Starting /dee2/code/volunteer_pipeline.sh SRR8450150 current disk space = 1551890145280 free memory = 1604597380 SRR8450150 SRAfilesize 28def7b07dc5f76b4d11ef248f1ba81b SRR8450150.sra SRR8450150.sra file validated SRR8450150 is paired end SRR8450150 is conventional basespace SRR8450150 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450150_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0095 37.0 37.0 37.0 37.0 37.0 2 36.2535 37.0 37.0 37.0 37.0 37.0 3 36.425 37.0 37.0 37.0 37.0 37.0 4 36.4015 37.0 37.0 37.0 37.0 37.0 5 36.426 37.0 37.0 37.0 37.0 37.0 6 36.432 37.0 37.0 37.0 37.0 37.0 7 36.4085 37.0 37.0 37.0 37.0 37.0 8 36.3935 37.0 37.0 37.0 37.0 37.0 9 36.421 37.0 37.0 37.0 37.0 37.0 10-14 36.5039 37.0 37.0 37.0 37.0 37.0 15-19 36.4182 37.0 37.0 37.0 37.0 37.0 20-24 36.467200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.312400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.404999999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.3842 37.0 37.0 37.0 37.0 37.0 40-44 36.3399 37.0 37.0 37.0 37.0 37.0 45-49 36.3092 37.0 37.0 37.0 37.0 37.0 50-54 36.330200000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2741 37.0 37.0 37.0 37.0 37.0 60-64 36.25279999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.133300000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.2776 37.0 37.0 37.0 37.0 37.0 75-79 36.2382 37.0 37.0 37.0 37.0 37.0 80-84 36.2621 37.0 37.0 37.0 37.0 37.0 85-89 36.1897 37.0 37.0 37.0 37.0 37.0 90-94 36.2199 37.0 37.0 37.0 37.0 37.0 95-99 36.1258 37.0 37.0 37.0 37.0 37.0 100-104 36.03189999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1445 37.0 37.0 37.0 37.0 37.0 110-114 35.9755 37.0 37.0 37.0 37.0 37.0 115-119 36.0055 37.0 37.0 37.0 37.0 37.0 120-124 35.9611 37.0 37.0 37.0 37.0 37.0 125-129 35.8923 37.0 37.0 37.0 37.0 37.0 130-134 35.928200000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.832800000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.839800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.812200000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.247 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 3.0 26 8.0 27 10.0 28 21.0 29 31.0 30 30.0 31 32.0 32 59.0 33 105.0 34 135.0 35 332.0 36 2728.0 37 506.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.74307304785894 11.51133501259446 8.261964735516372 34.48362720403023 2 26.900000000000002 11.825 29.7 31.574999999999996 3 23.1 15.1 21.85 39.95 4 27.400000000000002 20.9 21.825 29.875 5 27.675 25.474999999999998 22.5 24.349999999999998 6 24.275 27.125 24.325 24.275 7 20.625 22.7 36.8 19.875 8 22.275 22.95 27.875 26.900000000000002 9 21.45 21.875 31.55 25.124999999999996 10-14 24.474999999999998 25.105 24.79 25.629999999999995 15-19 24.725 23.919999999999998 25.295 26.06 20-24 24.560000000000002 24.04 25.785000000000004 25.615 25-29 24.87 24.145 24.765 26.22 30-34 24.495 23.655 25.41 26.44 35-39 24.75 24.060000000000002 24.165 27.025 40-44 24.975 24.154999999999998 24.705 26.165 45-49 24.465 23.75 24.855 26.93 50-54 24.595 23.465 24.705 27.235 55-59 25.15 24.18 24.169999999999998 26.5 60-64 24.595 23.79 24.365000000000002 27.250000000000004 65-69 24.990000000000002 23.599999999999998 24.59 