Starting /dee2/code/volunteer_pipeline.sh SRR8450156 current disk space = 1551827365888 free memory = 1602171592 SRR8450156 SRAfilesize 341a885282a359642d2ff0e10e7a6835 SRR8450156.sra SRR8450156.sra file validated SRR8450156 is paired end SRR8450156 is conventional basespace SRR8450156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21075 37.0 37.0 37.0 37.0 37.0 2 36.2025 37.0 37.0 37.0 37.0 37.0 3 36.4265 37.0 37.0 37.0 37.0 37.0 4 36.4085 37.0 37.0 37.0 37.0 37.0 5 36.4665 37.0 37.0 37.0 37.0 37.0 6 36.429 37.0 37.0 37.0 37.0 37.0 7 36.3965 37.0 37.0 37.0 37.0 37.0 8 36.425 37.0 37.0 37.0 37.0 37.0 9 36.423 37.0 37.0 37.0 37.0 37.0 10-14 36.4173 37.0 37.0 37.0 37.0 37.0 15-19 36.4228 37.0 37.0 37.0 37.0 37.0 20-24 36.41420000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2878 37.0 37.0 37.0 37.0 37.0 30-34 36.346000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.263999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2606 37.0 37.0 37.0 37.0 37.0 45-49 36.254000000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2222 37.0 37.0 37.0 37.0 37.0 55-59 36.196600000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0917 37.0 37.0 37.0 37.0 37.0 65-69 36.0882 37.0 37.0 37.0 37.0 37.0 70-74 36.1967 37.0 37.0 37.0 37.0 37.0 75-79 36.081300000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.124900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0753 37.0 37.0 37.0 37.0 37.0 90-94 36.040200000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.0721 37.0 37.0 37.0 37.0 37.0 100-104 35.9754 37.0 37.0 37.0 37.0 37.0 105-109 35.9883 37.0 37.0 37.0 37.0 37.0 110-114 35.9253 37.0 37.0 37.0 37.0 37.0 115-119 35.9811 37.0 37.0 37.0 37.0 37.0 120-124 35.8448 37.0 37.0 37.0 37.0 37.0 125-129 35.8762 37.0 37.0 37.0 37.0 37.0 130-134 35.8268 37.0 37.0 37.0 37.0 37.0 135-139 35.78660000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.7643 37.0 37.0 37.0 37.0 37.0 145-149 35.6807 37.0 37.0 37.0 37.0 37.0 150-151 35.1025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 1.0 25 4.0 26 12.0 27 14.0 28 24.0 29 29.0 30 38.0 31 40.0 32 66.0 33 100.0 34 155.0 35 307.0 36 2773.0 37 434.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.12816654125909 12.942061700526711 8.72836719337848 31.201404564835716 2 26.413206603301653 14.70735367683842 27.688844422211105 31.190595297648827 3 22.375 19.85 23.849999999999998 33.925 4 26.674999999999997 24.9 21.025 27.400000000000002 5 26.400000000000002 27.975 22.525000000000002 23.1 6 23.724999999999998 29.425 23.95 22.900000000000002 7 19.075 23.05 37.75 20.125 8 22.925 21.8 26.775 28.499999999999996 9 20.0 22.025 32.125 25.85 10-14 24.12 25.0 25.025 25.855 15-19 24.095 24.38 24.985 26.540000000000003 20-24 23.630000000000003 24.865000000000002 25.39 26.115 25-29 23.66 24.745 24.740000000000002 26.855 30-34 24.16 24.9 24.79 26.150000000000002 35-39 24.0 24.595 24.545 26.86 40-44 24.709999999999997 24.154999999999998 24.565 26.57 45-49 24.79 23.655 25.069999999999997 26.484999999999996 50-54 24.27 24.825 24.525 26.38 55-59 24.08 24.625 24.959999999999997 26.334999999999997 60-64 24.834999999999997 24.385 24.505 26.275 65-69 24.395 24.154999999999998 24.535 26.915 70-74 24.525 24.279999999999998 24.69 