Starting /dee2/code/volunteer_pipeline.sh SRR8450155 current disk space = 1551827365888 free memory = 1602171436 SRR8450155 SRAfilesize ed705dba6af8e53b08cf8f7cb7b24e92 SRR8450155.sra SRR8450155.sra file validated SRR8450155 is paired end SRR8450155 is conventional basespace SRR8450155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1345 37.0 37.0 37.0 37.0 37.0 2 36.3305 37.0 37.0 37.0 37.0 37.0 3 36.463 37.0 37.0 37.0 37.0 37.0 4 36.4885 37.0 37.0 37.0 37.0 37.0 5 36.5465 37.0 37.0 37.0 37.0 37.0 6 36.54 37.0 37.0 37.0 37.0 37.0 7 36.4685 37.0 37.0 37.0 37.0 37.0 8 36.482 37.0 37.0 37.0 37.0 37.0 9 36.48 37.0 37.0 37.0 37.0 37.0 10-14 36.4842 37.0 37.0 37.0 37.0 37.0 15-19 36.422000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4767 37.0 37.0 37.0 37.0 37.0 25-29 36.3963 37.0 37.0 37.0 37.0 37.0 30-34 36.398900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.3489 37.0 37.0 37.0 37.0 37.0 40-44 36.408699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3393 37.0 37.0 37.0 37.0 37.0 50-54 36.3143 37.0 37.0 37.0 37.0 37.0 55-59 36.26369999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.2727 37.0 37.0 37.0 37.0 37.0 65-69 36.17999999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2642 37.0 37.0 37.0 37.0 37.0 75-79 36.2255 37.0 37.0 37.0 37.0 37.0 80-84 36.2605 37.0 37.0 37.0 37.0 37.0 85-89 36.1237 37.0 37.0 37.0 37.0 37.0 90-94 36.215999999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.0963 37.0 37.0 37.0 37.0 37.0 100-104 36.116699999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.0698 37.0 37.0 37.0 37.0 37.0 110-114 36.0499 37.0 37.0 37.0 37.0 37.0 115-119 35.98440000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.9231 37.0 37.0 37.0 37.0 37.0 125-129 35.9038 37.0 37.0 37.0 37.0 37.0 130-134 35.92119999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.841 37.0 37.0 37.0 37.0 37.0 140-144 35.8755 37.0 37.0 37.0 37.0 37.0 145-149 35.826 37.0 37.0 37.0 37.0 37.0 150-151 35.24725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 5.0 26 10.0 27 12.0 28 14.0 29 34.0 30 30.0 31 39.0 32 57.0 33 70.0 34 141.0 35 314.0 36 2766.0 37 505.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.956740442655935 12.575452716297786 8.299798792756539 32.168008048289735 2 26.424999999999997 12.5 27.425 33.650000000000006 3 23.35 16.400000000000002 22.525000000000002 37.724999999999994 4 26.400000000000002 21.775 19.825 32.0 5 28.15 25.474999999999998 21.625 24.75 6 24.55 27.175 23.200000000000003 25.074999999999996 7 19.8 25.324999999999996 35.925000000000004 18.95 8 21.05 25.825 28.375 24.75 9 21.525 22.225 31.775 24.474999999999998 10-14 23.825 25.775 25.03 25.369999999999997 15-19 24.044999999999998 24.615000000000002 24.79 26.55 20-24 23.75 24.709999999999997 24.945 26.595000000000002 25-29 24.3 24.895 24.41 26.395000000000003 30-34 24.55 24.705 24.11 26.634999999999998 35-39 24.445 24.38 24.279999999999998 26.895000000000003 40-44 24.335 25.005 24.39 26.27 45-49 24.195 24.98 24.055 26.77 50-54 24.03 23.985 24.310000000000002 27.675 55-59 24.279999999999998 24.255 24.09 27.375 60-64 24.474999999999998 24.735 23.630000000000003 27.16 65-69 24.335 24.055 24.15 27.46 70-74 24.845 23.919999999999998 24.005000000000003 27.229999999999997 75-79 24.58 23.905 24.43 27.084999999999997 80-84 25.47 24.315 24.215 26.0 85-89 25.15 