Starting /dee2/code/volunteer_pipeline.sh SRR8450153 current disk space = 1551903932416 free memory = 1602177340 SRR8450153 SRAfilesize 2c3304e7b3553f29462cb316e1618d11 SRR8450153.sra SRR8450153.sra file validated SRR8450153 is paired end SRR8450153 is conventional basespace SRR8450153 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450153_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.104 37.0 37.0 37.0 37.0 37.0 2 36.3795 37.0 37.0 37.0 37.0 37.0 3 36.412 37.0 37.0 37.0 37.0 37.0 4 36.498 37.0 37.0 37.0 37.0 37.0 5 36.5625 37.0 37.0 37.0 37.0 37.0 6 36.5785 37.0 37.0 37.0 37.0 37.0 7 36.448 37.0 37.0 37.0 37.0 37.0 8 36.5485 37.0 37.0 37.0 37.0 37.0 9 36.545 37.0 37.0 37.0 37.0 37.0 10-14 36.491 37.0 37.0 37.0 37.0 37.0 15-19 36.4754 37.0 37.0 37.0 37.0 37.0 20-24 36.4527 37.0 37.0 37.0 37.0 37.0 25-29 36.36990000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4097 37.0 37.0 37.0 37.0 37.0 35-39 36.3605 37.0 37.0 37.0 37.0 37.0 40-44 36.3717 37.0 37.0 37.0 37.0 37.0 45-49 36.260000000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.314600000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.2068 37.0 37.0 37.0 37.0 37.0 60-64 36.1537 37.0 37.0 37.0 37.0 37.0 65-69 36.0608 37.0 37.0 37.0 37.0 37.0 70-74 36.2149 37.0 37.0 37.0 37.0 37.0 75-79 36.282 37.0 37.0 37.0 37.0 37.0 80-84 36.235 37.0 37.0 37.0 37.0 37.0 85-89 36.146699999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2315 37.0 37.0 37.0 37.0 37.0 95-99 36.137800000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.1154 37.0 37.0 37.0 37.0 37.0 105-109 36.125099999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.027 37.0 37.0 37.0 37.0 37.0 115-119 36.0083 37.0 37.0 37.0 37.0 37.0 120-124 35.9876 37.0 37.0 37.0 37.0 37.0 125-129 35.8943 37.0 37.0 37.0 37.0 37.0 130-134 35.916999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.914699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.84439999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.91459999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.33775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 4.0 26 6.0 27 14.0 28 15.0 29 23.0 30 23.0 31 47.0 32 68.0 33 75.0 34 163.0 35 320.0 36 2768.0 37 471.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.086562657272275 12.330145948666331 8.782083543029694 34.801207851031705 2 26.738369184592298 12.956478239119559 27.138569284642323 33.16658329164582 3 24.275 15.8 22.45 37.475 4 26.1 22.025 19.55 32.324999999999996 5 28.799999999999997 23.875 22.15 25.174999999999997 6 27.975 26.174999999999997 22.325 23.525 7 18.875 24.75 36.875 19.5 8 22.3 23.75 28.825 25.124999999999996 9 22.525000000000002 20.599999999999998 31.125000000000004 25.75 10-14 24.67 24.91 24.865000000000002 25.555 15-19 25.040000000000003 23.465 24.5 26.995 20-24 24.515 23.94 25.215 26.33 25-29 24.39 23.41 24.404999999999998 27.794999999999998 30-34 24.95 23.69 24.545 26.815 35-39 24.95 23.21 24.43 27.41 40-44 24.709999999999997 24.36 24.610000000000003 26.32 45-49 25.15 23.580000000000002 24.060000000000002 27.21 50-54 25.575 22.875 24.45 27.1 55-59 24.92 23.7 23.825 27.555000000000003 60-64 25.1 23.400000000000002 24.654999999999998 26.845000000000002 65-69 25.06 23.82 23.724999999999998 27.395000000000003 70-74 26.39 