Starting /dee2/code/volunteer_pipeline.sh SRR8450148 current disk space = 1551953637376 free memory = 1602215984 SRR8450148 SRAfilesize 5aa6683c222da4694e2ef28f3f5f359a SRR8450148.sra SRR8450148.sra file validated SRR8450148 is paired end SRR8450148 is conventional basespace SRR8450148 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450148_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1725 37.0 37.0 37.0 37.0 37.0 2 36.2545 37.0 37.0 37.0 37.0 37.0 3 36.34 37.0 37.0 37.0 37.0 37.0 4 36.4945 37.0 37.0 37.0 37.0 37.0 5 36.4205 37.0 37.0 37.0 37.0 37.0 6 36.578 37.0 37.0 37.0 37.0 37.0 7 36.4495 37.0 37.0 37.0 37.0 37.0 8 36.4745 37.0 37.0 37.0 37.0 37.0 9 36.425 37.0 37.0 37.0 37.0 37.0 10-14 36.4277 37.0 37.0 37.0 37.0 37.0 15-19 36.36149999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4489 37.0 37.0 37.0 37.0 37.0 25-29 36.33969999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3919 37.0 37.0 37.0 37.0 37.0 35-39 36.3271 37.0 37.0 37.0 37.0 37.0 40-44 36.31270000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.351800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.23309999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.2408 37.0 37.0 37.0 37.0 37.0 60-64 36.2054 37.0 37.0 37.0 37.0 37.0 65-69 36.0789 37.0 37.0 37.0 37.0 37.0 70-74 36.2299 37.0 37.0 37.0 37.0 37.0 75-79 36.196400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2011 37.0 37.0 37.0 37.0 37.0 85-89 36.074299999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.1582 37.0 37.0 37.0 37.0 37.0 95-99 36.0622 37.0 37.0 37.0 37.0 37.0 100-104 36.070800000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9981 37.0 37.0 37.0 37.0 37.0 110-114 35.93730000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.9524 37.0 37.0 37.0 37.0 37.0 120-124 35.9334 37.0 37.0 37.0 37.0 37.0 125-129 35.8892 37.0 37.0 37.0 37.0 37.0 130-134 35.8817 37.0 37.0 37.0 37.0 37.0 135-139 35.78830000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.849 37.0 37.0 37.0 37.0 37.0 145-149 35.8172 37.0 37.0 37.0 37.0 37.0 150-151 35.226749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 0.0 25 5.0 26 4.0 27 15.0 28 13.0 29 20.0 30 32.0 31 49.0 32 57.0 33 98.0 34 159.0 35 362.0 36 2762.0 37 421.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.53266331658292 11.206030150753769 8.542713567839195 33.71859296482412 2 28.825 12.425 28.050000000000004 30.7 3 22.375 16.725 22.025 38.875 4 26.6 23.35 20.599999999999998 29.45 5 28.849999999999998 24.6 23.05 23.5 6 26.224999999999998 28.15 22.725 22.900000000000002 7 19.425 24.224999999999998 37.05 19.3 8 22.0 22.5 29.049999999999997 26.450000000000003 9 21.375 21.025 31.65 25.95 10-14 23.815 25.31 25.05 25.825 15-19 24.66 23.635 25.635 26.07 20-24 24.279999999999998 24.21 24.98 26.529999999999998 25-29 24.6 24.39 24.77 26.240000000000002 30-34 24.64 23.74 24.86 26.76 35-39 24.4 24.555 24.415 26.63 40-44 24.7 24.25 24.97 26.08 45-49 24.85 24.465 23.965 26.72 50-54 25.06 24.085 24.435000000000002 26.419999999999998 55-59 25.03 23.79 24.385 26.795 60-64 25.28 23.82 24.81 26.090000000000003 65-69 24.165 24.545 24.185000000000002 27.105 70-74 25.324999999999996 23.32 24.945 26.41 75-79 24.625 23.705000000000002 24.575 27.095000000000002 80-84 25.014999999999997 23.794999999999998 24.025 27.165 85-89 25.145 23.905 24.32 26.63 90-94 25.330000000000002 23.445 23.715 27.51 