Starting /dee2/code/volunteer_pipeline.sh SRR8450154 current disk space = 1551845105664 free memory = 1602193004 SRR8450154 SRAfilesize c2fec033c9053193b0294a10556d7882 SRR8450154.sra SRR8450154.sra file validated SRR8450154 is paired end SRR8450154 is conventional basespace SRR8450154 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450154_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.14575 37.0 37.0 37.0 37.0 37.0 2 36.287 37.0 37.0 37.0 37.0 37.0 3 36.3335 37.0 37.0 37.0 37.0 37.0 4 36.3825 37.0 37.0 37.0 37.0 37.0 5 36.437 37.0 37.0 37.0 37.0 37.0 6 36.458 37.0 37.0 37.0 37.0 37.0 7 36.33 37.0 37.0 37.0 37.0 37.0 8 36.459 37.0 37.0 37.0 37.0 37.0 9 36.469 37.0 37.0 37.0 37.0 37.0 10-14 36.4505 37.0 37.0 37.0 37.0 37.0 15-19 36.408699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3912 37.0 37.0 37.0 37.0 37.0 25-29 36.301700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.318200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.311 37.0 37.0 37.0 37.0 37.0 40-44 36.28580000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.2908 37.0 37.0 37.0 37.0 37.0 50-54 36.26480000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.2397 37.0 37.0 37.0 37.0 37.0 60-64 36.1964 37.0 37.0 37.0 37.0 37.0 65-69 36.1236 37.0 37.0 37.0 37.0 37.0 70-74 36.22279999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1884 37.0 37.0 37.0 37.0 37.0 80-84 36.1751 37.0 37.0 37.0 37.0 37.0 85-89 36.1348 37.0 37.0 37.0 37.0 37.0 90-94 36.1411 37.0 37.0 37.0 37.0 37.0 95-99 36.0989 37.0 37.0 37.0 37.0 37.0 100-104 36.018899999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.047900000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.964299999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.9714 37.0 37.0 37.0 37.0 37.0 120-124 35.89919999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.8772 37.0 37.0 37.0 37.0 37.0 130-134 35.8309 37.0 37.0 37.0 37.0 37.0 135-139 35.8119 37.0 37.0 37.0 37.0 37.0 140-144 35.8611 37.0 37.0 37.0 37.0 37.0 145-149 35.718399999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.240750000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 4.0 26 6.0 27 12.0 28 18.0 29 22.0 30 42.0 31 43.0 32 63.0 33 90.0 34 161.0 35 348.0 36 2746.0 37 443.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.12164534737898 11.46225232004013 8.72836719337848 34.68773513920241 2 26.974999999999998 12.875 28.199999999999996 31.95 3 23.7 18.6 21.375 36.325 4 26.8 23.225 21.05 28.925 5 27.675 26.400000000000002 21.75 24.175 6 25.900000000000002 28.499999999999996 23.275000000000002 22.325 7 18.725 23.45 37.875 19.950000000000003 8 22.900000000000002 23.325000000000003 26.950000000000003 26.825 9 19.45 22.7 31.7 26.150000000000002 10-14 24.015 25.245 24.755 25.985000000000003 15-19 23.885 23.825 25.509999999999998 26.779999999999998 20-24 24.42 25.080000000000002 24.88 25.619999999999997 25-29 24.474999999999998 24.27 25.71 25.545 30-34 24.38 24.47 24.81 26.340000000000003 35-39 24.47 24.335 25.474999999999998 25.72 40-44 23.93 24.845 24.935 26.290000000000003 45-49 23.985 24.62 24.795 26.6 50-54 24.11 24.495 24.915000000000003 26.479999999999997 55-59 24.395 23.97 24.959999999999997 26.674999999999997 60-64 23.995 24.884999999999998 24.59 26.529999999999998 