22.835 23.625 27.150000000000002 75-79 26.395000000000003 22.830000000000002 23.875 26.900000000000002 80-84 26.174999999999997 23.605 23.335 26.884999999999998 85-89 26.640000000000004 23.585 22.89 26.884999999999998 90-94 26.669999999999998 23.05 23.549999999999997 26.729999999999997 95-99 26.075 22.66 24.22 27.045 100-104 26.165 23.11 23.825 26.900000000000002 105-109 26.284999999999997 22.994999999999997 23.27 27.450000000000003 110-114 26.295 23.01 23.53 27.165 115-119 26.135 22.634999999999998 23.805 27.425 120-124 26.479999999999997 22.98 23.799999999999997 26.740000000000002 125-129 26.119999999999997 22.965 23.625 27.29 130-134 26.640000000000004 22.435 23.79 27.134999999999998 135-139 26.265 22.79 24.125 26.82 140-144 27.060000000000002 22.68 23.669999999999998 26.590000000000003 145-149 26.825 22.575 22.8 27.800000000000004 150-151 26.6 22.75 23.3375 27.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.5 29 4.5 30 8.0 31 8.5 32 10.0 33 12.0 34 16.5 35 22.0 36 29.0 37 44.5 38 62.5 39 79.0 40 92.5 41 111.0 42 122.0 43 120.0 44 132.0 45 139.5 46 154.0 47 167.5 48 165.5 49 165.0 50 161.5 51 144.5 52 125.0 53 118.0 54 120.0 55 117.5 56 106.5 57 113.0 58 105.0 59 97.0 60 94.0 61 84.0 62 88.0 63 90.5 64 88.0 65 103.0 66 106.5 67 85.0 68 63.0 69 50.5 70 44.5 71 40.5 72 39.0 73 30.5 74 28.0 75 24.5 76 21.5 77 16.0 78 7.0 79 5.5 80 5.0 81 4.5 82 2.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.89497474076045 89.225 2 4.546663121510237 8.55 3 0.452007444828503 1.275 4 0.05317734645041213 0.2 5 0.026588673225206066 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026588673225206066 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCTTGTTATCTCGTAT 25 0.625 TruSeq Adapter, Index 11 (97% over 37bp) GCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.575 0.0 0.0 0.0 0.0 128-129 1.7375 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.7375 0.0 0.0 0.0 0.0 138-139 3.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTATGA 10 0.006830828 145.0 5 TCTGATG 10 0.006830828 145.0 7 GCACAGT 10 0.006830828 145.0 1 TTTTTTT 40 0.0076550315 18.125 45-49 >>END_MODULE SRR8450153 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450153_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.014 37.0 37.0 37.0 37.0 37.0 2 35.7 37.0 37.0 37.0 37.0 37.0 3 35.699 37.0 37.0 37.0 37.0 37.0 4 35.7325 37.0 37.0 37.0 37.0 37.0 5 35.584 37.0 37.0 37.0 37.0 37.0 6 35.6385 37.0 37.0 37.0 37.0 37.0 7 35.5145 37.0 37.0 37.0 37.0 37.0 8 35.5345 37.0 37.0 37.0 37.0 37.0 9 35.5295 37.0 37.0 37.0 37.0 37.0 10-14 35.46940000000001 37.0 37.0 37.0 37.0 37.0 15-19 35.452099999999994 37.0 37.0 37.0 37.0 37.0 20-24 35.282 37.0 37.0 37.0 37.0 37.0 25-29 35.1616 37.0 37.0 37.0 37.0 37.0 30-34 35.1597 37.0 37.0 37.0 34.6 37.0 35-39 35.2084 37.0 37.0 37.0 37.0 37.0 40-44 35.0465 37.0 37.0 37.0 34.6 37.0 45-49 35.1415 37.0 37.0 37.0 34.6 37.0 50-54 34.9925 37.0 37.0 37.0 29.8 37.0 55-59 35.0135 37.0 37.0 37.0 27.4 37.0 60-64 35.0518 37.0 37.0 37.0 29.8 37.0 65-69 34.99999999999999 37.0 37.0 37.0 27.4 37.0 70-74 34.8572 37.0 37.0 37.0 25.0 37.0 75-79 34.9308 37.0 37.0 37.0 25.0 37.0 80-84 34.980900000000005 37.0 37.0 37.0 27.4 37.0 85-89 34.956100000000006 37.0 37.0 37.0 25.0 37.0 90-94 34.982299999999995 37.0 37.0 37.0 