26.505000000000003 75-79 24.87 24.065 24.335 26.729999999999997 80-84 24.85 24.255 24.435000000000002 26.46 85-89 24.610000000000003 23.755000000000003 24.515 27.12 90-94 25.16 23.68 24.145 27.015 95-99 25.045 23.505000000000003 24.575 26.875 100-104 25.195 24.275 24.375 26.155 105-109 25.074999999999996 23.35 24.355 27.22 110-114 25.324999999999996 23.895 24.205 26.575 115-119 25.180000000000003 23.335 24.115000000000002 27.37 120-124 25.11 24.035 24.425 26.43 125-129 25.040000000000003 24.205 24.095 26.66 130-134 25.230000000000004 23.525 24.15 27.095000000000002 135-139 24.529999999999998 23.645 24.295 27.529999999999998 140-144 25.025 23.51 24.495 26.97 145-149 25.025 23.895 23.855 27.224999999999998 150-151 24.925 23.474999999999998 24.462500000000002 27.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 3.0 28 4.0 29 3.0 30 5.0 31 9.5 32 12.5 33 21.5 34 25.5 35 26.0 36 43.0 37 58.5 38 75.0 39 89.0 40 105.5 41 122.0 42 129.5 43 140.5 44 156.0 45 172.0 46 180.0 47 180.0 48 179.0 49 176.0 50 157.0 51 141.0 52 139.5 53 133.5 54 110.5 55 98.0 56 101.0 57 91.5 58 91.0 59 89.5 60 80.0 61 73.0 62 66.5 63 72.0 64 78.0 65 75.0 66 65.0 67 54.5 68 57.0 69 56.5 70 48.0 71 37.5 72 28.5 73 29.0 74 28.5 75 21.0 76 16.5 77 16.0 78 8.0 79 4.5 80 4.0 81 2.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10783798001053 90.4 2 4.576538663861126 8.7 3 0.31562335612835346 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.3875 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.65 0.0 0.0 0.0 0.0 138-139 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8450156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.891 37.0 37.0 37.0 37.0 37.0 2 35.3685 37.0 37.0 37.0 37.0 37.0 3 35.2725 37.0 37.0 37.0 37.0 37.0 4 35.413 37.0 37.0 37.0 37.0 37.0 5 35.3475 37.0 37.0 37.0 37.0 37.0 6 35.1245 37.0 37.0 37.0 25.0 37.0 7 35.144 37.0 37.0 37.0 37.0 37.0 8 35.3005 37.0 37.0 37.0 37.0 37.0 9 35.1255 37.0 37.0 37.0 37.0 37.0 10-14 35.060700000000004 37.0 37.0 37.0 29.8 37.0 15-19 34.9661 37.0 37.0 37.0 29.8 37.0 20-24 34.8226 37.0 37.0 37.0 25.0 37.0 25-29 34.7031 37.0 37.0 37.0 25.0 37.0 30-34 34.637100000000004 37.0 37.0 37.0 25.0 37.0 35-39 34.667500000000004 37.0 37.0 37.0 25.0 37.0 40-44 34.588300000000004 37.0 37.0 37.0 25.0 37.0 45-49 34.613 37.0 37.0 37.0 25.0 37.0 50-54 34.4757 37.0 37.0 37.0 25.0 37.0 55-59 34.520599999999995 37.0 37.0 37.0 25.0 37.0 60-64 34.44199999999999 37.0 37.0 37.0 25.0 37.0 65-69 34.4295 37.0 37.0 37.0 25.0 37.0 70-74 34.354699999999994 37.0 37.0 37.0 25.0 37.0 75-79 34.368700000000004 37.0 37.0 37.0 25.0 37.0 80-84 34.410700000000006 37.0 37.0 37.0 25.0 37.0 85-89 34.3563 37.0 37.0 37.0 25.0 37.0 90-94 34.397400000000005 37.0 37.0 37.0 25.0 37.0 95-99 34.379000000000005 37.0 37.0 37.0 25.0 37.0 100-104 34.3507 37.0 37.0 37.0 25.0 37.0 105-109 34.2923 37.0 37.0 37.0 25.0 37.0 110-114 34.208200000000005 37.0 37.0 37.0 25.0 37.0 115-119 34.1947 37.0 37.0 37.0 25.0 37.0 120-124 34.2158 37.0 37.0 37.0 25.0 37.0 125-129 34.102199999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.0398 37.0 37.0 37.0 25.0 37.0 135-139 33.9621 37.0 37.0 37.0 25.0 37.0 140-144 33.8101 37.0 37.0 37.0 25.0 37.0 145-149 33.8356 37.0 37.0 37.0 25.0 37.0 150-151 33.0235 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 22.0 14 28.0 15 28.0 16 21.0 17 14.0 18 18.0 19 20.0 20 18.0 21 30.0 22 37.0 23 43.0 24 37.0 25 16.0 26 27.0 27 24.0 28 17.0 29 35.0 30 39.0 31 54.0 32 60.0 33 117.0 34 237.0 35 552.0 36 2302.0 37 199.