Starting /dee2/code/volunteer_pipeline.sh SRR8450147 current disk space = 1551870128128 free memory = 1602233972 SRR8450147 SRAfilesize d320dede5f24916a15443b02759133ab SRR8450147.sra SRR8450147.sra file validated SRR8450147 is paired end SRR8450147 is conventional basespace SRR8450147 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450147_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.001 37.0 37.0 37.0 37.0 37.0 2 36.20925 37.0 37.0 37.0 37.0 37.0 3 36.314 37.0 37.0 37.0 37.0 37.0 4 36.374 37.0 37.0 37.0 37.0 37.0 5 36.4825 37.0 37.0 37.0 37.0 37.0 6 36.498 37.0 37.0 37.0 37.0 37.0 7 36.304 37.0 37.0 37.0 37.0 37.0 8 36.384 37.0 37.0 37.0 37.0 37.0 9 36.3585 37.0 37.0 37.0 37.0 37.0 10-14 36.4197 37.0 37.0 37.0 37.0 37.0 15-19 36.44169999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.3825 37.0 37.0 37.0 37.0 37.0 25-29 36.269 37.0 37.0 37.0 37.0 37.0 30-34 36.3645 37.0 37.0 37.0 37.0 37.0 35-39 36.309 37.0 37.0 37.0 37.0 37.0 40-44 36.2995 37.0 37.0 37.0 37.0 37.0 45-49 36.267199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2351 37.0 37.0 37.0 37.0 37.0 55-59 36.168499999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2005 37.0 37.0 37.0 37.0 37.0 65-69 36.080200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.208 37.0 37.0 37.0 37.0 37.0 75-79 36.186099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.184900000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.13170000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.1312 37.0 37.0 37.0 37.0 37.0 95-99 36.1089 37.0 37.0 37.0 37.0 37.0 100-104 35.9689 37.0 37.0 37.0 37.0 37.0 105-109 36.0446 37.0 37.0 37.0 37.0 37.0 110-114 35.9624 37.0 37.0 37.0 37.0 37.0 115-119 35.9762 37.0 37.0 37.0 37.0 37.0 120-124 35.9057 37.0 37.0 37.0 37.0 37.0 125-129 35.834300000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.817600000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.7788 37.0 37.0 37.0 37.0 37.0 140-144 35.793499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7258 37.0 37.0 37.0 37.0 37.0 150-151 35.1755 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 1.0 24 2.0 25 5.0 26 3.0 27 8.0 28 15.0 29 22.0 30 46.0 31 60.0 32 72.0 33 91.0 34 139.0 35 344.0 36 2728.0 37 462.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.487706974410436 11.088810837932765 8.881083793276467 33.54239839438033 2 26.731682920730183 12.628157039259817 29.507376844211052 31.13278319579895 3 23.65 17.1 22.5 36.75 4 29.15 23.200000000000003 19.8 27.85 5 27.250000000000004 27.575 22.7 22.475 6 23.200000000000003 29.725 22.225 24.85 7 19.5 23.549999999999997 39.050000000000004 17.9 8 23.025000000000002 22.650000000000002 28.65 25.674999999999997 9 21.3 23.025000000000002 31.0 24.675 10-14 24.715 25.35 25.145 24.79 15-19 24.529999999999998 24.42 25.064999999999998 25.985000000000003 20-24 24.645 24.310000000000002 24.935 26.11 25-29 24.535 24.505 25.03 25.929999999999996 30-34 23.9 24.195 25.615 26.290000000000003 35-39 24.05 24.425 25.330000000000002 26.195 40-44 24.13 24.060000000000002 24.959999999999997 26.85 45-49 23.87 24.345 25.174999999999997 26.61 50-54 24.27 24.285 25.45 25.995 55-59 24.58 24.16 24.959999999999997 26.3 60-64 23.52 24.525 25.145 26.810000000000002 65-69 