23.7 24.09 27.060000000000002 90-94 25.724999999999998 24.02 23.544999999999998 26.71 95-99 24.69 24.195 23.865 27.250000000000004 100-104 25.374999999999996 23.555 24.07 27.0 105-109 25.679999999999996 23.400000000000002 23.71 27.21 110-114 26.13 23.625 23.53 26.715 115-119 25.369999999999997 23.925 23.724999999999998 26.979999999999997 120-124 25.955000000000002 23.29 23.635 27.12 125-129 25.590000000000003 23.64 23.165 27.605 130-134 25.869999999999997 23.235 23.755000000000003 27.139999999999997 135-139 26.08 23.485 23.28 27.155 140-144 26.224999999999998 23.445 23.43 26.900000000000002 145-149 25.64 22.97 23.400000000000002 27.99 150-151 26.474999999999998 23.075000000000003 23.0 27.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 3.0 29 3.5 30 5.0 31 7.5 32 11.5 33 22.0 34 30.0 35 30.5 36 37.0 37 57.5 38 81.5 39 87.0 40 86.5 41 108.5 42 142.5 43 158.5 44 153.0 45 153.5 46 165.5 47 162.5 48 158.5 49 169.0 50 145.5 51 137.5 52 150.0 53 129.5 54 103.5 55 102.0 56 113.0 57 110.5 58 93.0 59 83.0 60 76.0 61 70.0 62 81.0 63 85.0 64 84.5 65 86.0 66 74.5 67 58.0 68 56.0 69 51.0 70 44.5 71 45.0 72 40.5 73 34.5 74 27.5 75 20.0 76 15.0 77 14.0 78 11.5 79 5.5 80 3.0 81 3.5 82 2.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.30312665606783 88.97500000000001 2 5.511393746687864 10.4 3 0.13248542660307366 0.375 4 0.026497085320614733 0.1 5 0.0 0.0 6 0.026497085320614733 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGACTGTTATCTCGTAT 6 0.15 TruSeq Adapter, Index 4 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0125 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0125 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.0875 0.0 0.0 0.0 0.025 94-95 0.1 0.0 0.0 0.0 0.025 96-97 0.1 0.0 0.0 0.0 0.025 98-99 0.1125 0.0 0.0 0.0 0.025 100-101 0.15 0.0 0.0 0.0 0.025 102-103 0.225 0.0 0.0 0.0 0.025 104-105 0.325 0.0 0.0 0.0 0.025 106-107 0.375 0.0 0.0 0.0 0.025 108-109 0.475 0.0 0.0 0.0 0.025 110-111 0.6375 0.0 0.0 0.0 0.025 112-113 0.7375 0.0 0.0 0.0 0.025 114-115 0.8375 0.0 0.0 0.0 0.025 116-117 0.9874999999999999 0.0 0.0 0.0 0.025 118-119 1.175 0.0 0.0 0.0 0.025 120-121 1.3624999999999998 0.0 0.0 0.0 0.025 122-123 1.525 0.0 0.0 0.0 0.025 124-125 1.75 0.0 0.0 0.0 0.025 126-127 1.9375 0.0 0.0 0.0 0.025 128-129 2.1375 0.0 0.0 0.0 0.025 130-131 2.425 0.0 0.0 0.0 0.025 132-133 2.75 0.0 0.0 0.0 0.025 134-135 3.25 0.0 0.0 0.0 0.025 136-137 3.575 0.0 0.0 0.0 0.025 138-139 3.9875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8450155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8225 37.0 37.0 37.0 37.0 37.0 2 35.5295 37.0 37.0 37.0 37.0 37.0 3 35.4485 37.0 37.0 37.0 37.0 37.0 4 35.4155 37.0 37.0 37.0 37.0 37.0 5 35.3175 37.0 37.0 37.0 37.0 37.0 6 35.3585 37.0 37.0 37.0 37.0 37.0 7 35.187 37.0 37.0 37.0 37.0 37.0 8 35.213 37.0 37.0 37.0 37.0 37.0 9 35.245 37.0 37.0 37.0 37.0 37.0 10-14 35.0441 37.0 37.0 37.0 32.2 37.0 15-19 34.923 37.0 37.0 37.0 27.4 37.0 20-24 34.918400000000005 37.0 37.0 37.0 25.0 37.0 25-29 34.7208 37.0 37.0 37.0 25.0 37.0 30-34 34.7075 37.0 37.0 37.0 25.0 37.0 35-39 34.6851 37.0 37.0 37.0 25.0 37.0 40-44 34.5211 37.0 37.0 37.0 25.0 37.0 45-49 34.6246 37.0 37.0 37.0 25.0 37.0 50-54 34.5165 37.0 37.0 37.0 25.0 37.0 55-59 34.5385 37.0 37.0 37.0 25.0 37.0 60-64 34.449200000000005 37.0 37.0 37.0 25.0 37.0 65-69 34.5334 37.0 37.0 