Starting /dee2/code/volunteer_pipeline.sh SRR8450152 current disk space = 1551932116992 free memory = 1604580564 SRR8450152 SRAfilesize e46aee257d270b6cd24d2cf36b2ecf35 SRR8450152.sra SRR8450152.sra file validated SRR8450152 is paired end SRR8450152 is conventional basespace SRR8450152 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450152_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.063 37.0 37.0 37.0 37.0 37.0 2 36.1735 37.0 37.0 37.0 37.0 37.0 3 36.4165 37.0 37.0 37.0 37.0 37.0 4 36.5155 37.0 37.0 37.0 37.0 37.0 5 36.477 37.0 37.0 37.0 37.0 37.0 6 36.4945 37.0 37.0 37.0 37.0 37.0 7 36.346 37.0 37.0 37.0 37.0 37.0 8 36.4455 37.0 37.0 37.0 37.0 37.0 9 36.403 37.0 37.0 37.0 37.0 37.0 10-14 36.4852 37.0 37.0 37.0 37.0 37.0 15-19 36.4311 37.0 37.0 37.0 37.0 37.0 20-24 36.4529 37.0 37.0 37.0 37.0 37.0 25-29 36.347899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.3433 37.0 37.0 37.0 37.0 37.0 35-39 36.315 37.0 37.0 37.0 37.0 37.0 40-44 36.3513 37.0 37.0 37.0 37.0 37.0 45-49 36.343599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3022 37.0 37.0 37.0 37.0 37.0 55-59 36.279700000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.1737 37.0 37.0 37.0 37.0 37.0 65-69 36.1566 37.0 37.0 37.0 37.0 37.0 70-74 36.3051 37.0 37.0 37.0 37.0 37.0 75-79 36.1971 37.0 37.0 37.0 37.0 37.0 80-84 36.247400000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.16289999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.20440000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.162 37.0 37.0 37.0 37.0 37.0 100-104 36.0712 37.0 37.0 37.0 37.0 37.0 105-109 36.0846 37.0 37.0 37.0 37.0 37.0 110-114 35.9871 37.0 37.0 37.0 37.0 37.0 115-119 36.0278 37.0 37.0 37.0 37.0 37.0 120-124 35.9534 37.0 37.0 37.0 37.0 37.0 125-129 35.8728 37.0 37.0 37.0 37.0 37.0 130-134 35.85099999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.8666 37.0 37.0 37.0 37.0 37.0 140-144 35.7922 37.0 37.0 37.0 37.0 37.0 145-149 35.7597 37.0 37.0 37.0 37.0 37.0 150-151 35.23625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 4.0 26 2.0 27 9.0 28 15.0 29 20.0 30 37.0 31 48.0 32 71.0 33 104.0 34 121.0 35 344.0 36 2788.0 37 433.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.91851106639839 11.64486921529175 8.601609657947686 30.835010060362173 2 25.525 13.700000000000001 29.799999999999997 30.975 3 22.05 21.675 22.375 33.900000000000006 4 25.900000000000002 26.450000000000003 21.349999999999998 26.3 5 26.85 28.625 21.9 22.625 6 22.95 31.75 23.799999999999997 21.5 7 18.625 23.35 37.55 20.474999999999998 8 21.325 24.075 27.875 26.724999999999998 9 19.900000000000002 21.65 32.1 26.35 10-14 23.645 25.465 25.03 25.86 15-19 24.12 24.89 25.369999999999997 25.619999999999997 20-24 23.189999999999998 25.235000000000003 25.47 26.105 25-29 23.68 25.09 25.575 25.655 30-34 23.785 24.735 25.235000000000003 26.245 35-39 23.39 25.085 25.019999999999996 26.505000000000003 40-44 23.830000000000002 25.615 24.62 25.935000000000002 45-49 22.994999999999997 25.7 25.180000000000003 26.125 50-54 23.965 24.8 24.845 26.39 55-59 23.810000000000002 25.130000000000003 24.654999999999998 26.405 60-64 23.715 25.5 24.709999999999997 