24.605 24.05 25.41 25.935000000000002 70-74 24.66 24.02 24.625 26.695 75-79 24.775 24.535 24.310000000000002 26.38 80-84 24.485 24.635 24.7 26.179999999999996 85-89 25.235000000000003 23.885 24.585 26.295 90-94 25.115 23.815 24.349999999999998 26.72 95-99 25.25 23.355 24.855 26.540000000000003 100-104 24.959999999999997 24.505 24.29 26.245 105-109 24.65 23.990000000000002 24.834999999999997 26.525 110-114 25.264999999999997 23.915 24.779999999999998 26.040000000000003 115-119 25.185000000000002 23.91 24.63 26.275 120-124 25.545 23.91 24.62 25.924999999999997 125-129 25.28 24.21 24.315 26.195 130-134 25.7 23.405 24.075 26.82 135-139 25.28 23.605 24.04 27.075 140-144 25.14 23.75 25.025 26.085 145-149 24.935 23.674999999999997 24.25 27.139999999999997 150-151 25.55 24.1625 24.05 26.237500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 1.5 28 2.0 29 5.0 30 6.0 31 6.5 32 10.5 33 14.0 34 20.0 35 31.5 36 42.0 37 49.5 38 64.0 39 84.0 40 103.0 41 128.5 42 163.5 43 173.0 44 174.5 45 192.0 46 179.5 47 161.5 48 165.5 49 170.5 50 168.5 51 150.0 52 131.5 53 131.0 54 117.5 55 100.0 56 96.5 57 87.5 58 83.0 59 87.0 60 76.0 61 66.0 62 68.0 63 61.5 64 62.5 65 72.0 66 68.0 67 60.0 68 59.5 69 53.0 70 41.0 71 37.0 72 31.5 73 26.0 74 28.5 75 27.0 76 17.5 77 9.0 78 7.5 79 7.0 80 6.0 81 3.5 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.72016895459345 89.7 2 4.963041182682154 9.4 3 0.31678986272439286 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.23750000000000002 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5375 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7749999999999999 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.6375000000000002 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGATGG 10 0.006830828 145.0 145 TTGAGGT 10 0.006830828 145.0 2 TGAGGTT 10 0.006830828 145.0 3 >>END_MODULE SRR8450147 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450147_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7795 37.0 37.0 37.0 37.0 37.0 2 35.4065 37.0 37.0 37.0 37.0 37.0 3 35.524 37.0 37.0 37.0 37.0 37.0 4 35.5165 37.0 37.0 37.0 37.0 37.0 5 35.439 37.0 37.0 37.0 37.0 37.0 6 35.421 37.0 37.0 37.0 37.0 37.0 7 35.08 37.0 37.0 37.0 25.0 37.0 8 35.324 37.0 37.0 37.0 37.0 37.0 9 35.1225 37.0 37.0 37.0 37.0 37.0 10-14 35.1416 37.0 37.0 37.0 37.0 37.0 15-19 35.0758 37.0 37.0 37.0 32.2 37.0 20-24 35.082899999999995 37.0 37.0 37.0 32.2 37.0 25-29 34.95739999999999 37.0 37.0 37.0 27.4 37.0 30-34 34.876000000000005 37.0 37.0 37.0 25.0 37.0 35-39 34.9052 37.0 37.0 37.0 29.8 37.0 40-44 34.754999999999995 37.0 37.0 37.0 25.0 37.0 45-49 34.8564 37.0 37.0 37.0 25.0 37.0 50-54 34.6533 37.0 37.0 37.0 25.0 37.0 55-59 34.7426 37.0 37.0 37.0 25.0 37.0 60-64 34.733799999999995 37.0 37.0 37.0 25.0 37.0 65-69 34.6922 37.0 37.0 37.0 25.0 37.0 70-74 34.631299999999996 37.0 37.0 37.0 25.0 37.0 75-79 34.643499999999996 37.0 37.0 37.0 25.0 37.0 80-84 34.6089 37.0 37.0 37.0 25.0 37.0 85-89 34.5295 37.0 37.0 37.0 25.0 37.0 90-94 34.5596 37.0 37.0 37.0 25.0 37.0 95-99 34.5179 37.0 37.0 37.0 25.0 37.0 100-104 34.5112 37.0 37.0 37.0 25.0 37.0 105-109 34.439800000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.4446 37.0 37.0 37.0 25.0 37.0 115-119 34.393600000000006 