37.0 25.0 37.0 70-74 34.381099999999996 37.0 37.0 37.0 25.0 37.0 75-79 34.42 37.0 37.0 37.0 25.0 37.0 80-84 34.386700000000005 37.0 37.0 37.0 25.0 37.0 85-89 34.4024 37.0 37.0 37.0 25.0 37.0 90-94 34.3041 37.0 37.0 37.0 25.0 37.0 95-99 34.3346 37.0 37.0 37.0 25.0 37.0 100-104 34.2444 37.0 37.0 37.0 25.0 37.0 105-109 34.2941 37.0 37.0 37.0 25.0 37.0 110-114 34.2721 37.0 37.0 37.0 25.0 37.0 115-119 34.2527 37.0 37.0 37.0 25.0 37.0 120-124 34.215599999999995 37.0 37.0 37.0 25.0 37.0 125-129 34.1206 37.0 37.0 37.0 25.0 37.0 130-134 34.020500000000006 37.0 37.0 37.0 25.0 37.0 135-139 34.0359 37.0 37.0 37.0 25.0 37.0 140-144 33.761199999999995 37.0 37.0 37.0 22.2 37.0 145-149 33.7646 37.0 37.0 37.0 25.0 37.0 150-151 32.955749999999995 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 21.0 14 29.0 15 28.0 16 31.0 17 20.0 18 14.0 19 22.0 20 22.0 21 38.0 22 37.0 23 34.0 24 33.0 25 26.0 26 19.0 27 21.0 28 26.0 29 33.0 30 36.0 31 45.0 32 64.0 33 98.0 34 173.0 35 512.0 36 2384.0 37 232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.75 19.05 9.875 28.325 2 35.625 23.275000000000002 19.575 21.525 3 29.549999999999997 24.349999999999998 22.925 23.175 4 31.85 28.225 17.575 22.35 5 33.35 28.549999999999997 16.7 21.4 6 28.7 31.574999999999996 18.175 21.55 7 28.725 19.5 27.825 23.95 8 28.9 23.45 19.825 27.825 9 28.125 22.400000000000002 23.275000000000002 26.200000000000003 10-14 30.12 25.009999999999998 19.96 24.91 15-19 29.87 24.58 20.49 25.06 20-24 28.355000000000004 24.745 21.6 25.3 25-29 28.32 25.724999999999998 20.485 25.47 30-34 27.865000000000002 25.91 21.27 24.955 35-39 27.725 26.235000000000003 21.099999999999998 24.94 40-44 27.694999999999997 25.785000000000004 21.365000000000002 25.155 45-49 27.650000000000002 25.525 21.68 25.145 50-54 27.310000000000002 26.279999999999998 21.25 25.16 55-59 28.435 25.915 20.630000000000003 25.019999999999996 60-64 27.450000000000003 25.95 21.32 25.28 65-69 27.860000000000003 26.405 21.285 24.45 70-74 28.110000000000003 25.485000000000003 21.23 25.174999999999997 75-79 27.49 25.685000000000002 21.62 25.205 80-84 27.785 25.845000000000002 21.095 25.275 85-89 27.794999999999998 26.009999999999998 21.279999999999998 24.915000000000003 90-94 26.865 26.125 21.7 25.31 95-99 28.110000000000003 25.72 21.37 24.8 100-104 28.285 25.825 20.945 24.945 105-109 27.279999999999998 25.795 21.84 25.085 110-114 27.889999999999997 26.435 21.05 24.625 115-119 28.54 25.924999999999997 20.91 24.625 120-124 27.474999999999998 26.655 21.529999999999998 24.34 125-129 27.455000000000002 26.565 21.46 24.52 130-134 28.38 26.634999999999998 21.32 23.665 135-139 27.925 26.93 21.22 23.925 140-144 28.275 26.96 21.505 23.26 145-149 28.325 25.895000000000003 21.32 24.46 150-151 28.5625 25.937500000000004 21.4 24.099999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 1.0 8 2.0 9 4.0 10 5.0 11 2.5 12 1.5 13 2.5 14 3.5 15 4.5 16 4.0 17 2.0 18 1.5 19 4.0 20 5.5 21 6.0 22 4.5 23 4.5 24 4.5 25 4.5 26 4.0 27 6.0 28 8.0 29 6.5 30 7.0 31 7.5 32 10.0 33 11.5 34 15.0 35 21.5 36 28.5 37 36.0 38 42.0 39 55.5 40 81.0 41 106.0 42 109.0 43 113.0 44 124.0 45 142.5 46 158.5 47 149.5 48 153.0 49 154.5 50 141.0 51 131.5 52 109.5 53 99.0 54 109.5 55 117.5 56 120.5 57 112.0 58 102.5 59 93.0 60 82.5 61 82.0 62 86.5 63 96.5 64 90.5 65 78.5 66 80.5 67 84.0 68 75.0 69 74.0 70 70.5 71 48.5 72 44.0 73 42.5 74 36.0 75 24.0 76 18.0 77 16.5 78 12.0 79 9.5 80 7.5 81 5.0 82 3.5 83 4.5 84 2.0 85 1.0 86 1.5 87 1.5 88 2.0 89 1.5 90 1.5 91 1.0 92 1.0 93 3.0 94 2.5 95 2.0 96 3.5 97 4.0 98 4.0 99 4.5 100 18.