26.075 65-69 23.365 24.87 24.95 26.815 70-74 24.07 24.745 24.85 26.334999999999997 75-79 23.755000000000003 24.485 25.16 26.6 80-84 23.915 24.385 25.205 26.495 85-89 25.005 24.529999999999998 24.19 26.275 90-94 24.83 24.41 24.7 26.06 95-99 24.19 24.709999999999997 24.645 26.455000000000002 100-104 24.58 24.9 24.474999999999998 26.045 105-109 25.095 24.13 25.080000000000002 25.695 110-114 24.349999999999998 24.485 24.715 26.450000000000003 115-119 24.055 24.875 24.44 26.63 120-124 24.335 24.955 24.29 26.419999999999998 125-129 24.535 24.279999999999998 24.895 26.290000000000003 130-134 24.585 24.92 24.224999999999998 26.27 135-139 24.84 24.085 24.715 26.36 140-144 24.975 23.845 24.41 26.77 145-149 24.925 23.945 24.715 26.415 150-151 24.8 24.525 23.0625 27.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 1.0 27 0.5 28 3.0 29 5.0 30 6.5 31 11.0 32 12.0 33 12.5 34 15.5 35 35.5 36 59.0 37 68.5 38 79.0 39 100.0 40 110.5 41 119.5 42 141.0 43 166.0 44 181.5 45 182.5 46 186.5 47 202.0 48 185.0 49 152.5 50 161.5 51 148.5 52 132.0 53 141.0 54 130.5 55 97.0 56 89.5 57 91.0 58 71.5 59 76.0 60 82.0 61 77.5 62 77.0 63 77.5 64 75.5 65 64.0 66 55.0 67 51.5 68 43.0 69 35.0 70 32.0 71 29.5 72 30.0 73 21.5 74 15.0 75 16.0 76 11.5 77 8.0 78 6.0 79 3.5 80 3.0 81 1.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6031746031746 89.4 2 5.0 9.45 3 0.3703703703703704 1.05 4 0.026455026455026457 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.11249999999999999 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.3625 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.7374999999999998 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8450152 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450152_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7555 37.0 37.0 37.0 37.0 37.0 2 35.2035 37.0 37.0 37.0 37.0 37.0 3 35.1625 37.0 37.0 37.0 37.0 37.0 4 35.3015 37.0 37.0 37.0 37.0 37.0 5 35.0875 37.0 37.0 37.0 25.0 37.0 6 34.96 37.0 37.0 37.0 25.0 37.0 7 34.8365 37.0 37.0 37.0 25.0 37.0 8 34.959 37.0 37.0 37.0 25.0 37.0 9 34.933 37.0 37.0 37.0 25.0 37.0 10-14 34.8107 37.0 37.0 37.0 25.0 37.0 15-19 34.651799999999994 37.0 37.0 37.0 25.0 37.0 20-24 34.5681 37.0 37.0 37.0 25.0 37.0 25-29 34.5 37.0 37.0 37.0 25.0 37.0 30-34 34.443 37.0 37.0 37.0 25.0 37.0 35-39 34.543800000000005 37.0 37.0 37.0 25.0 37.0 40-44 34.44199999999999 37.0 37.0 37.0 25.0 37.0 45-49 34.4131 37.0 37.0 37.0 25.0 37.0 50-54 34.197700000000005 37.0 37.0 37.0 25.0 37.0 55-59 34.298 37.0 37.0 37.0 25.0 37.0 60-64 34.326499999999996 37.0 37.0 37.0 25.0 37.0 65-69 34.30409999999999 37.0 37.0 37.0 25.0 37.0 70-74 34.1393 37.0 37.0 37.0 25.0 37.0 75-79 34.215799999999994 37.0 37.0 37.0 25.0 37.0 80-84 34.1632 37.0 37.0 37.0 25.0 37.0 85-89 34.175200000000004 37.0 37.0 37.0 25.0 37.0 90-94 34.0992 37.0 37.0 37.0 25.0 37.0 95-99 34.0681 37.0 37.0 37.0 25.0 37.0 100-104 34.0201 37.0 37.0 37.0 25.0 37.0 105-109 34.0706 37.0 37.0 37.0 25.0 37.0 110-114 34.0057 37.0 37.0 37.0 25.0 37.0 115-119 33.9066 37.0 37.0 37.0 25.0 37.0 120-124 33.890600000000006 37.0 37.0 37.0 25.0 37.0 125-129 33.8629 37.0 37.0 37.0 25.0 37.0 130-134 33.813 37.0 37.0 37.0 25.0 37.0 135-139 33.7636 37.0 37.0 37.0 25.0 37.0 140-144 33.520300000000006 37.0 37.0 37.0 19.4 37.0 145-149 33.529399999999995 37.0 37.0 37.0 19.4 37.0 150-151 32.776250000000005 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 22.0 14 38.0 15 34.0 16 24.0 17 22.0 18 19.0 19 19.0 20 16.0 21 28.0 22 48.0 23 41.0 24 40.0 25 30.0 26 20.0 27 31.0 28 33.0 29 28.0 30 47.0 31 66.0 32 69.0 33 123.0 34 213.0 35 502.0 36 2284.0 37 199.