37.0 37.0 37.0 25.0 37.0 120-124 34.338 37.0 37.0 37.0 25.0 37.0 125-129 34.2785 37.0 37.0 37.0 25.0 37.0 130-134 34.1892 37.0 37.0 37.0 25.0 37.0 135-139 34.1881 37.0 37.0 37.0 25.0 37.0 140-144 33.932 37.0 37.0 37.0 25.0 37.0 145-149 33.9751 37.0 37.0 37.0 25.0 37.0 150-151 33.3275 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 19.0 14 18.0 15 25.0 16 14.0 17 16.0 18 10.0 19 9.0 20 17.0 21 20.0 22 27.0 23 27.0 24 34.0 25 29.0 26 26.0 27 25.0 28 35.0 29 38.0 30 45.0 31 71.0 32 82.0 33 137.0 34 245.0 35 526.0 36 2309.0 37 191.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 18.075 11.35 30.175 2 33.775 21.875 22.25 22.1 3 26.950000000000003 24.125 24.75 24.175 4 30.0 28.475 18.8 22.725 5 31.775 29.825000000000003 17.05 21.349999999999998 6 27.200000000000003 31.65 18.35 22.8 7 25.825 19.650000000000002 31.225 23.3 8 27.700000000000003 23.625 20.4 28.275 9 26.5 22.625 24.099999999999998 26.775 10-14 28.505000000000003 24.945 20.585 25.965 15-19 27.785 24.84 21.78 25.595000000000002 20-24 27.334999999999997 24.68 21.735 26.25 25-29 26.979999999999997 25.275 21.65 26.095000000000002 30-34 26.334999999999997 26.26 22.1 25.305 35-39 26.35 26.3 22.009999999999998 25.34 40-44 27.025 25.44 21.81 25.724999999999998 45-49 26.655 25.86 21.86 25.624999999999996 50-54 26.640000000000004 25.95 21.815 25.595000000000002 55-59 26.334999999999997 25.729999999999997 22.0 25.935000000000002 60-64 26.69 25.405 22.155 25.75 65-69 26.965 25.855 21.805 25.374999999999996 70-74 27.425 25.66 21.86 25.055 75-79 26.575 25.290000000000003 22.2 25.935000000000002 80-84 27.13 25.290000000000003 22.075 25.505 85-89 26.855 25.83 22.009999999999998 25.305 90-94 26.77 25.840000000000003 21.725 25.665 95-99 27.29 25.685000000000002 21.745 25.28 100-104 26.87 25.645 21.925 25.56 105-109 26.46 25.935000000000002 22.345000000000002 25.259999999999998 110-114 26.245 26.540000000000003 21.685 25.53 115-119 26.740000000000002 26.474999999999998 21.73 25.055 120-124 26.945000000000004 26.14 21.945 24.97 125-129 26.945000000000004 26.295 21.905 24.855 130-134 27.13 26.369999999999997 21.755 24.745 135-139 26.775 26.355 22.24 24.63 140-144 26.669999999999998 26.77 21.965 24.595 145-149 27.435 26.035000000000004 22.189999999999998 24.34 150-151 28.499999999999996 26.325 21.0375 24.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.5 3 2.0 4 1.5 5 1.0 6 1.5 7 2.5 8 2.0 9 0.5 10 1.0 11 2.0 12 3.0 13 2.5 14 2.5 15 3.0 16 2.5 17 2.5 18 2.0 19 3.0 20 3.5 21 3.5 22 4.0 23 4.0 24 3.5 25 2.5 26 5.5 27 6.5 28 5.5 29 7.0 30 9.0 31 10.5 32 10.5 33 12.0 34 21.5 35 31.5 36 34.5 37 40.0 38 59.0 39 74.5 40 84.5 41 102.0 42 121.5 43 144.0 44 142.0 45 138.5 46 147.5 47 140.5 48 143.5 49 149.5 50 146.0 51 137.0 52 121.5 53 110.5 54 102.5 55 95.0 56 88.5 57 91.0 58 93.5 59 84.5 60 92.0 61 94.5 62 83.5 63 85.5 64 78.0 65 72.0 66 72.5 67 76.0 68 78.5 69 82.5 70 77.5 71 60.0 72 54.0 73 50.0 74 39.0 75 27.0 76 17.0 77 13.0 78 11.5 79 6.0 80 3.5 81 4.5 82 4.0 83 3.0 84 2.5 85 1.0 86 1.5 87 1.5 88 2.0 89 3.0 90 2.5 91 1.5 92 1.0 93 0.5 94 0.5 95 0.5 96 1.5 97 2.5 98 1.0 99 1.0 100 11.