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 94.74386339381003 88.775 2 5.042689434364995 9.45 3 0.16008537886872998 0.44999999999999996 4 0.0 0.0 5 0.026680896478121666 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026680896478121666 1.2 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 48 1.2 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 3.1 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 405 0.0017167695 12.530864 1 >>END_MODULE Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534282 spots for SRR8450155.sra Written 1534282 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra Read 1534267 spots for SRR8450155.sra Written 1534267 spots for SRR8450155.sra SRR ids: ['SRR8450155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nf9b5v4z SRR8450155.sra spots: 30685355 blocks: [[1, 1534267], [1534268, 3068534], [3068535, 4602801], [4602802, 6137068], [6137069, 7671335], [7671336, 9205602], [9205603, 10739869], [10739870, 12274136], [12274137, 13808403], [13808404, 15342670], [15342671, 16876937], [16876938, 18411204], [18411205, 19945471], [19945472, 21479738], [21479739, 23014005], [23014006, 24548272], [24548273, 26082539], [26082540, 27616806], [27616807, 29151073], [29151074, 30685355]] SRR8450155 file size 10376559 SRR8450155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450155 SRR8450155_1.fastq SRR8450155_2.fastq Input file: SRR8450155_1.fastq Paired file: SRR8450155_2.fastq trimmed: SRR8450155-trimmed-pair1.fastq, SRR8450155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:23:59 2024 >> started Fri Dec 6 10:25:45 2024 >> done (105.697s) 30685355 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 50907 ( 0.17%) empty read pairs filtered out after trimming by size control 30634374 (99.83%) read pairs available; of these: 2051995 ( 6.70%) trimmed read pairs available after processing 28582379 (93.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 5 0.00% 21 5 0.00% 22 7 0.00% 23 11 0.00% 24 8 0.00% 25 14 0.00% 26 5 0.00% 27 9 0.00% 28 15 0.00% 29 8 0.00% 30 14 0.00% 31 7 0.00% 32 21 0.00% 33 26 0.00% 34 12 0.00% 35 16 0.00% 36 11 0.00% 37 21 0.00% 38 20 0.00% 39 37 0.00% 40 29 0.00% 41 17 0.00% 42 24 0.00% 43 25 0.00% 44 25 0.00% 45 34 0.00% 46 34 0.00% 47 25 0.00% 48 29 0.00% 49 40 0.00% 50 38 0.00% 51 50 0.00% 52 42 0.00% 53 31 0.00% 54 41 0.00% 55 52 0.00% 56 53 0.00% 57 67 0.00% 58 52 0.00% 59 71 0.00% 60 78 0.00% 61 102 0.00% 62 99 0.00% 63 113 0.00% 64 134 0.00% 65 129 0.00% 66 136 0.00% 67 169 0.00% 68 185 0.00% 69 227 0.00% 70 192 0.00% 71 269 0.00% 72 292 0.00% 73 363 0.00% 74 397 0.00% 75 432 0.00% 76 571 0.00% 77 538 0.00% 78 619 0.00% 79 765 0.00% 80 877 0.00% 81 1040 0.00% 82 1170 0.00% 83 1354 0.00% 84 1584 0.01% 85 1692 0.01% 86 1975 0.01% 87 2097 0.01% 88 2397 0.01% 89 2657 0.01% 90 2926 0.01% 91 3280 0.01% 92 3801 0.01% 93 4233 0.01% 94 4634 0.02% 95 5242 0.02% 96 5647 0.02% 97 6491 0.02% 98 6862 0.02% 99 7466 0.02% 100 8003 0.03% 101 8914 0.03% 102 9354 0.03% 103 10315 0.03% 104 11316 0.04% 105 11993 0.04% 106 13093 0.04% 107 13796 0.05% 108 14660 0.05% 109 15987 