Starting /dee2/code/volunteer_pipeline.sh SRR8450149 current disk space = 1551773724672 free memory = 1604604388 SRR8450149 SRAfilesize e8f0f38bd4850544dfb741a43b6999e9 SRR8450149.sra SRR8450149.sra file validated SRR8450149 is paired end SRR8450149 is conventional basespace SRR8450149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.03075 37.0 37.0 37.0 37.0 37.0 2 36.26 37.0 37.0 37.0 37.0 37.0 3 36.456 37.0 37.0 37.0 37.0 37.0 4 36.4805 37.0 37.0 37.0 37.0 37.0 5 36.4255 37.0 37.0 37.0 37.0 37.0 6 36.5675 37.0 37.0 37.0 37.0 37.0 7 36.407 37.0 37.0 37.0 37.0 37.0 8 36.458 37.0 37.0 37.0 37.0 37.0 9 36.467 37.0 37.0 37.0 37.0 37.0 10-14 36.48799999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4024 37.0 37.0 37.0 37.0 37.0 20-24 36.4731 37.0 37.0 37.0 37.0 37.0 25-29 36.334500000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3471 37.0 37.0 37.0 37.0 37.0 35-39 36.3516 37.0 37.0 37.0 37.0 37.0 40-44 36.3647 37.0 37.0 37.0 37.0 37.0 45-49 36.319100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3019 37.0 37.0 37.0 37.0 37.0 55-59 36.2736 37.0 37.0 37.0 37.0 37.0 60-64 36.244800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.1155 37.0 37.0 37.0 37.0 37.0 70-74 36.2391 37.0 37.0 37.0 37.0 37.0 75-79 36.2632 37.0 37.0 37.0 37.0 37.0 80-84 36.2496 37.0 37.0 37.0 37.0 37.0 85-89 36.1611 37.0 37.0 37.0 37.0 37.0 90-94 36.187799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1554 37.0 37.0 37.0 37.0 37.0 100-104 36.0207 37.0 37.0 37.0 37.0 37.0 105-109 36.112700000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.0548 37.0 37.0 37.0 37.0 37.0 115-119 35.9893 37.0 37.0 37.0 37.0 37.0 120-124 35.9346 37.0 37.0 37.0 37.0 37.0 125-129 35.878699999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9088 37.0 37.0 37.0 37.0 37.0 135-139 35.8121 37.0 37.0 37.0 37.0 37.0 140-144 35.81699999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7636 37.0 37.0 37.0 37.0 37.0 150-151 35.244 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 0.0 25 1.0 26 8.0 27 5.0 28 16.0 29 29.0 30 32.0 31 38.0 32 66.0 33 103.0 34 149.0 35 322.0 36 2752.0 37 476.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.56261022927689 10.959939531368104 8.818342151675484 36.65910808767951 2 26.76338169084542 12.256128064032017 29.514757378689342 31.465732866433214 3 24.425 15.6 22.375 37.6 4 27.575 21.9 20.125 30.4 5 28.325 26.275 21.625 23.775 6 24.425 29.599999999999998 22.3 23.674999999999997 7 19.75 25.1 36.075 19.075 8 21.575 23.125 28.499999999999996 26.8 9 21.45 22.975 31.574999999999996 24.0 10-14 24.654999999999998 25.845000000000002 24.015 25.485000000000003 15-19 24.515 23.865 24.815 26.805 20-24 24.195 24.825 24.775 26.205000000000002 25-29 24.355 24.6 24.97 26.075 30-34 24.48 23.65 24.59 27.279999999999998 35-39 23.9 25.345000000000002 24.27 26.484999999999996 40-44 24.605 24.445 24.345 26.605 45-49 24.13 24.779999999999998 23.95 27.139999999999997 50-54 23.97 24.26 24.685000000000002 27.084999999999997 55-59 24.465 24.47 24.33 26.735 60-64 24.445 23.799999999999997 24.765 26.99 65-69 24.39 23.64 24.675 27.295 70-74 24.84 23.64 24.645 26.875 75-79 24.84 24.05 24.64 26.47 80-84 25.385 24.085 23.985 26.545 85-89 25.115 23.810000000000002 24.67 26.405 90-94 25.64 23.51 24.43 26.419999999999998 95-99 25.629999999999995 23.56 24.015 26.795 100-104 25.835 23.380000000000003 24.265 26.52 105-109 24.990000000000002 23.755000000000003 24.104999999999997 27.150000000000002 110-114 25.314999999999998 23.735 24.485 26.465 115-119 25.4 23.86 23.785 26.955000000000002 120-124 25.55 24.065 23.39 26.995 125-129 24.925 23.71 24.26 27.105 130-134 25.7 23.599999999999998 24.205 26.495 135-139 25.324999999999996 24.45 23.685000000000002 26.540000000000003 140-144 25.46 23.630000000000003 23.43 27.48 145-149 25.569999999999997 24.205 23.69 26.534999999999997 150-151 25.7875 23.025000000000002 