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.375 17.675 9.700000000000001 27.250000000000004 2 34.275 21.475 22.55 21.7 3 28.275 23.599999999999998 23.799999999999997 24.325 4 30.4 29.625 18.725 21.25 5 31.825 30.625000000000004 17.2 20.349999999999998 6 28.9 32.1 18.475 20.525 7 28.475 19.475 29.15 22.900000000000002 8 28.725 22.15 20.125 28.999999999999996 9 27.500000000000004 22.575 23.425 26.5 10-14 30.61 24.265 20.555 24.57 15-19 28.51 24.88 21.935 24.675 20-24 27.74 25.825 21.73 24.705 25-29 27.925 26.155 21.55 24.37 30-34 27.175 27.229999999999997 21.38 24.215 35-39 26.58 27.095000000000002 21.465 24.86 40-44 26.87 26.834999999999997 21.265 25.03 45-49 26.674999999999997 26.6 21.73 24.995 50-54 26.41 26.825 22.07 24.695 55-59 26.955000000000002 26.39 21.645 25.009999999999998 60-64 26.66 26.52 22.07 24.75 65-69 27.060000000000002 26.795 21.925 24.22 70-74 27.250000000000004 26.02 22.15 24.58 75-79 27.485 26.525 21.584999999999997 24.404999999999998 80-84 26.55 26.810000000000002 22.3 24.34 85-89 26.529999999999998 27.01 22.009999999999998 24.45 90-94 26.995 26.99 21.66 24.355 95-99 27.105 26.419999999999998 22.18 24.295 100-104 26.375 26.855 22.14 24.63 105-109 27.084999999999997 27.295 21.55 24.07 110-114 27.055 27.425 21.9 23.62 115-119 27.0 27.0 22.33 23.669999999999998 120-124 26.900000000000002 27.015 22.185 23.9 125-129 26.305 27.24 22.400000000000002 24.055 130-134 27.275 27.169999999999998 21.72 23.835 135-139 26.625 27.395000000000003 22.49 23.49 140-144 27.005000000000003 27.705000000000002 22.175 23.115 145-149 26.875 27.61 22.12 23.395 150-151 27.2625 26.6125 22.3625 23.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.5 6 2.0 7 1.5 8 2.0 9 4.5 10 5.0 11 4.5 12 3.5 13 3.0 14 3.0 15 2.0 16 3.0 17 3.5 18 4.5 19 6.0 20 7.5 21 5.0 22 4.5 23 6.5 24 4.5 25 3.0 26 4.0 27 6.0 28 8.0 29 9.5 30 13.5 31 14.5 32 12.0 33 16.5 34 20.5 35 23.0 36 35.5 37 45.0 38 47.5 39 68.5 40 86.0 41 92.0 42 112.5 43 130.5 44 141.5 45 168.0 46 175.5 47 163.5 48 163.0 49 158.0 50 148.0 51 135.5 52 118.5 53 115.5 54 113.0 55 112.0 56 99.0 57 86.5 58 90.0 59 80.5 60 79.0 61 73.5 62 73.0 63 89.5 64 82.5 65 61.0 66 58.5 67 72.0 68 70.5 69 59.0 70 61.5 71 54.0 72 49.0 73 43.5 74 30.5 75 24.0 76 15.0 77 10.0 78 8.5 79 8.5 80 8.0 81 8.0 82 6.0 83 2.0 84 1.5 85 1.5 86 1.5 87 1.5 88 2.5 89 3.5 90 2.5 91 1.0 92 2.5 93 3.0 94 2.5 95 1.5 96 0.0 97 2.0 98 2.5 99 3.0 100 14.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.03867698052814 89.075 2 4.507868765004002 8.450000000000001 3 0.3200853560949587 0.8999999999999999 4 0.08002133902373967 0.3 5 0.0 0.0 6 0.026673779674579887 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026673779674579887 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 45 1.