Starting /dee2/code/volunteer_pipeline.sh SRR8450151 current disk space = 1551911718912 free memory = 1604590752 SRR8450151 SRAfilesize 83790b904d26bfb73fca3bd1e1b69067 SRR8450151.sra SRR8450151.sra file validated SRR8450151 is paired end SRR8450151 is conventional basespace SRR8450151 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450151_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.08675 37.0 37.0 37.0 37.0 37.0 2 36.328 37.0 37.0 37.0 37.0 37.0 3 36.3355 37.0 37.0 37.0 37.0 37.0 4 36.3585 37.0 37.0 37.0 37.0 37.0 5 36.434 37.0 37.0 37.0 37.0 37.0 6 36.4185 37.0 37.0 37.0 37.0 37.0 7 36.237 37.0 37.0 37.0 37.0 37.0 8 36.4225 37.0 37.0 37.0 37.0 37.0 9 36.4625 37.0 37.0 37.0 37.0 37.0 10-14 36.445 37.0 37.0 37.0 37.0 37.0 15-19 36.343 37.0 37.0 37.0 37.0 37.0 20-24 36.4155 37.0 37.0 37.0 37.0 37.0 25-29 36.34589999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3381 37.0 37.0 37.0 37.0 37.0 35-39 36.278999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.29430000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.2654 37.0 37.0 37.0 37.0 37.0 50-54 36.2313 37.0 37.0 37.0 37.0 37.0 55-59 36.2113 37.0 37.0 37.0 37.0 37.0 60-64 36.162800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.09740000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.191100000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.171299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.13549999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.0835 37.0 37.0 37.0 37.0 37.0 90-94 36.1098 37.0 37.0 37.0 37.0 37.0 95-99 36.0674 37.0 37.0 37.0 37.0 37.0 100-104 35.9781 37.0 37.0 37.0 37.0 37.0 105-109 36.010400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9058 37.0 37.0 37.0 37.0 37.0 115-119 35.938500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.8578 37.0 37.0 37.0 37.0 37.0 125-129 35.886199999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.80050000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7936 37.0 37.0 37.0 37.0 37.0 140-144 35.7659 37.0 37.0 37.0 37.0 37.0 145-149 35.6871 37.0 37.0 37.0 37.0 37.0 150-151 35.1195 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 6.0 27 13.0 28 20.0 29 23.0 30 32.0 31 51.0 32 77.0 33 108.0 34 165.0 35 356.0 36 2752.0 37 394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.84900928016052 11.713067469275144 7.674943566591422 34.76297968397291 2 26.674999999999997 13.450000000000001 28.349999999999998 31.525 3 22.45 16.475 23.175 37.9 4 29.2 22.475 20.0 28.325 5 27.900000000000002 26.950000000000003 22.275 22.875 6 23.75 29.4 23.3 23.549999999999997 7 20.5 22.400000000000002 36.375 20.724999999999998 8 22.25 23.225 27.650000000000002 26.875 9 20.5 21.45 32.5 25.55 10-14 24.2 24.845 25.215 25.740000000000002 15-19 24.47 23.685000000000002 25.36 26.484999999999996 20-24 24.33 24.7 24.86 26.11 25-29 24.67 24.240000000000002 24.51 26.58 30-34 24.305 24.65 24.63 26.415 35-39 24.015 24.46 24.715 26.810000000000002 40-44 24.965 24.05 24.185000000000002 26.8 45-49 24.68 24.125 24.38 26.815 50-54 24.94 24.125 24.560000000000002 26.375 55-59 24.72 24.25 24.57 26.46 60-64 24.385 24.154999999999998 24.88 26.58 65-69 24.845 24.365000000000002 24.305 26.484999999999996 70-74 25.035 