26.82 70-74 25.75 23.369999999999997 24.575 26.305 75-79 25.040000000000003 23.615 24.34 27.005000000000003 80-84 25.355 24.265 24.065 26.314999999999998 85-89 25.069999999999997 23.29 25.39 26.25 90-94 25.36 23.605 24.240000000000002 26.795 95-99 25.445 22.939999999999998 24.92 26.695 100-104 25.41 23.425 24.205 26.96 105-109 25.25 23.474999999999998 24.29 26.985 110-114 25.264999999999997 23.51 24.785 26.44 115-119 25.55 23.74 24.45 26.26 120-124 25.215 23.87 24.279999999999998 26.634999999999998 125-129 25.695 23.935000000000002 24.044999999999998 26.325 130-134 25.569999999999997 23.56 23.995 26.875 135-139 25.91 23.544999999999998 23.75 26.795 140-144 25.900000000000002 22.78 24.125 27.195000000000004 145-149 25.569999999999997 22.875 24.3 27.255000000000003 150-151 25.637500000000003 24.0375 23.95 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.5 29 3.5 30 3.0 31 6.5 32 10.0 33 13.0 34 19.5 35 32.0 36 37.0 37 45.0 38 54.5 39 66.0 40 100.0 41 127.5 42 135.5 43 149.0 44 167.0 45 183.0 46 174.5 47 164.0 48 153.5 49 151.5 50 150.0 51 150.5 52 158.0 53 132.5 54 116.0 55 111.5 56 110.5 57 108.0 58 100.0 59 95.5 60 84.0 61 78.0 62 75.5 63 71.0 64 74.0 65 77.0 66 72.0 67 63.5 68 58.0 69 49.0 70 43.5 71 39.0 72 37.5 73 36.0 74 31.0 75 24.5 76 18.5 77 12.0 78 9.0 79 6.0 80 2.0 81 2.5 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 94.70619375330863 89.45 2 4.764425622022235 9.0 3 0.4764425622022234 1.35 4 0.05293806246691372 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.1375 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138-139 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAATT 10 0.006830828 145.0 4 GGCATGT 10 0.006830828 145.0 4 TTCCCCG 10 0.006830828 145.0 8 GCTAATT 10 0.006830828 145.0 2 GCGCTGC 10 0.006830828 145.0 2 GCATGTT 10 0.006830828 145.0 5 >>END_MODULE SRR8450150 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450150_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.012 37.0 37.0 37.0 37.0 37.0 2 35.486 37.0 37.0 37.0 37.0 37.0 3 35.497 37.0 37.0 37.0 37.0 37.0 4 35.5815 37.0 37.0 37.0 37.0 37.0 5 35.465 37.0 37.0 37.0 37.0 37.0 6 35.3365 37.0 37.0 37.0 37.0 37.0 7 35.455 37.0 37.0 37.0 37.0 37.0 8 35.547 37.0 37.0 37.0 37.0 37.0 9 35.446 37.0 37.0 37.0 37.0 37.0 10-14 35.329299999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.2571 37.0 37.0 37.0 37.0 37.0 20-24 35.24490000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.1366 37.0 37.0 37.0 37.0 37.0 30-34 35.1074 37.0 37.0 37.0 34.6 37.0 35-39 35.087199999999996 37.0 37.0 37.0 34.6 37.0 40-44 34.982299999999995 37.0 37.0 37.0 27.4 37.0 45-49 35.0752 37.0 37.0 37.0 32.2 37.0 50-54 34.954100000000004 37.0 37.0 37.0 25.0 37.0 55-59 34.9787 37.0 37.0 37.0 29.8 37.0 60-64 34.951 37.0 37.0 37.0 25.0 37.0 65-69 34.984500000000004 37.0 37.0 37.0 29.8 37.0 70-74 34.8377 37.0 37.0 37.0 25.0 37.0 75-79 34.90490000000001 37.0 37.0 37.0 25.0 37.0 80-84 34.9133 37.0 37.0 37.0 25.0 37.0 85-89 34.80069999999999 37.0 37.0 37.0 25.0 37.0 90-94 34.7697 37.0 37.0 37.0 25.0 37.0 95-99 34.7711 37.0 37.0 37.0 25.0 37.0 100-104 34.780699999999996 37.0 37.0 37.0 25.0 37.0 105-109 34.799 37.0 37.0 37.0 25.0 37.0 110-114 34.7629 37.0 37.0 