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.11249999999999999 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.4375 0.0 0.0 0.0 0.0 134-135 1.7125 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138-139 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATCT 10 0.006830828 145.0 7 >>END_MODULE Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838486 spots for SRR8450152.sra Written 1838486 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra Read 1838474 spots for SRR8450152.sra Written 1838474 spots for SRR8450152.sra SRR ids: ['SRR8450152.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qkuo5w0c SRR8450152.sra spots: 36769492 blocks: [[1, 1838474], [1838475, 3676948], [3676949, 5515422], [5515423, 7353896], [7353897, 9192370], [9192371, 11030844], [11030845, 12869318], [12869319, 14707792], [14707793, 16546266], [16546267, 18384740], [18384741, 20223214], [20223215, 22061688], [22061689, 23900162], [23900163, 25738636], [25738637, 27577110], [27577111, 29415584], [29415585, 31254058], [31254059, 33092532], [33092533, 34931006], [34931007, 36769492]] SRR8450152 file size 12438273 SRR8450152 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450152 SRR8450152_1.fastq SRR8450152_2.fastq Input file: SRR8450152_1.fastq Paired file: SRR8450152_2.fastq trimmed: SRR8450152-trimmed-pair1.fastq, SRR8450152-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:20:40 2024 >> started Fri Dec 6 10:21:25 2024 >> done (45.317s) 36769492 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 21049 ( 0.06%) empty read pairs filtered out after trimming by size control 36748397 (99.94%) read pairs available; of these: 1419086 ( 3.86%) trimmed read pairs available after processing 35329311 (96.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 9 0.00% 20 9 0.00% 21 6 0.00% 22 5 0.00% 23 8 0.00% 24 8 0.00% 25 14 0.00% 26 15 0.00% 27 16 0.00% 28 15 0.00% 29 11 0.00% 30 10 0.00% 31 11 0.00% 32 23 0.00% 33 15 0.00% 34 16 0.00% 35 25 0.00% 36 19 0.00% 37 11 0.00% 38 24 0.00% 39 23 0.00% 40 29 0.00% 41 32 0.00% 42 26 0.00% 43 23 0.00% 44 27 0.00% 45 30 0.00% 46 35 0.00% 47 33 0.00% 48 42 0.00% 49 50 0.00% 50 56 0.00% 51 42 0.00% 52 36 0.00% 53 53 0.00% 54 45 0.00% 55 41 0.00% 56 59 0.00% 57 69 0.00% 58 53 0.00% 59 65 0.00% 60 74 0.00% 61 96 0.00% 62 87 0.00% 63 82 0.00% 64 103 0.00% 65 107 0.00% 66 132 0.00% 67 133 0.00% 68 120 0.00% 69 153 0.00% 70 157 0.00% 71 192 0.00% 72 193 0.00% 73 251 0.00% 74 264 0.00% 75 286 0.00% 76 370 0.00% 77 357 0.00% 78 387 0.00% 79 464 0.00% 80 564 0.00% 81 574 0.00% 82 677 0.00% 83 788 0.00% 84 942 0.00% 85 1024 0.00% 86 1185 0.00% 87 1295 0.00% 88 1442 0.00% 89 1558 0.00% 90 1709 0.00% 91 1941 0.01% 92 2214 0.01% 93 2509 0.01% 94 2786 0.01% 95 3219 0.01% 96 3291 0.01% 97 3677 0.01% 98 3973 0.01% 99 4339 0.01% 100 4804 0.01% 101 5124 0.01% 102 5647 0.02% 103 6288 0.02% 104 6770 0.02% 105 7361 0.02% 106 7945 0.02% 107 8542 0.02% 108 8795 0.02% 109 9591 0.03% 110 10062 0.03% 111 10868 0.03% 112 11750 0.03% 113 12536 0.03% 114 13695 0.04% 115 14249 0.04% 116 15197 0.04% 