24.2375 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 2.5 29 3.5 30 4.0 31 6.0 32 11.0 33 17.0 34 22.5 35 27.5 36 40.5 37 52.0 38 63.0 39 78.0 40 94.0 41 119.5 42 142.5 43 164.0 44 176.5 45 171.5 46 169.0 47 174.0 48 173.0 49 160.5 50 157.0 51 145.5 52 125.5 53 121.5 54 111.0 55 108.0 56 106.0 57 89.5 58 92.0 59 100.5 60 88.0 61 74.5 62 74.5 63 70.0 64 64.0 65 73.0 66 71.0 67 64.0 68 63.5 69 56.5 70 50.5 71 44.5 72 33.0 73 26.5 74 30.5 75 24.5 76 16.5 77 17.0 78 12.5 79 5.0 80 2.5 81 2.5 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.81618619412853 89.625 2 4.681301243057392 8.85 3 0.3967204443268976 1.125 4 0.10579211848717271 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5249999999999999 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2999999999999998 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.1 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.375 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8450149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.95 37.0 37.0 37.0 37.0 37.0 2 35.47 37.0 37.0 37.0 37.0 37.0 3 35.6275 37.0 37.0 37.0 37.0 37.0 4 35.623 37.0 37.0 37.0 37.0 37.0 5 35.554 37.0 37.0 37.0 37.0 37.0 6 35.446 37.0 37.0 37.0 37.0 37.0 7 35.5065 37.0 37.0 37.0 37.0 37.0 8 35.588 37.0 37.0 37.0 37.0 37.0 9 35.549 37.0 37.0 37.0 37.0 37.0 10-14 35.389700000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.3745 37.0 37.0 37.0 37.0 37.0 20-24 35.327999999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.21900000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.1528 37.0 37.0 37.0 34.6 37.0 35-39 35.188700000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.0524 37.0 37.0 37.0 32.2 37.0 45-49 35.0978 37.0 37.0 37.0 34.6 37.0 50-54 34.9923 37.0 37.0 37.0 29.8 37.0 55-59 35.0154 37.0 37.0 37.0 27.4 37.0 60-64 35.004900000000006 37.0 37.0 37.0 27.4 37.0 65-69 34.964 37.0 37.0 37.0 27.4 37.0 70-74 34.8669 37.0 37.0 37.0 25.0 37.0 75-79 34.90149999999999 37.0 37.0 37.0 25.0 37.0 80-84 34.8418 37.0 37.0 37.0 25.0 37.0 85-89 34.8301 37.0 37.0 37.0 25.0 37.0 90-94 34.8506 37.0 37.0 37.0 25.0 37.0 95-99 34.8158 37.0 37.0 37.0 25.0 37.0 100-104 34.815200000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.8153 37.0 37.0 37.0 27.4 37.0 110-114 34.744299999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.7256 37.0 37.0 37.0 25.0 37.0 120-124 34.6287 37.0 37.0 37.0 25.0 37.0 125-129 34.5738 37.0 37.0 37.0 25.0 37.0 130-134 34.5224 37.0 37.0 37.0 25.0 37.0 135-139 34.446299999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.2693 37.0 37.0 37.0 25.0 37.0 145-149 34.3378 37.0 37.0 37.0 25.0 37.0 150-151 33.4725 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 6.0 13 15.0 14 16.0 15 21.0 16 7.0 17 8.0 18 5.0 19 5.0 20 15.0 21 11.0 22 27.0 23 39.0 24 26.0 25 25.0 26 19.0 27 15.0 28 28.0 29 31.0 30 43.0 31 52.0 32 88.0 33 126.0 34 225.0 35 613.0 36 2363.0 37 171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 17.5 11.875 33.25 2 34.75 20.474999999999998 22.275 22.5 3 26.35 24.7 23.5 25.45 4 29.9 27.375 18.075 24.65 5 31.075000000000003 29.375 18.099999999999998 21.45 6 25.775 33.475 18.675 22.075 7 25.424999999999997 19.625 30.099999999999998 24.85 8 27.1 22.375 22.25 28.275 9 26.05 22.675 25.25 26.025 10-14 28.084999999999997 24.465 20.95 26.5 15-19 27.71 24.085 21.93 26.275 20-24 27.525 24.425 21.88 26.169999999999998 25-29 26.674999999999997 24.855 21.959999999999997 26.51 30-34 26.790000000000003 24.86 22.345000000000002 26.005 35-39 26.655 25.124999999999996 22.005 26.215 40-44 27.38 24.33 22.264999999999997 26.025 45-49 26.895000000000003 24.765 22.045 26.295 50-54 26.724999999999998 24.58 22.43 26.265 55-59 27.765 24.6 21.495 26.14 60-64 27.265 24.265 22.27 26.200000000000003 65-69 26.790000000000003 24.87 21.965 26.375 70-74 27.200000000000003 24.55 21.790000000000003 26.46 75-79 26.87 