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.9774116396492 89.35 2 4.5442466117459475 8.55 3 0.3720435822482062 1.05 4 0.07972362476747276 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026574541589157584 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 30 0.75 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.23750000000000002 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.5750000000000002 0.0 0.0 0.0 0.0 136-137 1.7125 0.0 0.0 0.0 0.0 138-139 1.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTCTA 10 0.006830828 145.0 145 GCACACA 10 0.006830828 145.0 145 TTTTTTT 25 4.977651E-4 29.0 15-19 >>END_MODULE Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888223 spots for SRR8450147.sra Written 1888223 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra Read 1888216 spots for SRR8450147.sra Written 1888216 spots for SRR8450147.sra SRR ids: ['SRR8450147.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nebz0irj SRR8450147.sra spots: 37764327 blocks: [[1, 1888216], [1888217, 3776432], [3776433, 5664648], [5664649, 7552864], [7552865, 9441080], [9441081, 11329296], [11329297, 13217512], [13217513, 15105728], [15105729, 16993944], [16993945, 18882160], [18882161, 20770376], [20770377, 22658592], [22658593, 24546808], [24546809, 26435024], [26435025, 28323240], [28323241, 30211456], [30211457, 32099672], [32099673, 33987888], [33987889, 35876104], [35876105, 37764327]] SRR8450147 file size 12775390 SRR8450147 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450147 SRR8450147_1.fastq SRR8450147_2.fastq Input file: SRR8450147_1.fastq Paired file: SRR8450147_2.fastq trimmed: SRR8450147-trimmed-pair1.fastq, SRR8450147-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:09:38 2024 >> started Fri Dec 6 10:10:21 2024 >> done (42.268s) 37764327 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 21269 ( 0.06%) empty read pairs filtered out after trimming by size control 37743014 (99.94%) read pairs available; of these: 1392431 ( 3.69%) trimmed read pairs available after processing 36350583 (96.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 7 0.00% 21 8 0.00% 22 8 0.00% 23 9 0.00% 24 16 0.00% 25 17 0.00% 26 19 0.00% 27 11 0.00% 28 23 0.00% 29 9 0.00% 30 15 0.00% 31 11 0.00% 32 19 0.00% 33 27 0.00% 34 21 0.00% 35 25 0.00% 36 19 0.00% 37 23 0.00% 38 33 0.00% 39 29 0.00% 40 34 0.00% 41 35 0.00% 42 46 0.00% 43 34 0.00% 44 34 0.00% 45 46 0.00% 46 39 0.00% 47 42 0.00% 48 39 0.00% 49 50 0.00% 50 43 0.00% 51 59 0.00% 52 58 0.00% 53 68 0.00% 54 55 0.00% 55 49 0.00% 56 63 0.00% 57 69 0.00% 58 53 0.00% 59 62 0.00% 60 81 0.00% 61 91 0.00% 62 104 0.00% 63 114 0.00% 64 131 0.00% 65 125 0.00% 66 141 0.00% 67 147 0.00% 68 153 0.00% 69 185 0.00% 70 205 0.00% 71 209 0.00% 72 283 0.00% 73 282 0.00% 74 343 0.00% 75 324 0.00% 76 369 0.00% 77 478 0.00% 78 497 0.00% 79 591 0.00% 80 646 0.00% 81 730 0.00% 82 796 0.00% 83 1024 0.00% 84 988 0.00% 85 1256 0.00% 86 1352 0.00% 87 1424 0.00% 88 1651 0.00% 89 1858 0.00% 90 1980 0.01% 91 2248 0.01% 92 2456 0.01% 93 2860 0.01% 94 3216 0.01% 95 3373 0.01% 96 3789 0.01% 97 3942 0.01% 98 4448 0.01% 99 4720 0.01% 100 5232 0.01% 101 5462 0.01% 102 6100 0.02% 103 6640 0.02% 104 7072 0.02% 105 7518 0.02% 106 8124 0.02% 107 8555 0.02% 108 9259 0.02% 109 9987 0.03% 110 10213 0.03% 111 11123 0.03% 112 11668 0.03% 113 12499 0.03% 114 13652 0.04% 