25.0 37.0 95-99 35.033500000000004 37.0 37.0 37.0 25.0 37.0 100-104 35.075900000000004 37.0 37.0 37.0 32.2 37.0 105-109 35.0438 37.0 37.0 37.0 29.8 37.0 110-114 34.98440000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.8923 37.0 37.0 37.0 25.0 37.0 120-124 34.8848 37.0 37.0 37.0 25.0 37.0 125-129 34.7813 37.0 37.0 37.0 25.0 37.0 130-134 34.7325 37.0 37.0 37.0 25.0 37.0 135-139 34.6635 37.0 37.0 37.0 25.0 37.0 140-144 34.4885 37.0 37.0 37.0 25.0 37.0 145-149 34.5072 37.0 37.0 37.0 25.0 37.0 150-151 33.84425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 6.0 14 26.0 15 17.0 16 10.0 17 9.0 18 9.0 19 8.0 20 13.0 21 20.0 22 22.0 23 26.0 24 19.0 25 22.0 26 22.0 27 31.0 28 23.0 29 33.0 30 33.0 31 44.0 32 76.0 33 109.0 34 189.0 35 574.0 36 2440.0 37 217.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1 18.775 12.2 30.925000000000004 2 35.75 21.7 19.775000000000002 22.775000000000002 3 27.375 24.625 23.225 24.775 4 29.599999999999998 27.700000000000003 19.175 23.525 5 31.924999999999997 28.9 16.950000000000003 22.225 6 28.225 32.65 16.5 22.625 7 27.075 19.15 29.45 24.325 8 27.400000000000002 22.5 20.9 29.2 9 26.224999999999998 20.875 25.25 27.650000000000002 10-14 28.945 24.51 20.47 26.075 15-19 28.89 24.52 20.794999999999998 25.795 20-24 27.860000000000003 24.63 21.46 26.05 25-29 27.715 24.990000000000002 21.26 26.035000000000004 30-34 27.255000000000003 24.795 22.085 25.865 35-39 27.72 24.25 21.07 26.96 40-44 27.650000000000002 24.654999999999998 21.69 26.005 45-49 27.955000000000002 25.105 20.915 26.025 50-54 27.83 24.595 21.515 26.06 55-59 28.235 24.455 21.525 25.785000000000004 60-64 27.775 24.575 21.39 26.26 65-69 27.725 24.65 21.365000000000002 26.26 70-74 28.660000000000004 23.97 21.8 25.569999999999997 75-79 27.74 24.435000000000002 21.965 25.86 80-84 28.060000000000002 24.29 22.145 25.505 85-89 28.494999999999997 24.075 21.154999999999998 26.275 90-94 28.365000000000002 24.42 21.695 25.52 95-99 28.325 24.585 21.5 25.590000000000003 100-104 28.265 24.505 21.08 26.150000000000002 105-109 28.634999999999998 24.12 21.075 26.169999999999998 110-114 28.63 24.54 21.17 25.66 115-119 28.735 24.48 21.45 25.335 120-124 28.754999999999995 24.545 21.265 25.435000000000002 125-129 27.815 25.119999999999997 21.105 25.96 130-134 28.585 25.019999999999996 21.404999999999998 24.990000000000002 135-139 28.79 24.275 21.925 25.009999999999998 140-144 28.63 24.535 21.425 25.41 145-149 28.95 24.47 21.315 25.264999999999997 150-151 28.3625 25.337500000000002 21.575 24.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 1.0 10 0.0 11 0.0 12 0.5 13 2.0 14 1.5 15 1.0 16 1.5 17 3.0 18 3.0 19 0.5 20 0.5 21 2.5 22 3.0 23 2.0 24 4.0 25 4.5 26 3.0 27 3.0 28 3.5 29 6.0 30 5.0 31 6.0 32 8.5 33 8.5 34 14.0 35 19.5 36 27.5 37 34.0 38 44.0 39 58.5 40 75.0 41 96.0 42 107.0 43 114.5 44 129.5 45 132.5 46 134.5 47 137.5 48 133.5 49 128.5 50 125.5 51 129.0 52 114.5 53 113.5 54 125.0 55 118.5 56 109.0 57 106.5 58 112.0 59 121.0 60 121.5 61 112.0 62 104.5 63 101.5 64 93.0 65 85.0 66 84.5 67 92.0 68 96.5 69 75.5 70 61.5 71 60.5 72 50.5 73 43.0 74 35.5 75 26.0 76 19.5 77 14.0 78 8.0 79 4.5 80 5.0 81 6.0 82 4.5 83 4.5 84 5.0 85 3.0 86 1.5 87 1.5 88 2.0 89 1.0 90 2.5 91 3.5 92 2.5 93 3.5 94 3.5 95 3.0 96 2.0 97 1.0 98 2.5 99 2.