65-69 24.4 23.985 24.86 26.755000000000003 70-74 24.12 23.84 25.180000000000003 26.86 75-79 24.91 24.375 24.279999999999998 26.435 80-84 24.13 24.779999999999998 24.65 26.44 85-89 24.97 23.59 25.11 26.33 90-94 24.275 23.73 25.465 26.529999999999998 95-99 25.285000000000004 23.685000000000002 24.990000000000002 26.040000000000003 100-104 24.69 23.96 24.46 26.889999999999997 105-109 24.265 23.669999999999998 25.03 27.034999999999997 110-114 25.080000000000002 23.77 24.445 26.705000000000002 115-119 24.895 24.169999999999998 24.63 26.305 120-124 25.14 23.565 24.415 26.88 125-129 25.130000000000003 23.395 24.85 26.625 130-134 25.424999999999997 23.974999999999998 24.675 25.924999999999997 135-139 24.95 23.76 24.325 26.965 140-144 25.145 23.275000000000002 24.54 27.04 145-149 25.255 23.745 24.415 26.584999999999997 150-151 24.55 23.925 23.75 27.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 1.5 29 4.0 30 6.0 31 8.5 32 11.5 33 14.5 34 21.5 35 31.0 36 38.5 37 59.5 38 77.0 39 84.0 40 94.5 41 118.5 42 148.5 43 150.5 44 164.5 45 179.5 46 186.5 47 185.0 48 172.0 49 172.5 50 165.5 51 152.5 52 135.5 53 119.5 54 116.5 55 119.5 56 113.0 57 92.5 58 81.0 59 83.5 60 89.5 61 82.0 62 69.0 63 64.5 64 65.5 65 71.5 66 67.0 67 66.5 68 61.5 69 47.5 70 41.0 71 39.0 72 28.5 73 24.0 74 25.5 75 21.0 76 13.0 77 4.0 78 3.0 79 2.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.09781477627472 92.35 2 3.7460978147762747 7.199999999999999 3 0.15608740894901144 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.9125 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.2625000000000002 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.4249999999999998 0.0 0.0 0.0 0.0 134-135 1.5750000000000002 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8450154 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450154_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.842 37.0 37.0 37.0 37.0 37.0 2 35.6265 37.0 37.0 37.0 37.0 37.0 3 35.505 37.0 37.0 37.0 37.0 37.0 4 35.4395 37.0 37.0 37.0 37.0 37.0 5 35.4545 37.0 37.0 37.0 37.0 37.0 6 35.4275 37.0 37.0 37.0 37.0 37.0 7 35.483 37.0 37.0 37.0 37.0 37.0 8 35.4995 37.0 37.0 37.0 37.0 37.0 9 35.4305 37.0 37.0 37.0 37.0 37.0 10-14 35.3293 37.0 37.0 37.0 37.0 37.0 15-19 35.2483 37.0 37.0 37.0 37.0 37.0 20-24 35.072500000000005 37.0 37.0 37.0 29.8 37.0 25-29 35.053399999999996 37.0 37.0 37.0 34.6 37.0 30-34 35.004200000000004 37.0 37.0 37.0 27.4 37.0 35-39 35.009499999999996 37.0 37.0 37.0 32.2 37.0 40-44 34.8923 37.0 37.0 37.0 27.4 37.0 45-49 34.892100000000006 37.0 37.0 37.0 25.0 37.0 50-54 34.776599999999995 37.0 37.0 37.0 25.0 37.0 55-59 34.8046 37.0 37.0 37.0 25.0 37.0 60-64 34.811099999999996 37.0 37.0 37.0 25.0 37.0 65-69 34.761 37.0 37.0 37.0 25.0 37.0 70-74 34.601 37.0 37.0 37.0 25.0 37.0 75-79 34.7073 37.0 37.0 37.0 25.0 37.0 80-84 34.6255 37.0 37.0 37.0 25.0 37.0 85-89 34.638799999999996 37.0 37.0 37.0 25.0 37.0 90-94 34.60189999999999 37.0 37.0 37.0 25.0 37.0 95-99 34.6432 37.0 37.0 37.0 25.0 37.0 100-104 34.6429 37.0 37.0 37.0 25.0 37.0 105-109 34.58669999999999 37.0 37.0 37.0 25.0 37.0 110-114 34.4524 37.0 37.0 37.0 25.0 37.0 115-119 34.4773 37.0 37.0 37.0 25.0 37.0 120-124 