115 14392 0.04% 116 15109 0.04% 117 15771 0.04% 118 16666 0.04% 119 17252 0.05% 120 18350 0.05% 121 19095 0.05% 122 20066 0.05% 123 20792 0.06% 124 22394 0.06% 125 24001 0.06% 126 24792 0.07% 127 25623 0.07% 128 26552 0.07% 129 27648 0.07% 130 28462 0.08% 131 29777 0.08% 132 31499 0.08% 133 32586 0.09% 134 33908 0.09% 135 35482 0.09% 136 36724 0.10% 137 37981 0.10% 138 38747 0.10% 139 40899 0.11% 140 41869 0.11% 141 43516 0.12% 142 45254 0.12% 143 47202 0.13% 144 48308 0.13% 145 50643 0.13% 146 52128 0.14% 147 53606 0.14% 148 55793 0.15% 149 56728 0.15% 150 58758 0.16% 151 36350583 96.31% 37743014 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=6.54 fanout-score-rank=16 prefix-density=0.73 prefix-fanout=4.0 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=27.53 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.88 fanout-score-rank=39 prefix-density=0.40 prefix-fanout=1.6 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=98.18 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=12.2 sequence=CCGCCGCCGCCTCC SRR8450147 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:11:08 Started mapping on | Dec 06 10:11:08 Finished on | Dec 06 10:16:11 Mapping speed, Million of reads per hour | 448.43 Number of input reads | 37743014 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 34329219 Uniquely mapped reads % | 90.96% Average mapped length | 299.30 Number of splices: Total | 36297744 Number of splices: Annotated (sjdb) | 34007288 Number of splices: GT/AG | 35802093 Number of splices: GC/AG | 425706 Number of splices: AT/AC | 15885 Number of splices: Non-canonical | 54060 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.83 Insertion rate per base | 0.01% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406616 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 37472 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.12% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3007179 3007179 3007179 N_multimapping 406616 406616 406616 N_noFeature 1163012 33320683 1464160 N_ambiguous 867912 5810 161693 UnstrandedReadsAssigned:32298295 PositiveStrandReadsAssigned:1002726 NegativeStrandReadsAssigned:32703366 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450147 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450147-trimmed-pair1.fastq SRR8450147-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,743,014 reads, 34,236,421 reads pseudoaligned [quant] estimated average fragment length: 308.265 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR8450147.ke.tsv 35125 SRR8450147.se.tsv 88098 total ==> SRR8450147.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 629.705 0 0 PNS24247 1044 736.735 71.8841 3.82831 PNS24249 1928 1620.74 242.551 5.87188 PNS24246 1044 736.735 71.8841 3.82831 PNS24248 1044 736.735 71.8841 3.82831 PNS24244 1471 1163.74 121.797 4.10646 PNS24243 293 78.2281 0 0 KQK14069 1603 1295.74 11935.9 361.43 KQK14071 474 203.109 83.7816 16.1848 ==> SRR8450147.se.tsv <== BRADI_1g14170v3 11987 BRADI_1g53295v3 355 BRADI_1g59795v3 574 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 430 BRADI_1g74790v3 116 BRADI_1g09890v3 3 BRADI_1g77505v3 633 BRADI_1g48960v3 0 SRR8450147 completed mapping pipeline successfully