95-99 25.115 23.235 24.685000000000002 26.965 100-104 25.900000000000002 23.78 24.015 26.305 105-109 25.119999999999997 23.925 24.58 26.375 110-114 25.405 23.565 24.135 26.895000000000003 115-119 25.31 24.310000000000002 24.13 26.25 120-124 25.790000000000003 23.875 23.565 26.77 125-129 25.585 23.34 23.745 27.33 130-134 25.895000000000003 23.39 24.245 26.47 135-139 25.765 23.7 23.735 26.8 140-144 25.06 23.255 24.94 26.745 145-149 25.355 23.105 24.4 27.139999999999997 150-151 25.8125 22.650000000000002 24.587500000000002 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 2.5 30 4.5 31 7.0 32 13.0 33 20.0 34 22.5 35 20.5 36 30.5 37 52.0 38 65.5 39 77.5 40 92.5 41 112.0 42 131.5 43 161.5 44 172.0 45 164.5 46 179.0 47 175.5 48 160.0 49 161.5 50 159.5 51 151.0 52 132.5 53 129.0 54 121.0 55 99.0 56 101.0 57 99.5 58 87.5 59 94.0 60 95.5 61 87.5 62 79.5 63 77.0 64 86.0 65 82.0 66 76.5 67 66.0 68 53.5 69 46.0 70 41.5 71 39.0 72 34.5 73 33.0 74 28.5 75 23.5 76 17.0 77 9.0 78 6.0 79 5.0 80 4.5 81 2.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.88531505404693 89.97500000000001 2 4.824677036646454 9.15 3 0.23727919852359608 0.675 4 0.05272871078302136 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0125 0.0 0.0 110-111 0.30000000000000004 0.0 0.025 0.0 0.0 112-113 0.375 0.0 0.025 0.0 0.0 114-115 0.4 0.0 0.025 0.0 0.0 116-117 0.4625 0.0 0.025 0.0 0.0 118-119 0.55 0.0 0.025 0.0 0.0 120-121 0.55 0.0 0.025 0.0 0.0 122-123 0.6125 0.0 0.025 0.0 0.0 124-125 0.7 0.0 0.025 0.0 0.0 126-127 0.75 0.0 0.025 0.0 0.0 128-129 0.9375 0.0 0.025 0.0 0.0 130-131 1.0750000000000002 0.0 0.025 0.0 0.0 132-133 1.2125 0.0 0.025 0.0 0.0 134-135 1.3 0.0 0.025 0.0 0.0 136-137 1.4874999999999998 0.0 0.025 0.0 0.0 138-139 1.6 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGATT 10 0.006830828 145.0 1 >>END_MODULE SRR8450148 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450148_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0045 37.0 37.0 37.0 37.0 37.0 2 35.592 37.0 37.0 37.0 37.0 37.0 3 35.663 37.0 37.0 37.0 37.0 37.0 4 35.696 37.0 37.0 37.0 37.0 37.0 5 35.5945 37.0 37.0 37.0 37.0 37.0 6 35.5695 37.0 37.0 37.0 37.0 37.0 7 35.7225 37.0 37.0 37.0 37.0 37.0 8 35.654 37.0 37.0 37.0 37.0 37.0 9 35.6275 37.0 37.0 37.0 37.0 37.0 10-14 35.4961 37.0 37.0 37.0 37.0 37.0 15-19 35.4578 37.0 37.0 37.0 37.0 37.0 20-24 35.381099999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.256299999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.223 37.0 37.0 37.0 37.0 37.0 35-39 35.2045 37.0 37.0 37.0 37.0 37.0 40-44 35.1144 37.0 37.0 37.0 32.2 37.0 45-49 35.2019 37.0 37.0 37.0 37.0 37.0 50-54 34.9399 37.0 37.0 37.0 27.4 37.0 55-59 35.146699999999996 37.0 37.0 37.0 34.6 37.0 60-64 35.080799999999996 37.0 37.0 37.0 32.2 37.0 65-69 35.0273 37.0 37.0 37.0 32.2 37.0 70-74 34.9868 37.0 37.0 37.0 25.0 37.0 75-79 35.0172 37.0 37.0 37.0 29.8 37.0 80-84 34.8975 37.0 37.0 37.0 25.0 37.0 85-89 34.936400000000006 37.0 37.0 37.0 25.0 37.0 90-94 34.8968 37.0 37.0 37.0 25.0 37.0 95-99 34.8806 37.0 37.0 37.0 25.0 37.0 100-104 34.90939999999999 37.0 37.0 37.0 27.4 37.0 105-109 34.902 37.0 37.0 37.0 25.0 37.0 110-114 34.80830000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.8532 37.0 37.0 37.0 25.0 37.0 120-124 34.75869999999999 37.0 37.0 37.0 25.0 37.0 125-129 34.709 37.0 37.0 37.0 25.0 37.0 130-134 34.709199999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.60170000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.3995 37.0 37.0 37.0 25.0 37.0 145-149 34.4414 37.0 37.0 37.0 25.0 37.0 150-151 33.75075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 13.0 14 15.0 15 26.0 16 11.0 17 12.0 18 6.0 19 6.0 20 11.0 21 19.0 22 24.0 23 29.0 24 18.0 25 19.0 26 21.0 27 14.0 28 20.0 29 31.0 30 33.0 31 59.0 32 76.0 33 111.0 34 256.0 35 554.0 36 2417.0 37 198.