34.459799999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.364700000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.2584 37.0 37.0 37.0 25.0 37.0 135-139 34.2875 37.0 37.0 37.0 25.0 37.0 140-144 34.0702 37.0 37.0 37.0 25.0 37.0 145-149 33.980399999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.26125 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 19.0 14 23.0 15 23.0 16 17.0 17 18.0 18 5.0 19 11.0 20 14.0 21 19.0 22 34.0 23 28.0 24 27.0 25 19.0 26 16.0 27 26.0 28 21.0 29 33.0 30 45.0 31 46.0 32 91.0 33 149.0 34 240.0 35 564.0 36 2316.0 37 194.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 19.950000000000003 11.125 29.025000000000002 2 35.4 22.25 21.0 21.349999999999998 3 27.650000000000002 24.0 24.575 23.775 4 30.575000000000003 29.125 17.75 22.55 5 31.125000000000004 28.925 18.275 21.675 6 28.000000000000004 32.2 18.15 21.65 7 26.55 19.925 30.75 22.775000000000002 8 28.799999999999997 22.875 20.275000000000002 28.050000000000004 9 27.05 22.6 23.549999999999997 26.8 10-14 29.09 24.765 21.205 24.94 15-19 28.08 24.955 22.07 24.895 20-24 27.589999999999996 26.015 21.42 24.975 25-29 27.405 25.324999999999996 22.21 25.06 30-34 27.01 25.740000000000002 22.255 24.995 35-39 27.529999999999998 25.650000000000002 21.634999999999998 25.185000000000002 40-44 27.91 24.875 22.175 25.040000000000003 45-49 27.57 25.895000000000003 21.84 24.695 50-54 27.750000000000004 25.165 22.14 24.945 55-59 27.41 25.71 21.990000000000002 24.89 60-64 27.534999999999997 25.695 22.07 24.7 65-69 27.48 25.740000000000002 21.73 25.05 70-74 27.88 25.445 21.85 24.825 75-79 27.08 25.495 22.325 25.1 80-84 27.47 25.395 22.105 25.03 85-89 27.38 25.595000000000002 22.24 24.785 90-94 27.215 25.955000000000002 21.765 25.064999999999998 95-99 26.665 26.155 22.25 24.93 100-104 27.665 25.314999999999998 22.085 24.935 105-109 27.6 25.6 22.605 24.195 110-114 27.515 25.855 22.24 24.39 115-119 27.93 25.564999999999998 21.815 24.69 120-124 27.439999999999998 26.174999999999997 21.865000000000002 24.52 125-129 27.605 26.340000000000003 21.54 24.515 130-134 26.919999999999998 26.384999999999998 21.73 24.965 135-139 27.62 26.195 21.84 24.345 140-144 27.485 26.119999999999997 22.375 24.02 145-149 27.305 25.900000000000002 22.134999999999998 24.66 150-151 27.3 26.5625 22.037499999999998 24.099999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.5 5 1.5 6 1.5 7 1.5 8 1.0 9 0.5 10 1.0 11 2.0 12 3.0 13 3.0 14 3.0 15 3.0 16 2.0 17 4.0 18 4.5 19 2.5 20 2.5 21 3.5 22 3.5 23 4.0 24 4.0 25 2.5 26 3.0 27 4.5 28 5.0 29 5.0 30 10.0 31 12.5 32 8.5 33 10.5 34 18.0 35 24.5 36 32.5 37 37.5 38 45.5 39 61.5 40 87.5 41 116.5 42 124.5 43 133.5 44 147.0 45 141.5 46 140.0 47 153.5 48 159.0 49 150.0 50 135.5 51 138.5 52 142.0 53 125.0 54 104.5 55 94.5 56 100.5 57 107.0 58 96.0 59 95.0 60 99.5 61 91.0 62 89.5 63 88.0 64 87.5 65 86.5 66 79.0 67 74.0 68 66.5 69 56.0 70 52.0 71 53.5 72 46.5 73 34.0 74 27.0 75 23.5 76 20.0 77 11.0 78 7.0 79 7.5 80 6.0 81 3.0 82 1.0 83 2.5 84 3.0 85 3.5 86 4.5 87 3.5 88 3.0 89 2.5 90 2.0 91 1.5 92 0.5 93 3.0 94 4.0 95 1.5 96 1.5 97 1.5 98 1.0 99 3.0 100 12.