37.0 25.0 37.0 115-119 34.7154 37.0 37.0 37.0 25.0 37.0 120-124 34.68579999999999 37.0 37.0 37.0 25.0 37.0 125-129 34.547399999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.4728 37.0 37.0 37.0 25.0 37.0 135-139 34.4851 37.0 37.0 37.0 25.0 37.0 140-144 34.1519 37.0 37.0 37.0 25.0 37.0 145-149 34.2965 37.0 37.0 37.0 25.0 37.0 150-151 33.46125 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 16.0 14 19.0 15 15.0 16 8.0 17 12.0 18 11.0 19 13.0 20 14.0 21 23.0 22 23.0 23 31.0 24 17.0 25 32.0 26 11.0 27 27.0 28 27.0 29 35.0 30 37.0 31 65.0 32 69.0 33 136.0 34 205.0 35 528.0 36 2424.0 37 197.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.875 17.65 11.5 30.975 2 34.375 22.725 22.45 20.45 3 25.924999999999997 25.0 24.474999999999998 24.6 4 29.9 26.85 19.0 24.25 5 29.799999999999997 30.175 18.15 21.875 6 26.674999999999997 32.800000000000004 18.725 21.8 7 26.150000000000002 19.325 29.625 24.9 8 27.175 22.900000000000002 20.525 29.4 9 25.1 23.200000000000003 25.55 26.150000000000002 10-14 27.36 25.929999999999996 20.44 26.27 15-19 27.405 24.5 21.815 26.279999999999998 20-24 27.1 25.290000000000003 21.55 26.06 25-29 26.740000000000002 25.05 21.855 26.355 30-34 26.47 25.474999999999998 21.94 26.115 35-39 26.365 25.89 21.64 26.105 40-44 26.58 26.125 21.41 25.885 45-49 26.565 25.555 21.21 26.669999999999998 50-54 26.795 25.569999999999997 21.905 25.729999999999997 55-59 27.47 25.295 21.39 25.845000000000002 60-64 26.805 25.855 21.095 26.245 65-69 27.145000000000003 25.52 21.51 25.825 70-74 27.250000000000004 26.424999999999997 21.18 25.145 75-79 26.445 24.685000000000002 22.75 26.119999999999997 80-84 26.6 26.02 21.990000000000002 25.39 85-89 27.74 24.77 21.959999999999997 25.53 90-94 26.88 25.865 22.015 25.240000000000002 95-99 27.075 25.545 21.84 25.540000000000003 100-104 27.055 25.505 21.435000000000002 26.005 105-109 26.334999999999997 25.7 21.795 26.169999999999998 110-114 27.605 25.46 21.529999999999998 25.405 115-119 27.029999999999998 25.245 22.12 25.605 120-124 26.384999999999998 25.365 22.35 25.900000000000002 125-129 27.63 25.305 21.795 25.27 130-134 27.405 25.955000000000002 21.15 25.490000000000002 135-139 27.644999999999996 25.2 21.759999999999998 25.395 140-144 27.779999999999998 26.119999999999997 21.525 24.575 145-149 27.560000000000002 26.13 21.805 24.505 150-151 26.924999999999997 25.6 22.0625 25.412499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 1.0 6 2.5 7 2.0 8 1.5 9 3.0 10 2.0 11 0.5 12 1.0 13 1.5 14 4.0 15 5.5 16 4.0 17 2.5 18 2.0 19 1.5 20 1.0 21 2.5 22 2.5 23 0.5 24 0.5 25 3.0 26 4.0 27 3.0 28 2.0 29 5.5 30 8.0 31 6.5 32 8.0 33 13.0 34 16.0 35 20.0 36 33.5 37 36.0 38 47.5 39 71.0 40 87.5 41 109.5 42 122.5 43 134.5 44 144.5 45 154.5 46 166.5 47 156.5 48 139.0 49 139.0 50 129.0 51 110.5 52 110.0 53 100.5 54 100.0 55 104.0 56 104.0 57 115.5 58 105.0 59 103.0 60 116.0 61 106.0 62 92.5 63 92.0 64 86.5 65 82.0 66 84.0 67 76.5 68 67.0 69 70.0 70 67.5 71 59.0 72 47.5 73 35.5 74 35.5 75 29.0 76 17.0 77 13.5 78 12.5 79 7.5 80 5.5 81 4.5 82 3.0 83 3.0 84 2.5 85 1.0 86 1.0 87 2.0 88 2.0 89 1.5 90 1.0 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.5 97 1.0 98 1.0 99 1.5 