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6485623003195 88.875 2 4.739084132055378 8.9 3 0.45260915867944623 1.275 4 0.10649627263045794 0.4 5 0.026624068157614485 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026624068157614485 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.575 0.0 0.0 0.0 0.0 128-129 1.7625 0.0 0.0 0.0 0.0 130-131 2.0250000000000004 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATTT 10 0.006830828 145.0 3 >>END_MODULE Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749417 spots for SRR8450153.sra Written 1749417 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra Read 1749398 spots for SRR8450153.sra Written 1749398 spots for SRR8450153.sra SRR ids: ['SRR8450153.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zhnpzivc SRR8450153.sra spots: 34987979 blocks: [[1, 1749398], [1749399, 3498796], [3498797, 5248194], [5248195, 6997592], [6997593, 8746990], [8746991, 10496388], [10496389, 12245786], [12245787, 13995184], [13995185, 15744582], [15744583, 17493980], [17493981, 19243378], [19243379, 20992776], [20992777, 22742174], [22742175, 24491572], [24491573, 26240970], [26240971, 27990368], [27990369, 29739766], [29739767, 31489164], [31489165, 33238562], [33238563, 34987979]] SRR8450153 file size 11834577 SRR8450153 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450153 SRR8450153_1.fastq SRR8450153_2.fastq Input file: SRR8450153_1.fastq Paired file: SRR8450153_2.fastq trimmed: SRR8450153-trimmed-pair1.fastq, SRR8450153-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:22:23 2024 >> started Fri Dec 6 10:23:37 2024 >> done (74.072s) 34987979 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 277783 ( 0.79%) empty read pairs filtered out after trimming by size control 34710105 (99.21%) read pairs available; of these: 1891216 ( 5.45%) trimmed read pairs available after processing 32818889 (94.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 6 0.00% 21 7 0.00% 22 15 0.00% 23 14 0.00% 24 12 0.00% 25 13 0.00% 26 20 0.00% 27 10 0.00% 28 10 0.00% 29 17 0.00% 30 21 0.00% 31 26 0.00% 32 21 0.00% 33 23 0.00% 34 22 0.00% 35 20 0.00% 36 35 0.00% 37 41 0.00% 38 26 0.00% 39 33 0.00% 40 32 0.00% 41 44 0.00% 42 36 0.00% 43 38 0.00% 44 34 0.00% 45 39 0.00% 46 58 0.00% 47 43 0.00% 48 39 0.00% 49 50 0.00% 50 51 0.00% 51 47 0.00% 52 56 0.00% 53 61 0.00% 54 58 0.00% 55 69 0.00% 56 65 0.00% 57 95 0.00% 58 86 0.00% 59 95 0.00% 60 110 0.00% 61 147 0.00% 62 119 0.00% 63 129 0.00% 64 158 0.00% 65 178 0.00% 66 182 0.00% 67 205 0.00% 68 214 0.00% 69 284 0.00% 70 291 0.00% 71 336 0.00% 72 462 0.00% 73 484 0.00% 74 525 0.00% 75 645 0.00% 76 735 0.00% 77 744 0.00% 78 858 0.00% 79 921 0.00% 80 1097 0.00% 81 1280 0.00% 82 1483 0.00% 83 1658 0.00% 84 1919 0.01% 85 2127 0.01% 86 2372 0.01% 87 2518 0.01% 88 2885 0.01% 89 3010 0.01% 90 3338 0.01% 91 3772 0.01% 92 4206 0.01% 93 4624 0.01% 94 5275 0.02% 95 5786 0.02% 96 6125 0.02% 97 6820 0.02% 98 7166 0.02% 99 7832 0.02% 100 8255 0.02% 101 9002 0.03% 102 9761 0.03% 103 10532 0.03% 104 11138 0.03% 105 11900 0.03% 106 12683 0.04% 107 13580 0.04% 108 13978 0.04% 109 15276 0.04% 110 16045 0.05% 111 16584 0.05% 112 17778 0.05% 113 18612 0.05% 114 19688 0.06% 115 20989 0.06% 116 22226 0.06% 117 23160 0.07% 118 