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.125 17.724999999999998 10.375 26.775 2 36.325 21.0 20.825 21.85 3 29.375 23.35 23.849999999999998 23.425 4 31.775 28.499999999999996 17.925 21.8 5 31.5 30.425 17.45 20.625 6 28.225 32.875 17.8 21.099999999999998 7 28.449999999999996 20.3 28.050000000000004 23.200000000000003 8 29.425 23.35 19.7 27.525 9 26.525 21.925 24.224999999999998 27.325 10-14 29.395 25.1 20.305 25.2 15-19 28.215 24.474999999999998 21.68 25.629999999999995 20-24 28.77 25.91 21.115000000000002 24.205 25-29 28.360000000000003 26.165 20.94 24.535 30-34 27.389999999999997 25.83 21.925 24.855 35-39 27.575 25.869999999999997 21.6 24.955 40-44 27.334999999999997 26.435 21.525 24.705 45-49 27.305 26.14 21.560000000000002 24.995 50-54 27.57 25.740000000000002 21.785 24.905 55-59 27.83 26.13 21.555 24.485 60-64 27.345000000000002 26.179999999999996 21.83 24.645 65-69 27.505000000000003 26.235000000000003 21.5 24.759999999999998 70-74 27.66 26.095000000000002 21.46 24.785 75-79 27.255000000000003 26.685 21.8 24.26 80-84 26.85 26.195 21.465 25.490000000000002 85-89 27.05 26.135 21.855 24.959999999999997 90-94 27.02 26.6 21.705 24.675 95-99 26.729999999999997 26.935 21.740000000000002 24.595 100-104 27.965 26.224999999999998 21.44 24.37 105-109 27.095000000000002 25.88 22.189999999999998 24.834999999999997 110-114 27.195000000000004 26.545 21.765 24.495 115-119 26.784999999999997 26.86 21.495 24.86 120-124 26.855 26.674999999999997 21.9 24.57 125-129 27.395000000000003 26.52 21.575 24.51 130-134 26.919999999999998 27.029999999999998 21.32 24.73 135-139 27.015 27.150000000000002 21.845 23.990000000000002 140-144 26.905 27.195000000000004 21.715 24.185000000000002 145-149 27.685 26.729999999999997 21.595 23.990000000000002 150-151 26.487500000000004 27.85 21.1625 24.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.5 6 3.5 7 2.5 8 2.0 9 2.5 10 1.5 11 0.5 12 1.5 13 4.0 14 4.5 15 4.5 16 5.0 17 7.0 18 7.5 19 4.0 20 3.0 21 4.5 22 6.0 23 4.5 24 1.5 25 4.0 26 4.5 27 3.0 28 5.5 29 7.0 30 8.0 31 13.0 32 13.5 33 14.5 34 19.0 35 21.0 36 29.0 37 37.0 38 44.0 39 66.5 40 82.0 41 86.0 42 108.0 43 129.5 44 149.0 45 157.5 46 146.5 47 152.5 48 155.0 49 146.0 50 149.0 51 153.0 52 146.0 53 136.5 54 123.0 55 111.5 56 97.5 57 84.5 58 86.5 59 98.5 60 90.0 61 74.0 62 74.5 63 76.0 64 70.5 65 62.5 66 70.5 67 75.0 68 72.5 69 68.0 70 65.0 71 57.5 72 51.0 73 41.5 74 30.5 75 29.5 76 23.5 77 15.5 78 10.0 79 5.0 80 3.5 81 4.5 82 3.5 83 2.0 84 3.5 85 4.0 86 2.5 87 2.5 88 2.5 89 1.5 90 2.0 91 1.5 92 1.5 93 1.5 94 1.0 95 2.0 96 1.5 97 2.0 98 4.0 99 4.5 100 14.