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 96.0810099947396 91.325 2 3.4718569174118885 6.6000000000000005 3 0.3945291951604419 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026301946344029457 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026301946344029457 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 31 0.775 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.3625 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.5875 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTTCT 10 0.006830828 145.0 3 >>END_MODULE Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303726 spots for SRR8450154.sra Written 1303726 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra Read 1303720 spots for SRR8450154.sra Written 1303720 spots for SRR8450154.sra SRR ids: ['SRR8450154.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bmooeqdn SRR8450154.sra spots: 26074406 blocks: [[1, 1303720], [1303721, 2607440], [2607441, 3911160], [3911161, 5214880], [5214881, 6518600], [6518601, 7822320], [7822321, 9126040], [9126041, 10429760], [10429761, 11733480], [11733481, 13037200], [13037201, 14340920], [14340921, 15644640], [15644641, 16948360], [16948361, 18252080], [18252081, 19555800], [19555801, 20859520], [20859521, 22163240], [22163241, 23466960], [23466961, 24770680], [24770681, 26074406]] SRR8450154 file size 8814060 SRR8450154 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450154 SRR8450154_1.fastq SRR8450154_2.fastq Input file: SRR8450154_1.fastq Paired file: SRR8450154_2.fastq trimmed: SRR8450154-trimmed-pair1.fastq, SRR8450154-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:23:43 2024 >> started Fri Dec 6 10:24:13 2024 >> done (29.882s) 26074406 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 13481 ( 0.05%) empty read pairs filtered out after trimming by size control 26060894 (99.95%) read pairs available; of these: 975558 ( 3.74%) trimmed read pairs available after processing 25085336 (96.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 9 0.00% 20 8 0.00% 21 5 0.00% 22 11 0.00% 23 7 0.00% 24 11 0.00% 25 17 0.00% 26 13 0.00% 27 9 0.00% 28 18 0.00% 29 10 0.00% 30 15 0.00% 31 27 0.00% 32 22 0.00% 33 19 0.00% 34 12 0.00% 35 25 0.00% 36 22 0.00% 37 19 0.00% 38 26 0.00% 39 26 0.00% 40 17 0.00% 41 20 0.00% 42 36 0.00% 43 19 0.00% 44 43 0.00% 45 23 0.00% 46 32 0.00% 47 35 0.00% 48 41 0.00% 49 28 0.00% 50 44 0.00% 51 33 0.00% 52 47 0.00% 53 49 0.00% 54 35 0.00% 55 45 0.00% 56 59 0.00% 57 44 0.00% 58 68 0.00% 59 56 0.00% 60 77 0.00% 61 76 0.00% 62 72 0.00% 63 83 0.00% 64 96 0.00% 65 100 0.00% 66 111 0.00% 67 119 0.00% 68 128 0.00% 69 142 0.00% 70 171 0.00% 71 183 0.00% 72 210 0.00% 73 247 0.00% 74 243 0.00% 75 301 0.00% 76 308 0.00% 77 319 0.00% 78 407 0.00% 79 450 0.00% 80 538 0.00% 81 645 0.00% 82 668 0.00% 83 798 0.00% 84 919 0.00% 85 971 0.00% 86 1069 0.00% 87 1258 0.00% 88 1322 0.01% 89 1464 0.01% 90 1654 0.01% 91 1763 0.01% 92 1969 0.01% 93 2162 0.01% 94 2403 0.01% 95 2690 0.01% 96 2976 0.01% 97 3153 0.01% 98 3346 0.01% 99 3681 0.01% 100 4027 0.02% 101 4113 0.02% 102 4780 0.02% 103 5035 0.02% 104 5407 0.02% 105 5723 0.02% 106 6154 0.02% 107 6238 0.02% 108 6772 0.03% 109 7240 0.03% 110 7505 0.03% 111 8223 0.03% 112 8512 0.03% 113 9187 0.04% 114 9785 0.04% 115 10543 0.04% 116 11018 0.04% 117 11303 0.04% 118 11859 0.05% 119 12201 0.05% 120 12904 0.05% 121 13489 0.05% 122 13954 0.05% 123 15046 0.06% 124 15928 0.06% 125 16565 0.06% 126 