23.65 24.87 26.445 75-79 25.405 24.095 24.255 26.245 80-84 24.39 24.135 24.59 26.884999999999998 85-89 25.295 24.345 23.915 26.445 90-94 25.435000000000002 23.86 24.035 26.669999999999998 95-99 24.915000000000003 23.835 24.46 26.790000000000003 100-104 25.165 23.985 24.375 26.474999999999998 105-109 25.455 23.365 24.75 26.43 110-114 25.53 23.405 24.275 26.790000000000003 115-119 26.064999999999998 23.494999999999997 23.57 26.87 120-124 25.474999999999998 23.355 24.19 26.979999999999997 125-129 25.69 23.43 24.240000000000002 26.640000000000004 130-134 26.455000000000002 23.755000000000003 23.525 26.265 135-139 25.835 23.49 23.875 26.8 140-144 25.52 24.135 23.52 26.825 145-149 25.705 23.23 23.96 27.105 150-151 25.887500000000003 23.175 24.25 26.687499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 2.5 29 3.5 30 4.5 31 9.0 32 15.5 33 21.5 34 24.5 35 31.5 36 48.5 37 57.5 38 64.0 39 86.5 40 104.5 41 118.5 42 140.5 43 153.5 44 172.5 45 171.5 46 158.5 47 170.0 48 171.0 49 158.5 50 143.0 51 131.5 52 122.0 53 115.5 54 115.0 55 106.0 56 95.5 57 90.5 58 84.0 59 82.0 60 89.0 61 88.0 62 79.5 63 72.0 64 69.5 65 86.5 66 85.0 67 68.0 68 63.5 69 52.0 70 46.5 71 45.5 72 39.0 73 33.0 74 26.5 75 22.5 76 19.5 77 12.5 78 10.0 79 7.0 80 2.0 81 2.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90399165144795 91.9 2 3.8612053222019305 7.3999999999999995 3 0.20871380120010435 0.6 4 0.026089225150013044 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5875 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 1.95 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.2125 0.0 0.0 0.0 0.0 138-139 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGCCG 10 0.006830828 145.0 9 >>END_MODULE SRR8450151 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450151_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9615 37.0 37.0 37.0 37.0 37.0 2 35.644 37.0 37.0 37.0 37.0 37.0 3 35.607 37.0 37.0 37.0 37.0 37.0 4 35.66 37.0 37.0 37.0 37.0 37.0 5 35.633 37.0 37.0 37.0 37.0 37.0 6 35.4215 37.0 37.0 37.0 37.0 37.0 7 35.478 37.0 37.0 37.0 37.0 37.0 8 35.4735 37.0 37.0 37.0 37.0 37.0 9 35.5955 37.0 37.0 37.0 37.0 37.0 10-14 35.41330000000001 37.0 37.0 37.0 37.0 37.0 15-19 35.299 37.0 37.0 37.0 37.0 37.0 20-24 35.2978 37.0 37.0 37.0 37.0 37.0 25-29 35.1875 37.0 37.0 37.0 37.0 37.0 30-34 35.127300000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.1742 37.0 37.0 37.0 37.0 37.0 40-44 35.1048 37.0 37.0 37.0 34.6 37.0 45-49 35.125699999999995 37.0 37.0 37.0 34.6 37.0 50-54 34.9617 37.0 37.0 37.0 27.4 37.0 55-59 35.011399999999995 37.0 37.0 37.0 32.2 37.0 60-64 34.953700000000005 37.0 37.0 37.0 25.0 37.0 65-69 34.979499999999994 37.0 37.0 37.0 25.0 37.0 70-74 34.8528 37.0 37.0 37.0 25.0 37.0 75-79 34.952799999999996 37.0 37.0 37.0 25.0 37.0 80-84 34.856 37.0 37.0 37.0 25.0 37.0 85-89 34.8557 37.0 37.0 37.0 27.4 37.0 90-94 34.8031 37.0 37.0 37.0 25.0 37.0 95-99 34.7796 37.0 37.0 37.0 25.0 37.0 100-104 34.838300000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.796499999999995 37.0 37.0 37.0 25.0 37.0 110-114 34.773199999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.700900000000004 37.0 37.0 37.0 25.0 37.0 120-124 34.596199999999996 37.0 37.0 37.0 25.0 37.0 125-129 