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.825 17.525 12.2 30.45 2 33.7 21.9 22.025 22.375 3 26.674999999999997 24.05 25.6 23.674999999999997 4 29.75 27.275 18.95 24.025 5 30.975 28.599999999999998 18.125 22.3 6 27.025 32.574999999999996 19.475 20.925 7 26.025 19.7 29.725 24.55 8 28.775000000000002 21.75 20.575 28.9 9 26.525 22.675 24.0 26.8 10-14 28.4 24.535 20.66 26.405 15-19 28.08 24.185000000000002 22.215 25.52 20-24 27.445000000000004 24.66 21.865000000000002 26.029999999999998 25-29 28.02 23.94 22.009999999999998 26.029999999999998 30-34 26.93 24.88 22.02 26.169999999999998 35-39 27.595 25.419999999999998 21.15 25.835 40-44 27.055 25.119999999999997 21.65 26.174999999999997 45-49 27.845 24.779999999999998 21.415 25.96 50-54 26.935 25.895000000000003 21.255 25.915 55-59 27.310000000000002 25.205 21.455 26.029999999999998 60-64 26.88 25.205 21.26 26.655 65-69 26.795 25.275 21.634999999999998 26.295 70-74 26.745 25.019999999999996 22.295 25.94 75-79 26.619999999999997 25.665 21.685 26.029999999999998 80-84 26.97 25.169999999999998 22.065 25.795 85-89 27.265 25.080000000000002 21.415 26.240000000000002 90-94 27.01 24.915000000000003 21.81 26.265 95-99 26.595000000000002 25.624999999999996 21.965 25.814999999999998 100-104 26.845000000000002 25.2 22.2 25.755 105-109 27.48 25.06 21.67 25.790000000000003 110-114 27.415 26.419999999999998 21.25 24.915000000000003 115-119 27.465 25.765 21.13 25.64 120-124 26.57 25.165 21.834999999999997 26.43 125-129 27.089999999999996 25.75 21.48 25.679999999999996 130-134 27.650000000000002 24.72 22.075 25.555 135-139 26.924999999999997 25.795 22.345000000000002 24.935 140-144 27.43 25.330000000000002 21.825 25.415 145-149 27.279999999999998 25.56 21.93 25.230000000000004 150-151 26.674999999999997 25.7625 22.162499999999998 25.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.5 8 1.5 9 2.0 10 2.0 11 1.0 12 0.5 13 1.5 14 2.5 15 2.0 16 1.5 17 1.5 18 1.0 19 0.5 20 1.5 21 3.0 22 2.5 23 0.5 24 1.0 25 2.0 26 2.0 27 2.0 28 3.5 29 5.0 30 5.5 31 6.5 32 12.0 33 14.0 34 15.0 35 15.5 36 25.0 37 45.0 38 55.5 39 59.5 40 80.5 41 98.0 42 113.0 43 129.5 44 127.5 45 134.0 46 144.0 47 148.5 48 161.0 49 166.5 50 150.5 51 136.5 52 114.0 53 101.0 54 98.5 55 108.0 56 118.5 57 110.0 58 100.0 59 89.5 60 88.0 61 93.0 62 102.5 63 103.0 64 83.0 65 76.5 66 89.0 67 86.5 68 75.5 69 68.0 70 68.5 71 62.5 72 52.5 73 48.5 74 40.5 75 30.5 76 19.5 77 16.0 78 14.5 79 6.5 80 4.0 81 4.0 82 2.5 83 2.5 84 2.5 85 1.5 86 1.0 87 1.0 88 1.0 89 1.5 90 3.0 91 2.0 92 0.0 93 1.0 94 1.0 95 0.5 96 1.0 97 1.0 98 1.5 99 1.