file: SRR8450146_2.fastq trimmed: SRR8450146-trimmed-pair1.fastq, SRR8450146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:05:32 2024 >> started Fri Dec 6 10:06:02 2024 >> done (30.876s) 28031833 read pairs processed; of these: 92 ( 0.00%) short read pairs filtered out after trimming by size control 180953 ( 0.65%) empty read pairs filtered out after trimming by size control 27850788 (99.35%) read pairs available; of these: 1286357 ( 4.62%) trimmed read pairs available after processing 26564431 (95.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 6 0.00% 21 10 0.00% 22 5 0.00% 23 16 0.00% 24 14 0.00% 25 13 0.00% 26 17 0.00% 27 14 0.00% 28 11 0.00% 29 14 0.00% 30 15 0.00% 31 19 0.00% 32 17 0.00% 33 18 0.00% 34 27 0.00% 35 23 0.00% 36 22 0.00% 37 30 0.00% 38 34 0.00% 39 25 0.00% 40 34 0.00% 41 21 0.00% 42 33 0.00% 43 20 0.00% 44 16 0.00% 45 40 0.00% 46 35 0.00% 47 39 0.00% 48 36 0.00% 49 37 0.00% 50 42 0.00% 51 32 0.00% 52 42 0.00% 53 59 0.00% 54 50 0.00% 55 45 0.00% 56 56 0.00% 57 45 0.00% 58 56 0.00% 59 66 0.00% 60 70 0.00% 61 77 0.00% 62 78 0.00% 63 83 0.00% 64 92 0.00% 65 68 0.00% 66 90 0.00% 67 87 0.00% 68 113 0.00% 69 125 0.00% 70 147 0.00% 71 123 0.00% 72 198 0.00% 73 205 0.00% 74 227 0.00% 75 248 0.00% 76 248 0.00% 77 297 0.00% 78 333 0.00% 79 402 0.00% 80 452 0.00% 81 482 0.00% 82 618 0.00% 83 703 0.00% 84 753 0.00% 85 890 0.00% 86 918 0.00% 87 1048 0.00% 88 1178 0.00% 89 1289 0.00% 90 1422 0.01% 91 1700 0.01% 92 1860 0.01% 93 2044 0.01% 94 2338 0.01% 95 2624 0.01% 96 2931 0.01% 97 3301 0.01% 98 3456 0.01% 99 3697 0.01% 100 4145 0.01% 101 4574 0.02% 102 5058 0.02% 103 5648 0.02% 104 6110 0.02% 105 6610 0.02% 106 7151 0.03% 107 7482 0.03% 108 8200 0.03% 109 8794 0.03% 110 9331 0.03% 111 9949 0.04% 112 11018 0.04% 113 11684 0.04% 114 12441 0.04% 115 13300 0.05% 116 14266 0.05% 117 14739 0.05% 118 15524 0.06% 119 16081 0.06% 120 16636 0.06% 121 17989 0.06% 122 19208 0.07% 123 20087 0.07% 124 21683 0.08% 125 22840 0.08% 126 23476 0.08% 127 24493 0.09% 128 25190 0.09% 129 26401 0.09% 130 27215 0.10% 131 28076 0.10% 132 29808 0.11% 133 31046 0.11% 134 32211 0.12% 135 33818 0.12% 136 34805 0.12% 137 35977 0.13% 138 36657 0.13% 139 38388 0.14% 140 38945 0.14% 141 40713 0.15% 142 41899 0.15% 143 43039 0.15% 144 45235 0.16% 145 46812 0.17% 146 48179 0.17% 147 49620 0.18% 148 50906 0.18% 149 51950 0.19% 150 52766 0.19% 151 26564431 95.38% 27850788 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=15.16 fanout-score-rank=3 prefix-density=1.29 prefix-fanout=5.2 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTG criterion=fanout-score sequence-density=0.17 sequence-density-rank=14 fanout-score=17.34 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=17.3 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.49 fanout-score-rank=37 prefix-density=0.46 prefix-fanout=1.3 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=73.80 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=9.5 sequence=CCGCCGCCGCCTCC SRR8450146 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:06:52 Started mapping on | Dec 06 10:06:52 Finished on | Dec 06 10:10:49 Mapping speed, Million of reads per hour | 423.05 Number of input reads | 27850788 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24309098 Uniquely mapped reads % | 87.28% Average mapped length | 298.90 Number of splices: Total | 24839884 Number of splices: Annotated (sjdb) | 23417266 Number of splices: GT/AG | 24509372 Number of splices: GC/AG | 287061 Number of splices: AT/AC | 9726 Number of splices: Non-canonical | 33725 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.90 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358108 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 42958 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.11% % of reads unmapped: other | 1.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3183582 3183582 3183582 N_multimapping 358108 358108 358108 N_noFeature 653910 23572979 826782 N_ambiguous 676304 3613 113655 UnstrandedReadsAssigned:22978884 PositiveStrandReadsAssigned:732506 NegativeStrandReadsAssigned:23368661 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450146-trimmed-pair1.fastq SRR8450146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,850,788 reads, 24,797,707 reads pseudoaligned [quant] estimated average fragment length: 291.018 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR8450146.ke.tsv 35125 SRR8450146.se.tsv 88098 total ==> SRR8450146.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 646.446 0 0 PNS24247 1044 753.982 69.742 4.61727 PNS24249 1928 1637.98 219.451 6.68775 PNS24246 1044 753.982 69.742 4.61727 PNS24248 1044 753.982 69.742 4.61727 PNS24244 1471 1180.98 172.323 7.28368 PNS24243 293 81.5625 0 0 KQK14069 1603 1312.98 9899.38 376.357 KQK14071 474 210.678 155.257 36.7861 ==> SRR8450146.se.tsv <== BRADI_1g14170v3 9904 BRADI_1g53295v3 128 BRADI_1g59795v3 254 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 241 BRADI_1g74790v3 156 BRADI_1g09890v3 0 BRADI_1g77505v3 575 BRADI_1g48960v3 0 SRR8450146 completed mapping pipeline successfully