34.511300000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.468599999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.459500000000006 37.0 37.0 37.0 25.0 37.0 140-144 34.1572 37.0 37.0 37.0 25.0 37.0 145-149 34.2606 37.0 37.0 37.0 25.0 37.0 150-151 33.4745 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 8.0 14 26.0 15 26.0 16 11.0 17 8.0 18 5.0 19 8.0 20 14.0 21 22.0 22 26.0 23 32.0 24 24.0 25 15.0 26 21.0 27 15.0 28 37.0 29 31.0 30 42.0 31 62.0 32 77.0 33 140.0 34 211.0 35 515.0 36 2374.0 37 248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.475 18.2 11.15 30.175 2 34.849999999999994 20.424999999999997 22.55 22.175 3 27.150000000000002 23.150000000000002 25.825 23.875 4 28.499999999999996 29.025000000000002 18.35 24.125 5 31.1 29.25 18.775 20.875 6 26.5 32.975 18.8 21.725 7 25.825 19.675 29.849999999999998 24.65 8 27.275 22.375 20.875 29.475 9 26.125 22.225 23.825 27.825 10-14 28.305000000000003 24.315 21.315 26.064999999999998 15-19 27.67 24.47 21.775 26.085 20-24 26.805 25.295 21.95 25.95 25-29 27.105 24.93 21.905 26.06 30-34 26.87 25.674999999999997 22.07 25.385 35-39 26.529999999999998 25.480000000000004 21.634999999999998 26.355 40-44 27.115000000000002 25.064999999999998 22.189999999999998 25.629999999999995 45-49 26.5 25.515 21.759999999999998 26.224999999999998 50-54 26.97 26.14 21.77 25.119999999999997 55-59 27.544999999999998 24.795 21.490000000000002 26.169999999999998 60-64 27.41 25.490000000000002 21.43 25.669999999999998 65-69 26.935 25.240000000000002 22.075 25.75 70-74 27.185 25.53 21.535 25.75 75-79 26.69 25.64 22.465 25.205 80-84 27.384999999999998 25.505 21.69 25.419999999999998 85-89 27.0 25.285000000000004 21.834999999999997 25.88 90-94 26.295 25.685000000000002 22.134999999999998 25.885 95-99 26.86 25.759999999999998 21.93 25.45 100-104 27.169999999999998 25.650000000000002 21.69 25.490000000000002 105-109 26.85 25.374999999999996 21.605 26.169999999999998 110-114 26.825 26.06 22.215 24.9 115-119 26.96 25.540000000000003 22.0 25.5 120-124 26.790000000000003 25.745 21.955 25.509999999999998 125-129 26.784999999999997 25.95 21.815 25.45 130-134 26.755000000000003 26.345000000000002 21.63 25.27 135-139 26.995 26.384999999999998 22.015 24.605 140-144 27.075 25.91 22.33 24.685000000000002 145-149 27.045 25.919999999999998 21.84 25.195 150-151 26.75 26.6625 21.05 25.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.0 6 1.0 7 2.5 8 3.0 9 1.0 10 0.5 11 1.5 12 3.5 13 3.5 14 4.5 15 5.0 16 2.5 17 2.0 18 4.5 19 4.5 20 2.0 21 1.5 22 1.5 23 4.5 24 6.0 25 4.0 26 3.0 27 3.0 28 3.0 29 5.0 30 6.0 31 8.0 32 12.0 33 14.0 34 14.5 35 20.5 36 37.5 37 46.5 38 48.5 39 64.0 40 87.5 41 108.0 42 116.0 43 128.0 44 135.5 45 138.5 46 152.0 47 168.0 48 167.0 49 143.0 50 123.0 51 112.0 52 115.5 53 114.5 54 103.5 55 94.5 56 80.0 57 89.5 58 111.0 59 106.0 60 88.5 61 86.5 62 97.0 63 99.5 64 94.0 65 83.0 66 68.5 67 74.0 68 84.5 69 76.0 70 73.5 71 64.5 72 50.5 73 42.5 74 34.5 75 32.0 76 29.0 77 18.0 78 9.5 79 7.0 80 3.5 81 2.5 82 4.0 83 3.0 84 2.0 85 2.5 86 1.5 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 1.5 93 3.0 94 2.0 95 1.5 96 1.5 97 2.0 98 2.0 99 1.