117 16046 0.04% 118 16672 0.05% 119 17612 0.05% 120 18396 0.05% 121 19337 0.05% 122 20344 0.06% 123 21717 0.06% 124 22989 0.06% 125 23895 0.07% 126 25532 0.07% 127 26074 0.07% 128 27275 0.07% 129 28452 0.08% 130 28954 0.08% 131 30407 0.08% 132 32512 0.09% 133 34251 0.09% 134 35332 0.10% 135 37157 0.10% 136 38590 0.11% 137 39395 0.11% 138 40449 0.11% 139 42139 0.11% 140 43244 0.12% 141 44495 0.12% 142 46444 0.13% 143 48547 0.13% 144 50613 0.14% 145 52266 0.14% 146 54357 0.15% 147 55616 0.15% 148 57481 0.16% 149 58561 0.16% 150 59856 0.16% 151 35329311 96.14% 36748397 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.45 prefix-fanout=1.9 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=42.62 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.6 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=17 prefix-density=0.46 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=105.98 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=14.7 sequence=CCGCCGCCGCCG SRR8450152 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:22:25 Started mapping on | Dec 06 10:22:25 Finished on | Dec 06 10:29:17 Mapping speed, Million of reads per hour | 321.10 Number of input reads | 36748397 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 31894944 Uniquely mapped reads % | 86.79% Average mapped length | 299.18 Number of splices: Total | 34198371 Number of splices: Annotated (sjdb) | 32167339 Number of splices: GT/AG | 33736494 Number of splices: GC/AG | 394933 Number of splices: AT/AC | 16257 Number of splices: Non-canonical | 50687 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.74 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352869 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 33128 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.47% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4500584 4500584 4500584 N_multimapping 352869 352869 352869 N_noFeature 944117 30995241 1180628 N_ambiguous 806502 5043 146083 UnstrandedReadsAssigned:30144325 PositiveStrandReadsAssigned:894660 NegativeStrandReadsAssigned:30568233 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450152 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450152-trimmed-pair1.fastq SRR8450152-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,748,397 reads, 32,729,071 reads pseudoaligned [quant] estimated average fragment length: 301.634 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52973 SRR8450152.ke.tsv 35125 SRR8450152.se.tsv 88098 total ==> SRR8450152.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 636.254 0 0 PNS24247 1044 743.366 63.3547 3.42755 PNS24249 1928 1627.37 219.63 5.42767 PNS24246 1044 743.366 63.3547 3.42755 PNS24248 1044 743.366 63.3547 3.42755 PNS24244 1471 1170.37 129.306 4.44329 PNS24243 293 78.9353 0 0 KQK14069 1603 1302.37 6542.08 202.018 KQK14071 474 208.116 92.2191 17.8206 ==> SRR8450152.se.tsv <== BRADI_1g14170v3 6661 BRADI_1g53295v3 255 BRADI_1g59795v3 440 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 2931 BRADI_1g74790v3 356 BRADI_1g09890v3 6 BRADI_1g77505v3 635 BRADI_1g48960v3 0 SRR8450152 completed mapping pipeline successfully