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.20021214531954 89.75 2 4.5080880403076105 8.5 3 0.23866348448687352 0.675 4 0.026518164942985947 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026518164942985947 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 39 0.975 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.4000000000000004 0.0 0.0 0.0 0.0 136-137 2.6 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGAAG 10 0.006830828 145.0 2 >>END_MODULE Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181527 spots for SRR8450156.sra Written 1181527 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra Read 1181508 spots for SRR8450156.sra Written 1181508 spots for SRR8450156.sra SRR ids: ['SRR8450156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_30oa0ttf SRR8450156.sra spots: 23630179 blocks: [[1, 1181508], [1181509, 2363016], [2363017, 3544524], [3544525, 4726032], [4726033, 5907540], [5907541, 7089048], [7089049, 8270556], [8270557, 9452064], [9452065, 10633572], [10633573, 11815080], [11815081, 12996588], [12996589, 14178096], [14178097, 15359604], [15359605, 16541112], [16541113, 17722620], [17722621, 18904128], [18904129, 20085636], [20085637, 21267144], [21267145, 22448652], [22448653, 23630179]] SRR8450156 file size 7985791 SRR8450156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450156 SRR8450156_1.fastq SRR8450156_2.fastq Input file: SRR8450156_1.fastq Paired file: SRR8450156_2.fastq trimmed: SRR8450156-trimmed-pair1.fastq, SRR8450156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:21:00 2024 >> started Fri Dec 6 10:21:25 2024 >> done (25.205s) 23630179 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 16173 ( 0.07%) empty read pairs filtered out after trimming by size control 23613964 (99.93%) read pairs available; of these: 1141379 ( 4.83%) trimmed read pairs available after processing 22472585 (95.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 3 0.00% 21 1 0.00% 22 7 0.00% 23 7 0.00% 24 3 0.00% 25 9 0.00% 26 17 0.00% 27 13 0.00% 28 10 0.00% 29 15 0.00% 30 10 0.00% 31 13 0.00% 32 25 0.00% 33 19 0.00% 34 11 0.00% 35 10 0.00% 36 15 0.00% 37 14 0.00% 38 17 0.00% 39 20 0.00% 40 21 0.00% 41 23 0.00% 42 14 0.00% 43 16 0.00% 44 13 0.00% 45 19 0.00% 46 26 0.00% 47 27 0.00% 48 26 0.00% 49 31 0.00% 50 33 0.00% 51 26 0.00% 52 32 0.00% 53 38 0.00% 54 42 0.00% 55 47 0.00% 56 47 0.00% 57 38 0.00% 58 42 0.00% 59 50 0.00% 60 52 0.00% 61 68 0.00% 62 64 0.00% 63 64 0.00% 64 99 0.00% 65 83 0.00% 66 108 0.00% 67 105 0.00% 68 126 0.00% 69 134 0.00% 70 139 0.00% 71 171 0.00% 72 228 0.00% 73 222 0.00% 74 246 0.00% 75 299 0.00% 76 308 0.00% 77 406 0.00% 78 440 0.00% 79 455 0.00% 80 510 0.00% 81 601 0.00% 82 728 0.00% 83 835 0.00% 84 915 0.00% 85 1007 0.00% 86 1141 0.00% 87 1239 0.01% 88 1339 0.01% 89 1558 0.01% 90 1656 0.01% 91 1846 0.01% 92 2207 0.01% 93 2312 0.01% 94 2701 0.01% 95 2998 0.01% 96 3340 0.01% 97 3548 0.02% 98 3744 0.02% 99 4069 0.02% 100 4300 0.02% 101 4757 0.02% 102 5410 0.02% 103 5905 0.03% 104 6260 0.03% 105 6592 0.03% 106 7103 0.03% 107 7414 0.03% 108 7971 0.03% 109 8310 0.04% 110 8704 0.04% 111 9273 0.04% 112 10047 0.04% 113 10921 0.05% 114 11695 0.05% 115 12587 0.05% 116 13032 0.06% 117 13699 0.06% 118 14078 0.06% 119 14359 0.06% 120 15556 0.07% 121 15799 0.07% 122 16867 0.07% 123 18076 0.08% 124 19317 0.08% 125 20533 0.09% 126 21164 0.09% 127 21657 0.09% 128 22248 0.09% 129 22866 0.10% 130 23739 0.10% 131 24344 0.10% 132 25550 0.11% 133 26821 0.11% 134 28114 0.12% 135 29510 0.12% 136 30413 0.13% 137 31241 0.13% 138 32146 0.14% 139 32732 0.14% 140 33573 0.14% 141 34459 