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.23305084745762 89.9 2 4.210805084745763 7.95 3 0.3707627118644068 1.05 4 0.1059322033898305 0.4 5 0.05296610169491525 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026483050847457626 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCA 5 0.125 No Hit CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8500000000000001 0.0 0.0 0.0 0.0 126-127 0.9625 0.0 0.0 0.0 0.0 128-129 1.1125 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138-139 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra Read 1835004 spots for SRR8450150.sra Written 1835004 spots for SRR8450150.sra SRR ids: ['SRR8450150.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dj9yay9k SRR8450150.sra spots: 36700080 blocks: [[1, 1835004], [1835005, 3670008], [3670009, 5505012], [5505013, 7340016], [7340017, 9175020], [9175021, 11010024], [11010025, 12845028], [12845029, 14680032], [14680033, 16515036], [16515037, 18350040], [18350041, 20185044], [20185045, 22020048], [22020049, 23855052], [23855053, 25690056], [25690057, 27525060], [27525061, 29360064], [29360065, 31195068], [31195069, 33030072], [33030073, 34865076], [34865077, 36700080]] SRR8450150 file size 12414752 SRR8450150 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450150 SRR8450150_1.fastq SRR8450150_2.fastq Input file: SRR8450150_1.fastq Paired file: SRR8450150_2.fastq trimmed: SRR8450150-trimmed-pair1.fastq, SRR8450150-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:18:22 2024 >> started Fri Dec 6 10:19:12 2024 >> done (50.743s) 36700080 read pairs processed; of these: 62 ( 0.00%) short read pairs filtered out after trimming by size control 29600 ( 0.08%) empty read pairs filtered out after trimming by size control 36670418 (99.92%) read pairs available; of these: 1489056 ( 4.06%) trimmed read pairs available after processing 35181362 (95.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 6 0.00% 21 9 0.00% 22 14 0.00% 23 10 0.00% 24 18 0.00% 25 18 0.00% 26 15 0.00% 27 20 0.00% 28 27 0.00% 29 22 0.00% 30 23 0.00% 31 18 0.00% 32 29 0.00% 33 28 0.00% 34 28 0.00% 35 39 0.00% 36 27 0.00% 37 27 0.00% 38 31 0.00% 39 41 0.00% 40 34 0.00% 41 34 0.00% 42 37 0.00% 43 48 0.00% 44 40 0.00% 45 38 0.00% 46 42 0.00% 47 40 0.00% 48 44 0.00% 49 38 0.00% 50 54 0.00% 51 47 0.00% 52 51 0.00% 53 62 0.00% 54 61 0.00% 55 56 0.00% 56 70 0.00% 57 87 0.00% 58 106 0.00% 59 75 0.00% 60 87 0.00% 61 111 0.00% 62 121 0.00% 63 158 0.00% 64 156 0.00% 65 152 0.00% 66 162 0.00% 67 193 0.00% 68 215 0.00% 69 230 0.00% 70 270 0.00% 71 267 0.00% 72 333 0.00% 73 390 0.00% 74 434 0.00% 75 462 0.00% 76 521 0.00% 77 638 0.00% 78 683 0.00% 79 775 0.00% 80 806 0.00% 81 952 0.00% 82 1108 0.00% 83 1279 0.00% 84 1378 0.00% 85 1538 0.00% 86 1797 0.00% 87 1920 0.01% 88 2066 0.01% 89 2291 0.01% 90 2541 0.01% 91 2816 0.01% 92 3044 0.01% 93 3310 0.01% 94 3885 0.01% 95 4192 0.01% 96 4450 0.01% 97 4983 0.01% 98 5164 0.01% 99 5682 0.02% 100 5941 0.02% 101 6519 0.02% 102 7030 0.02% 103 7682 0.02% 104 8013 0.02% 105 8541 0.02% 106 9231 0.03% 107 9910 0.03% 108 10566 0.03% 109 11158 0.03% 110 11716 0.03% 111 12491 0.03% 112 13271 0.04% 113 13770 0.04% 114 14600 0.04% 115 15679 0.04% 116 16601 0.05% 