24232 0.07% 119 25028 0.07% 120 26247 0.08% 121 27216 0.08% 122 28455 0.08% 123 30136 0.09% 124 31097 0.09% 125 32576 0.09% 126 34038 0.10% 127 35670 0.10% 128 36823 0.11% 129 38432 0.11% 130 39437 0.11% 131 40833 0.12% 132 42368 0.12% 133 44091 0.13% 134 45963 0.13% 135 47339 0.14% 136 48437 0.14% 137 49906 0.14% 138 51286 0.15% 139 53671 0.15% 140 54972 0.16% 141 56176 0.16% 142 58588 0.17% 143 60081 0.17% 144 61857 0.18% 145 64115 0.18% 146 65307 0.19% 147 67666 0.19% 148 70110 0.20% 149 70689 0.20% 150 72660 0.21% 151 32818889 94.55% 34710105 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=28 prefix-density=0.83 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.38 sequence-density-rank=11 fanout-score=18.13 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=6.0 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=11 prefix-density=0.69 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=59.68 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=3.0 sequence=GCAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR8450153 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:25:49 Started mapping on | Dec 06 10:25:50 Finished on | Dec 06 10:30:23 Mapping speed, Million of reads per hour | 457.72 Number of input reads | 34710105 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31692689 Uniquely mapped reads % | 91.31% Average mapped length | 298.63 Number of splices: Total | 31317330 Number of splices: Annotated (sjdb) | 29434728 Number of splices: GT/AG | 30902970 Number of splices: GC/AG | 359738 Number of splices: AT/AC | 11058 Number of splices: Non-canonical | 43564 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.86 Insertion rate per base | 0.01% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522348 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 65931 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.71% % of reads unmapped: other | 1.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2495068 2495068 2495068 N_multimapping 522348 522348 522348 N_noFeature 1014505 30671705 1298693 N_ambiguous 888049 4529 153179 UnstrandedReadsAssigned:29790135 PositiveStrandReadsAssigned:1016455 NegativeStrandReadsAssigned:30240817 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450153 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450153-trimmed-pair1.fastq SRR8450153-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,710,105 reads, 31,322,570 reads pseudoaligned [quant] estimated average fragment length: 286.138 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52973 SRR8450153.ke.tsv 35125 SRR8450153.se.tsv 88098 total ==> SRR8450153.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 651.222 0 0 PNS24247 1044 758.862 89.9915 4.6858 PNS24249 1928 1642.86 219.388 5.27664 PNS24246 1044 758.862 89.9915 4.6858 PNS24248 1044 758.862 89.9915 4.6858 PNS24244 1471 1185.86 158.637 5.28587 PNS24243 293 83.2826 0 0 KQK14069 1603 1317.86 24795.1 743.431 KQK14071 474 214.936 106.143 19.5132 ==> SRR8450153.se.tsv <== BRADI_1g14170v3 24633 BRADI_1g53295v3 216 BRADI_1g59795v3 261 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 426 BRADI_1g74790v3 210 BRADI_1g09890v3 0 BRADI_1g77505v3 379 BRADI_1g48960v3 0 SRR8450153 completed mapping pipeline successfully