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.87059442398737 91.125 2 3.682272488164124 7.000000000000001 3 0.34192530247238295 0.975 4 0.052603892688058915 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026301946344029457 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026301946344029457 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 21 0.525 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.3624999999999998 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.125 0.0 0.0 0.0 0.0 138-139 2.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 35 0.0035366106 20.714287 130-134 >>END_MODULE Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378033 spots for SRR8450151.sra Written 1378033 spots for SRR8450151.sra Read 1378039 spots for SRR8450151.sra Written 1378039 spots for SRR8450151.sra SRR ids: ['SRR8450151.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_30ugm4c4 SRR8450151.sra spots: 27560666 blocks: [[1, 1378033], [1378034, 2756066], [2756067, 4134099], [4134100, 5512132], [5512133, 6890165], [6890166, 8268198], [8268199, 9646231], [9646232, 11024264], [11024265, 12402297], [12402298, 13780330], [13780331, 15158363], [15158364, 16536396], [16536397, 17914429], [17914430, 19292462], [19292463, 20670495], [20670496, 22048528], [22048529, 23426561], [23426562, 24804594], [24804595, 26182627], [26182628, 27560666]] SRR8450151 file size 9317704 SRR8450151 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450151 SRR8450151_1.fastq SRR8450151_2.fastq Input file: SRR8450151_1.fastq Paired file: SRR8450151_2.fastq trimmed: SRR8450151-trimmed-pair1.fastq, SRR8450151-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:17:53 2024 >> started Fri Dec 6 10:18:26 2024 >> done (33.020s) 27560666 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 12518 ( 0.05%) empty read pairs filtered out after trimming by size control 27548099 (99.95%) read pairs available; of these: 1167001 ( 4.24%) trimmed read pairs available after processing 26381098 (95.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 7 0.00% 21 7 0.00% 22 8 0.00% 23 17 0.00% 24 13 0.00% 25 13 0.00% 26 14 0.00% 27 18 0.00% 28 17 0.00% 29 21 0.00% 30 23 0.00% 31 25 0.00% 32 27 0.00% 33 28 0.00% 34 22 0.00% 35 27 0.00% 36 22 0.00% 37 28 0.00% 38 38 0.00% 39 31 0.00% 40 48 0.00% 41 36 0.00% 42 35 0.00% 43 39 0.00% 44 61 0.00% 45 39 0.00% 46 45 0.00% 47 35 0.00% 48 42 0.00% 49 56 0.00% 50 46 0.00% 51 44 0.00% 52 54 0.00% 53 56 0.00% 54 55 0.00% 55 67 0.00% 56 49 0.00% 57 71 0.00% 58 82 0.00% 59 87 0.00% 60 80 0.00% 61 76 0.00% 62 127 0.00% 63 130 0.00% 64 123 0.00% 65 142 0.00% 66 137 0.00% 67 142 0.00% 68 173 0.00% 69 198 0.00% 70 235 0.00% 71 259 0.00% 72 260 0.00% 73 298 0.00% 74 340 0.00% 75 360 0.00% 76 401 0.00% 77 476 0.00% 78 555 0.00% 79 602 0.00% 80 620 0.00% 81 730 0.00% 82 868 0.00% 83 903 0.00% 84 1032 0.00% 85 1225 0.00% 86 1297 0.00% 87 1456 0.01% 88 1540 0.01% 89 1704 0.01% 90 1906 0.01% 91 2213 0.01% 92 2510 0.01% 93 2761 0.01% 94 3038 0.01% 95 3239 0.01% 96 3612 0.01% 97 3907 0.01% 98 4252 0.02% 99 4517 0.02% 100 4959 0.02% 101 5294 0.02% 102 5785 0.02% 103 6113 0.02% 104 6670 0.02% 105 7210 0.03% 106 7649 0.03% 107 7933 0.03% 108 8378 0.03% 109 8860 0.03% 110 9227 0.03% 111 9960 0.04% 112 10855 0.04% 113 11331 