0.05% 110 16815 0.05% 111 17965 0.06% 112 18895 0.06% 113 20258 0.07% 114 21342 0.07% 115 22749 0.07% 116 24067 0.08% 117 24932 0.08% 118 26240 0.09% 119 27669 0.09% 120 28891 0.09% 121 30026 0.10% 122 31252 0.10% 123 32839 0.11% 124 34901 0.11% 125 36351 0.12% 126 37595 0.12% 127 39766 0.13% 128 40115 0.13% 129 42091 0.14% 130 43681 0.14% 131 45335 0.15% 132 47447 0.15% 133 49403 0.16% 134 51069 0.17% 135 52472 0.17% 136 54014 0.18% 137 55516 0.18% 138 57141 0.19% 139 59060 0.19% 140 60843 0.20% 141 62581 0.20% 142 64702 0.21% 143 65720 0.21% 144 68032 0.22% 145 69936 0.23% 146 71999 0.24% 147 73788 0.24% 148 76072 0.25% 149 77070 0.25% 150 79629 0.26% 151 28582379 93.30% 30634374 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=14.61 fanout-score-rank=5 prefix-density=1.35 prefix-fanout=5.1 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=31.37 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.6 sequence=GGCCAGCTCCTATAGTGTGACGGGCGGTGTGTACAA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.55 fanout-score-rank=43 prefix-density=0.50 prefix-fanout=1.4 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=70.34 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR8450155 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:26:36 Started mapping on | Dec 06 10:26:36 Finished on | Dec 06 10:31:07 Mapping speed, Million of reads per hour | 406.95 Number of input reads | 30634374 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 26731458 Uniquely mapped reads % | 87.26% Average mapped length | 297.94 Number of splices: Total | 25977484 Number of splices: Annotated (sjdb) | 24392897 Number of splices: GT/AG | 25626031 Number of splices: GC/AG | 301827 Number of splices: AT/AC | 10033 Number of splices: Non-canonical | 39593 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.84 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495180 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 61691 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.44% % of reads unmapped: other | 1.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3407736 3407736 3407736 N_multimapping 495180 495180 495180 N_noFeature 842325 25893481 1036865 N_ambiguous 768422 3695 126223 UnstrandedReadsAssigned:25120711 PositiveStrandReadsAssigned:834282 NegativeStrandReadsAssigned:25568370 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450155-trimmed-pair1.fastq SRR8450155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,634,374 reads, 27,117,684 reads pseudoaligned [quant] estimated average fragment length: 270.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR8450155.ke.tsv 35125 SRR8450155.se.tsv 88098 total ==> SRR8450155.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.321 0.00010184 6.87726e-06 PNS24247 1044 774.935 55.8877 3.25001 PNS24249 1928 1658.93 237.358 6.44776 PNS24246 1044 774.935 55.8877 3.25001 PNS24248 1044 774.935 55.8877 3.25001 PNS24244 1471 1201.93 149.979 5.62319 PNS24243 293 87.3009 0 0 KQK14069 1603 1333.93 5445.23 183.957 KQK14071 474 224.949 126.612 25.3644 ==> SRR8450155.se.tsv <== BRADI_1g14170v3 5576 BRADI_1g53295v3 154 BRADI_1g59795v3 352 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 348 BRADI_1g74790v3 158 BRADI_1g09890v3 0 BRADI_1g77505v3 676 BRADI_1g48960v3 0 SRR8450155 completed mapping pipeline successfully