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.78168264110755 89.0 2 4.659211927582534 8.75 3 0.3993610223642172 1.125 4 0.05324813631522897 0.2 5 0.026624068157614485 0.125 6 0.026624068157614485 0.15 7 0.026624068157614485 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026624068157614485 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 6 0.15 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.025 0.0 0.0 0.0 0.025 96-97 0.025 0.0 0.0 0.0 0.025 98-99 0.037500000000000006 0.0 0.0 0.0 0.025 100-101 0.125 0.0 0.0 0.0 0.025 102-103 0.15 0.0 0.0 0.0 0.025 104-105 0.2 0.0 0.0 0.0 0.025 106-107 0.225 0.0 0.0 0.0 0.025 108-109 0.25 0.0 0.0 0.0 0.025 110-111 0.30000000000000004 0.0 0.0 0.0 0.025 112-113 0.375 0.0 0.0 0.0 0.025 114-115 0.4 0.0 0.0 0.0 0.025 116-117 0.4375 0.0 0.0 0.0 0.025 118-119 0.525 0.0 0.0 0.0 0.025 120-121 0.525 0.0 0.0 0.0 0.025 122-123 0.5874999999999999 0.0 0.0 0.0 0.025 124-125 0.675 0.0 0.0 0.0 0.025 126-127 0.725 0.0 0.0 0.0 0.025 128-129 0.9125 0.0 0.0 0.0 0.025 130-131 1.0625 0.0 0.0 0.0 0.025 132-133 1.1875 0.0 0.0 0.0 0.025 134-135 1.2625000000000002 0.0 0.0 0.0 0.025 136-137 1.4375 0.0 0.0 0.0 0.025 138-139 1.5499999999999998 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACGGG 10 0.006830828 145.0 8 >>END_MODULE Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375687 spots for SRR8450148.sra Written 1375687 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra Read 1375677 spots for SRR8450148.sra Written 1375677 spots for SRR8450148.sra SRR ids: ['SRR8450148.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a75z6o7n SRR8450148.sra spots: 27513550 blocks: [[1, 1375677], [1375678, 2751354], [2751355, 4127031], [4127032, 5502708], [5502709, 6878385], [6878386, 8254062], [8254063, 9629739], [9629740, 11005416], [11005417, 12381093], [12381094, 13756770], [13756771, 15132447], [15132448, 16508124], [16508125, 17883801], [17883802, 19259478], [19259479, 20635155], [20635156, 22010832], [22010833, 23386509], [23386510, 24762186], [24762187, 26137863], [26137864, 27513550]] SRR8450148 file size 9301738 SRR8450148 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450148 SRR8450148_1.fastq SRR8450148_2.fastq Input file: SRR8450148_1.fastq Paired file: SRR8450148_2.fastq trimmed: SRR8450148-trimmed-pair1.fastq, SRR8450148-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:06:45 2024 >> started Fri Dec 6 10:07:13 2024 >> done (28.417s) 27513550 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 14500 ( 0.05%) empty read pairs filtered out after trimming by size control 27499022 (99.95%) read pairs available; of these: 887583 ( 3.23%) trimmed read pairs available after processing 26611439 (96.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 9 0.00% 21 8 0.00% 22 9 0.00% 23 9 0.00% 24 15 0.00% 25 10 0.00% 26 14 0.00% 27 9 0.00% 28 16 0.00% 29 14 0.00% 30 17 0.00% 31 18 0.00% 32 17 0.00% 33 19 0.00% 34 16 0.00% 35 18 0.00% 36 16 0.00% 37 16 0.00% 38 23 0.00% 39 36 0.00% 40 18 0.00% 41 21 0.00% 42 26 0.00% 43 37 0.00% 44 24 0.00% 45 29 0.00% 46 28 0.00% 47 26 0.00% 48 29 0.00% 49 24 0.00% 50 30 0.00% 51 36 0.00% 52 33 0.00% 53 35 0.00% 54 35 0.00% 55 46 0.00% 56 49 0.00% 57 46 0.00% 58 39 0.00% 59 52 0.00% 60 46 0.00% 61 49 0.00% 62 64 0.00% 63 76 0.00% 64 61 0.00% 65 55 0.00% 66 82 0.00% 67 79 0.00% 68 76 0.00% 69 82 0.00% 70 97 0.00% 71 128 0.00% 72 136 0.00% 73 153 0.00% 74 188 0.00% 75 190 0.00% 76 206 0.00% 77 199 0.00% 78 224 0.00% 79 283 0.00% 80 290 0.00% 81 296 0.00% 82 399 0.00% 83 416 0.00% 84 531 0.00% 85 564 0.00% 86 605 0.00% 87 669 0.00% 88 718 0.00% 89 837 0.00% 90 901 0.00% 91 1055 0.00% 92 1224 0.00% 93 1297 0.00% 94 1517 0.01% 95 1562 0.01% 96 1867 0.01% 