17472 0.07% 127 18289 0.07% 128 18346 0.07% 129 19144 0.07% 130 19715 0.08% 131 20772 0.08% 132 21779 0.08% 133 22751 0.09% 134 23844 0.09% 135 24897 0.10% 136 25542 0.10% 137 26267 0.10% 138 26847 0.10% 139 28075 0.11% 140 28898 0.11% 141 29188 0.11% 142 31045 0.12% 143 31964 0.12% 144 33313 0.13% 145 34654 0.13% 146 35821 0.14% 147 36764 0.14% 148 38083 0.15% 149 38555 0.15% 150 39622 0.15% 151 25085336 96.26% 26060894 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=26 prefix-density=0.56 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.19 sequence-density-rank=9 fanout-score=18.35 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=5.0 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCAACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGTGTG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=24 prefix-density=0.93 prefix-fanout=1.6 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=15 fanout-score=61.82 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=10.0 sequence=CCGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR8450154 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:26:24 Started mapping on | Dec 06 10:26:24 Finished on | Dec 06 10:30:54 Mapping speed, Million of reads per hour | 347.48 Number of input reads | 26060894 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23453983 Uniquely mapped reads % | 90.00% Average mapped length | 299.24 Number of splices: Total | 24468147 Number of splices: Annotated (sjdb) | 22958648 Number of splices: GT/AG | 24141999 Number of splices: GC/AG | 281461 Number of splices: AT/AC | 10228 Number of splices: Non-canonical | 34459 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.80 Insertion rate per base | 0.01% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314242 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 33538 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.75% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2292669 2292669 2292669 N_multimapping 314242 314242 314242 N_noFeature 736214 22744501 929845 N_ambiguous 621970 3731 107353 UnstrandedReadsAssigned:22095799 PositiveStrandReadsAssigned:705751 NegativeStrandReadsAssigned:22416785 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450154 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450154-trimmed-pair1.fastq SRR8450154-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,060,894 reads, 23,463,145 reads pseudoaligned [quant] estimated average fragment length: 306.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52973 SRR8450154.ke.tsv 35125 SRR8450154.se.tsv 88098 total ==> SRR8450154.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 631.347 0 0 PNS24247 1044 738.62 56.7082 4.16188 PNS24249 1928 1622.62 156.147 5.21652 PNS24246 1044 738.62 56.7082 4.16188 PNS24248 1044 738.62 56.7082 4.16188 PNS24244 1471 1165.62 100.728 4.68445 PNS24243 293 78.3112 0 0 KQK14069 1603 1297.62 7023.71 293.415 KQK14071 474 203.263 35.399 9.44056 ==> SRR8450154.se.tsv <== BRADI_1g14170v3 6901 BRADI_1g53295v3 171 BRADI_1g59795v3 306 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 372 BRADI_1g74790v3 226 BRADI_1g09890v3 0 BRADI_1g77505v3 374 BRADI_1g48960v3 0 SRR8450154 completed mapping pipeline successfully