0.15% 142 35988 0.15% 143 37151 0.16% 144 38665 0.16% 145 40620 0.17% 146 42066 0.18% 147 42599 0.18% 148 43456 0.18% 149 44220 0.19% 150 44496 0.19% 151 22472585 95.17% 23613964 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=12.72 fanout-score-rank=7 prefix-density=1.24 prefix-fanout=4.6 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=27.10 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=5.6 sequence=GGCCAGCTCCTATAGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTCCTGCTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGGACGGGTTTTTGGAGTTAGCTCACCCTCGCGAGATCGCGACCCTTTGTCCCGCCCATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTGGCCTCATCCTCTCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTTCCAAACTCATAGTGGCAACTAAACACGAGGGTTGCGCTCGTTGCGAGACTTAACCCAACACCTTACGGCACGAGCTGACGACAGCCATGCACCA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.45 fanout-score-rank=38 prefix-density=0.41 prefix-fanout=1.3 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=8 fanout-score=80.37 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=17.8 sequence=CAAGAAGAAGGT SRR8450156 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:22:32 Started mapping on | Dec 06 10:22:32 Finished on | Dec 06 10:28:37 Mapping speed, Million of reads per hour | 232.90 Number of input reads | 23613964 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19661632 Uniquely mapped reads % | 83.26% Average mapped length | 298.73 Number of splices: Total | 19804091 Number of splices: Annotated (sjdb) | 18576101 Number of splices: GT/AG | 19532796 Number of splices: GC/AG | 235866 Number of splices: AT/AC | 7563 Number of splices: Non-canonical | 27866 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.84 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377065 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 56295 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.14% % of reads unmapped: other | 1.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3575267 3575267 3575267 N_multimapping 377065 377065 377065 N_noFeature 720044 19041134 860380 N_ambiguous 577470 3104 97840 UnstrandedReadsAssigned:18364118 PositiveStrandReadsAssigned:617394 NegativeStrandReadsAssigned:18703412 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450156-trimmed-pair1.fastq SRR8450156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,613,964 reads, 19,928,843 reads pseudoaligned [quant] estimated average fragment length: 293.452 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR8450156.ke.tsv 35125 SRR8450156.se.tsv 88098 total ==> SRR8450156.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 644.069 34.4486 3.41141 PNS24247 1044 751.548 36.7147 3.11587 PNS24249 1928 1635.55 145.678 5.68103 PNS24246 1044 751.548 36.7147 3.11587 PNS24248 1044 751.548 36.7147 3.11587 PNS24244 1471 1178.55 116.729 6.31725 PNS24243 293 82.2701 0 0 KQK14069 1603 1310.55 3753.58 182.679 KQK14071 474 211.007 37.6179 11.3708 ==> SRR8450156.se.tsv <== BRADI_1g14170v3 3818 BRADI_1g53295v3 132 BRADI_1g59795v3 260 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 159 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 491 BRADI_1g48960v3 0 SRR8450156 completed mapping pipeline successfully