117 17059 0.05% 118 18128 0.05% 119 18985 0.05% 120 19706 0.05% 121 20800 0.06% 122 21261 0.06% 123 22746 0.06% 124 24089 0.07% 125 25754 0.07% 126 26263 0.07% 127 27578 0.08% 128 28234 0.08% 129 29482 0.08% 130 30650 0.08% 131 31589 0.09% 132 32866 0.09% 133 34597 0.09% 134 35847 0.10% 135 37755 0.10% 136 38893 0.11% 137 39924 0.11% 138 41376 0.11% 139 42540 0.12% 140 43992 0.12% 141 45199 0.12% 142 47641 0.13% 143 48393 0.13% 144 50222 0.14% 145 52747 0.14% 146 54106 0.15% 147 55894 0.15% 148 57989 0.16% 149 59999 0.16% 150 60950 0.17% 151 35181362 95.94% 36670418 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=22 prefix-density=0.74 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=32.98 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=15 prefix-density=0.52 prefix-fanout=3.0 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=25 fanout-score=81.92 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=12.2 sequence=CCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR8450150 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:19:58 Started mapping on | Dec 06 10:19:59 Finished on | Dec 06 10:24:27 Mapping speed, Million of reads per hour | 492.59 Number of input reads | 36670418 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 33859888 Uniquely mapped reads % | 92.34% Average mapped length | 299.20 Number of splices: Total | 36582151 Number of splices: Annotated (sjdb) | 34386209 Number of splices: GT/AG | 36088951 Number of splices: GC/AG | 424690 Number of splices: AT/AC | 14272 Number of splices: Non-canonical | 54238 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.79 Insertion rate per base | 0.01% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395988 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 35568 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.78% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2414542 2414542 2414542 N_multimapping 395988 395988 395988 N_noFeature 962992 32864788 1252044 N_ambiguous 866696 5229 163670 UnstrandedReadsAssigned:32030200 PositiveStrandReadsAssigned:989871 NegativeStrandReadsAssigned:32444174 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450150 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450150-trimmed-pair1.fastq SRR8450150-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,670,418 reads, 33,646,089 reads pseudoaligned [quant] estimated average fragment length: 298.478 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52973 SRR8450150.ke.tsv 35125 SRR8450150.se.tsv 88098 total ==> SRR8450150.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 639.233 0 0 PNS24247 1044 746.522 87.7552 4.71084 PNS24249 1928 1630.52 246.393 6.05579 PNS24246 1044 746.522 87.7552 4.71084 PNS24248 1044 746.522 87.7552 4.71084 PNS24244 1471 1173.52 42.3409 1.4459 PNS24243 293 78.244 0 0 KQK14069 1603 1305.52 16699.6 512.615 KQK14071 474 206.662 190.305 36.9026 ==> SRR8450150.se.tsv <== BRADI_1g14170v3 17167 BRADI_1g53295v3 351 BRADI_1g59795v3 275 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 462 BRADI_1g74790v3 248 BRADI_1g09890v3 0 BRADI_1g77505v3 522 BRADI_1g48960v3 0 SRR8450150 completed mapping pipeline successfully