0.04% 114 11841 0.04% 115 12919 0.05% 116 13271 0.05% 117 13764 0.05% 118 14587 0.05% 119 15078 0.05% 120 15674 0.06% 121 16438 0.06% 122 16995 0.06% 123 18209 0.07% 124 19409 0.07% 125 20255 0.07% 126 21189 0.08% 127 21608 0.08% 128 22372 0.08% 129 23325 0.08% 130 23976 0.09% 131 24953 0.09% 132 25818 0.09% 133 27523 0.10% 134 28036 0.10% 135 29787 0.11% 136 30607 0.11% 137 31269 0.11% 138 32235 0.12% 139 33304 0.12% 140 34161 0.12% 141 35163 0.13% 142 36586 0.13% 143 37669 0.14% 144 39433 0.14% 145 40869 0.15% 146 41344 0.15% 147 42616 0.15% 148 44020 0.16% 149 44998 0.16% 150 45564 0.17% 151 26381098 95.76% 27548099 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=23 prefix-density=0.48 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=30.85 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=1.87 fanout-score-rank=38 prefix-density=0.36 prefix-fanout=1.6 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=104.03 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=14.5 sequence=CCGCCGCCGCCG SRR8450151 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:19:48 Started mapping on | Dec 06 10:19:48 Finished on | Dec 06 10:23:04 Mapping speed, Million of reads per hour | 505.99 Number of input reads | 27548099 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25148279 Uniquely mapped reads % | 91.29% Average mapped length | 299.07 Number of splices: Total | 25658715 Number of splices: Annotated (sjdb) | 24015013 Number of splices: GT/AG | 25304503 Number of splices: GC/AG | 298296 Number of splices: AT/AC | 14940 Number of splices: Non-canonical | 40976 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.76 Insertion rate per base | 0.01% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298435 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 36457 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.58% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2101385 2101385 2101385 N_multimapping 298435 298435 298435 N_noFeature 792952 24417676 1017860 N_ambiguous 611354 3981 106706 UnstrandedReadsAssigned:23743973 PositiveStrandReadsAssigned:726622 NegativeStrandReadsAssigned:24023713 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450151 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450151-trimmed-pair1.fastq SRR8450151-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,548,099 reads, 25,031,444 reads pseudoaligned [quant] estimated average fragment length: 305.96 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR8450151.ke.tsv 35125 SRR8450151.se.tsv 88098 total ==> SRR8450151.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 631.888 3.20196e-05 2.62995e-06 PNS24247 1044 739.04 49.8614 3.50161 PNS24249 1928 1623.04 180.292 5.76525 PNS24246 1044 739.04 49.8614 3.50161 PNS24248 1044 739.04 49.8614 3.50161 PNS24244 1471 1166.04 82.1243 3.65536 PNS24243 293 80.2646 0 0 KQK14069 1603 1298.04 5872.86 234.819 KQK14071 474 206.365 13.6398 3.4304 ==> SRR8450151.se.tsv <== BRADI_1g14170v3 5771 BRADI_1g53295v3 177 BRADI_1g59795v3 341 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1750 BRADI_1g74790v3 79 BRADI_1g09890v3 9 BRADI_1g77505v3 423 BRADI_1g48960v3 0 SRR8450151 completed mapping pipeline successfully