97 2104 0.01% 98 2146 0.01% 99 2433 0.01% 100 2674 0.01% 101 2938 0.01% 102 3118 0.01% 103 3517 0.01% 104 3783 0.01% 105 4081 0.01% 106 4527 0.02% 107 4778 0.02% 108 5111 0.02% 109 5418 0.02% 110 5904 0.02% 111 6294 0.02% 112 6928 0.03% 113 7392 0.03% 114 7891 0.03% 115 8451 0.03% 116 9038 0.03% 117 9457 0.03% 118 9900 0.04% 119 10354 0.04% 120 11035 0.04% 121 11666 0.04% 122 12478 0.05% 123 13119 0.05% 124 14065 0.05% 125 14771 0.05% 126 15505 0.06% 127 16309 0.06% 128 16883 0.06% 129 17584 0.06% 130 18306 0.07% 131 19108 0.07% 132 20196 0.07% 133 21501 0.08% 134 22188 0.08% 135 23158 0.08% 136 24242 0.09% 137 25039 0.09% 138 25723 0.09% 139 26812 0.10% 140 27745 0.10% 141 28813 0.10% 142 30445 0.11% 143 31368 0.11% 144 32570 0.12% 145 33851 0.12% 146 34902 0.13% 147 36210 0.13% 148 37522 0.14% 149 38362 0.14% 150 39671 0.14% 151 26611439 96.77% 27499022 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=16 prefix-density=0.88 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=32.89 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.20 sequence-density-rank=19 fanout-score=61.33 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=12.1 sequence=GCCGCCGCCGCC SRR8450148 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:08:08 Started mapping on | Dec 06 10:08:08 Finished on | Dec 06 10:12:31 Mapping speed, Million of reads per hour | 376.41 Number of input reads | 27499022 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24800612 Uniquely mapped reads % | 90.19% Average mapped length | 299.66 Number of splices: Total | 26788159 Number of splices: Annotated (sjdb) | 25156587 Number of splices: GT/AG | 26428691 Number of splices: GC/AG | 312168 Number of splices: AT/AC | 10274 Number of splices: Non-canonical | 37026 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.70 Insertion rate per base | 0.01% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319902 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 38759 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.49% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2378508 2378508 2378508 N_multimapping 319902 319902 319902 N_noFeature 740806 24075822 934893 N_ambiguous 647180 3853 117992 UnstrandedReadsAssigned:23412626 PositiveStrandReadsAssigned:720937 NegativeStrandReadsAssigned:23747727 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450148 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450148-trimmed-pair1.fastq SRR8450148-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,499,022 reads, 24,732,169 reads pseudoaligned [quant] estimated average fragment length: 310.17 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR8450148.ke.tsv 35125 SRR8450148.se.tsv 88098 total ==> SRR8450148.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.562 0 0 PNS24247 1044 734.83 78.0317 5.62064 PNS24249 1928 1618.83 166.835 5.45491 PNS24246 1044 734.83 78.0317 5.62064 PNS24248 1044 734.83 78.0317 5.62064 PNS24244 1471 1161.83 71.07 3.23777 PNS24243 293 76.4074 0 0 KQK14069 1603 1293.83 10809.3 442.205 KQK14071 474 200.814 130.577 34.4171 ==> SRR8450148.se.tsv <== BRADI_1g14170v3 11152 BRADI_1g53295v3 196 BRADI_1g59795v3 280 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 398 BRADI_1g74790v3 136 BRADI_1g09890v3 0 BRADI_1g77505v3 338 BRADI_1g48960v3 0 SRR8450148 completed mapping pipeline successfully