24.185000000000002 22.56 26.384999999999998 80-84 27.279999999999998 25.655 21.59 25.474999999999998 85-89 27.395000000000003 23.995 22.35 26.26 90-94 27.279999999999998 23.84 22.865 26.015 95-99 27.189999999999998 25.195 22.23 25.385 100-104 27.415 24.995 22.165000000000003 25.424999999999997 105-109 27.994999999999997 24.41 21.895 25.7 110-114 27.865000000000002 25.080000000000002 22.395 24.66 115-119 27.615000000000002 25.11 22.055 25.22 120-124 27.58 25.365 21.915000000000003 25.14 125-129 27.715 24.765 22.415 25.105 130-134 27.99 25.455 21.745 24.81 135-139 27.785 24.83 22.79 24.595 140-144 27.935 25.380000000000003 22.285 24.4 145-149 27.775 25.629999999999995 22.195 24.4 150-151 27.712500000000002 25.387500000000003 22.45 24.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.5 13 0.5 14 1.0 15 2.0 16 3.0 17 2.0 18 0.5 19 1.5 20 2.0 21 2.0 22 2.0 23 2.5 24 2.5 25 2.0 26 3.5 27 3.0 28 1.5 29 4.0 30 9.0 31 11.0 32 9.5 33 14.0 34 20.5 35 23.0 36 26.5 37 34.0 38 47.5 39 64.0 40 84.0 41 102.0 42 117.0 43 134.5 44 154.5 45 156.5 46 144.5 47 143.0 48 148.5 49 145.5 50 134.5 51 124.0 52 116.5 53 108.0 54 102.5 55 95.0 56 87.5 57 93.0 58 100.5 59 101.5 60 103.5 61 106.5 62 100.5 63 87.0 64 86.0 65 98.0 66 91.0 67 71.5 68 75.0 69 78.0 70 65.5 71 63.5 72 57.0 73 48.0 74 39.5 75 31.0 76 26.5 77 17.0 78 8.5 79 7.0 80 5.0 81 2.5 82 1.5 83 2.0 84 1.5 85 1.0 86 2.0 87 1.5 88 1.0 89 1.0 90 1.0 91 1.5 92 2.0 93 1.0 94 0.0 95 2.0 96 3.5 97 1.5 98 1.0 99 1.5 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.99602859412232 89.7 2 4.527402700555997 8.55 3 0.4236166269526079 1.2 4 0.0 0.0 5 0.026476039184537992 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026476039184537992 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5249999999999999 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.55 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.85 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTTGT 10 0.006830828 145.0 1 >>END_MODULE Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872153 spots for SRR8450149.sra Written 1872153 spots for SRR8450149.sra Read 1872157 spots for SRR8450149.sra Written 1872157 spots for SRR8450149.sra SRR ids: ['SRR8450149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qhjv3k6c SRR8450149.sra spots: 37443064 blocks: [[1, 1872153], [1872154, 3744306], [3744307, 5616459], [5616460, 7488612], [7488613, 9360765], [9360766, 11232918], [11232919, 13105071], [13105072, 14977224], [14977225, 16849377], [16849378, 18721530], [18721531, 20593683], [20593684, 22465836], [22465837, 24337989], [24337990, 26210142], [26210143, 28082295], [28082296, 29954448], [29954449, 31826601], [31826602, 33698754], [33698755, 35570907], [35570908, 37443064]] SRR8450149 file size 12666525 SRR8450149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450149 SRR8450149_1.fastq SRR8450149_2.fastq Input file: SRR8450149_1.fastq Paired file: SRR8450149_2.fastq trimmed: SRR8450149-trimmed-pair1.fastq, SRR8450149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:19:38 2024 >> started Fri Dec 6 10:20:16 2024 >> done (38.480s) 37443064 read pairs processed; of these: 61 ( 0.00%) short read pairs filtered out after trimming by size control 43780 ( 0.12%) empty read pairs filtered out after trimming by size control 37399223 (99.88%) read pairs available; of these: 1885115 ( 5.04%) trimmed read pairs available after processing 35514108 (94.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 10 0.00% 21 9 0.00% 22 15 0.00% 23 11 0.00% 24 6 0.00% 25 14 0.00% 26 15 0.00% 27 9 0.00% 28 12 0.00% 29 22 0.00% 30 17 0.00% 31 14 0.00% 32 25 0.00% 33 19 0.00% 34 24 0.00% 35 30 0.00% 36 28 0.00% 37 29 0.00% 38 24 0.00% 39 26 0.00% 40 24 0.00% 41 22 0.00% 42 31 0.00% 43 33 0.00% 44 33 0.00% 45 39 0.00% 46 35 0.00% 47 45 0.00% 48 49 0.00% 49 37 0.00% 50 47 0.00% 51 49 0.00% 52 50 0.00% 53 49 0.00% 54 57 0.00% 55 49 0.00% 56 52 0.00% 57 56 0.00% 58 80 0.00% 59 65 0.00% 60 94 0.00% 61 102 0.00% 62 107 0.00% 63 128 0.00% 64 141 0.00% 65 149 0.00% 66 142 0.00% 67 180 0.00% 68 215 0.00% 69 221 0.00% 70 287 0.00% 71 321 0.00% 72 327 0.00% 73 397 0.00% 74 421 0.00% 75 484 0.00% 76 538 0.00% 77 594 0.00% 78 773 0.00% 79 748 0.00% 80 897 0.00% 81 984 0.00% 82 1205 0.00% 83 1348 0.00% 84 1464 0.00% 85 1698 0.00% 86 1857 0.00% 87 2142 0.01% 88 2381 0.01% 89 2542 0.01% 90 2947 0.01% 91 3172 0.01% 92 3599 0.01% 93 3964 0.01% 94 4458 0.01% 95 4991 0.01% 96 5345 0.01% 97 5812 0.02% 98 6213 0.02% 99 6933 0.02% 100 7324 0.02% 101 7947 0.02% 102 8826 0.02% 103 9397 0.03% 104 10134 0.03% 105 10994 0.03% 106 11896 0.03% 107 12749 0.03% 108 13460 0.04% 109 14185 0.04% 110 15006 0.04% 111 15745 0.04% 112 16544 0.04% 113 17932 0.05% 114 18986 0.05% 115 20128 0.05% 116 21350 0.06% 117 22176 0.06% 118 23488 0.06% 119 24450 0.07% 120 25809 0.07% 121 27006 0.07% 122 27847 0.07% 123 29825 0.08% 124 31191 0.08% 125 32584 0.09% 126 33686 0.09% 127 35899 0.10% 128 36984 0.10% 129 37998 0.10% 130 39667 0.11% 131 40879 0.11% 132 42925 0.11% 133 44630 0.12% 134 45726 0.12% 135 48221 0.13% 136 49374 0.13% 137 51198 0.14% 138 52248 0.14% 139 54826 0.15% 140 55825 0.15% 141 57663 0.15% 142 60128 0.16% 143 61865 0.17% 144 63872 0.17% 145 65892 0.18% 146 67321 0.18% 147 69140 0.18% 148 71755 0.19% 149 73305 0.20% 150 75513 0.20% 151 35514108 94.96% 37399223 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=15 prefix-density=0.92 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=28.60 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.21 sequence-density-rank=16 fanout-score=63.38 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=12.4 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGGTGGACATCAGAAAGTATACTG SRR8450149 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:21:04 Started mapping on | Dec 06 10:21:04 Finished on | Dec 06 10:25:23 Mapping speed, Million of reads per hour | 519.83 Number of input reads | 37399223 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 34550800 Uniquely mapped reads % | 92.38% Average mapped length | 298.87 Number of splices: Total | 36952567 Number of splices: Annotated (sjdb) | 34794010 Number of splices: GT/AG | 36462000 Number of splices: GC/AG | 424658 Number of splices: AT/AC | 14369 Number of splices: Non-canonical | 51540 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407494 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 51916 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.35% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2440929 2440929 2440929 N_multimapping 407494 407494 407494 N_noFeature 931445 33580639 1189764 N_ambiguous 871796 4734 162311 UnstrandedReadsAssigned:32747559 PositiveStrandReadsAssigned:965427 NegativeStrandReadsAssigned:33198725 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450149-trimmed-pair1.fastq SRR8450149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,399,223 reads, 34,369,383 reads pseudoaligned [quant] estimated average fragment length: 289.008 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR8450149.ke.tsv 35125 SRR8450149.se.tsv 88098 total ==> SRR8450149.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.535 0 0 PNS24247 1044 755.992 77.3162 3.8803 PNS24249 1928 1639.99 213.828 4.94692 PNS24246 1044 755.992 77.3162 3.8803 PNS24248 1044 755.992 77.3162 3.8803 PNS24244 1471 1182.99 44.2234 1.41835 PNS24243 293 81.8362 0 0 KQK14069 1603 1314.99 10141.1 292.6 KQK14071 474 213.65 111.408 19.7845 ==> SRR8450149.se.tsv <== BRADI_1g14170v3 10377 BRADI_1g53295v3 136 BRADI_1g59795v3 372 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 1564 BRADI_1g74790v3 150 BRADI_1g09890v3 4 BRADI_1g77505v3 610 BRADI_1g48960v3 1 SRR8450149 completed mapping pipeline successfully