Starting /dee2/code/volunteer_pipeline.sh SRR8450157 current disk space = 1551855144960 free memory = 1602159488 SRR8450157 SRAfilesize 7287753ee0d4c2ee01ce552578a7a106 SRR8450157.sra SRR8450157.sra file validated SRR8450157 is paired end SRR8450157 is conventional basespace SRR8450157 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450157_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.05725 37.0 37.0 37.0 37.0 37.0 2 36.22325 37.0 37.0 37.0 37.0 37.0 3 36.3695 37.0 37.0 37.0 37.0 37.0 4 36.4055 37.0 37.0 37.0 37.0 37.0 5 36.466 37.0 37.0 37.0 37.0 37.0 6 36.492 37.0 37.0 37.0 37.0 37.0 7 36.409 37.0 37.0 37.0 37.0 37.0 8 36.443 37.0 37.0 37.0 37.0 37.0 9 36.4735 37.0 37.0 37.0 37.0 37.0 10-14 36.496500000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.4365 37.0 37.0 37.0 37.0 37.0 20-24 36.4516 37.0 37.0 37.0 37.0 37.0 25-29 36.3639 37.0 37.0 37.0 37.0 37.0 30-34 36.362 37.0 37.0 37.0 37.0 37.0 35-39 36.350100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.322500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2793 37.0 37.0 37.0 37.0 37.0 50-54 36.259100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2151 37.0 37.0 37.0 37.0 37.0 60-64 36.198699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.176 37.0 37.0 37.0 37.0 37.0 70-74 36.2312 37.0 37.0 37.0 37.0 37.0 75-79 36.26090000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1887 37.0 37.0 37.0 37.0 37.0 85-89 36.1037 37.0 37.0 37.0 37.0 37.0 90-94 36.185300000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.093399999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.0199 37.0 37.0 37.0 37.0 37.0 105-109 36.07000000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.9613 37.0 37.0 37.0 37.0 37.0 115-119 36.013999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.877599999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.903000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.846700000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.8036 37.0 37.0 37.0 37.0 37.0 140-144 35.7897 37.0 37.0 37.0 37.0 37.0 145-149 35.750600000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.175749999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 1.0 24 2.0 25 3.0 26 9.0 27 8.0 28 15.0 29 29.0 30 23.0 31 50.0 32 61.0 33 92.0 34 135.0 35 391.0 36 2733.0 37 446.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.73155376479476 11.583983883152857 8.813900780659784 33.8705615713926 2 26.056514128532132 12.203050762690673 31.282820705176295 30.457614403600903 3 22.6 17.05 23.575 36.775000000000006 4 27.200000000000003 23.3 21.224999999999998 28.275 5 27.975 26.700000000000003 22.925 22.400000000000002 6 25.025 29.45 22.675 22.85 7 20.125 23.375 36.55 19.950000000000003 8 21.775 22.975 27.650000000000002 27.6 9 21.0 22.425 32.225 24.349999999999998 10-14 23.724999999999998 25.525 25.779999999999998 24.97 15-19 23.935000000000002 23.925 25.759999999999998 26.38 20-24 24.395 24.635 25.165 25.805 25-29 24.08 24.455 25.419999999999998 26.045 30-34 24.235 24.215 25.965 25.585 35-39 24.91 24.59 24.709999999999997 25.790000000000003 40-44 23.799999999999997 24.27 25.319999999999997 26.61 45-49 24.495 24.725 24.95 25.83 50-54 23.39 24.349999999999998 25.490000000000002 26.77 55-59 24.565 23.674999999999997 25.11 26.650000000000002 60-64 24.215 24.63 25.27 25.885 65-69 24.75 24.215 24.565 26.47 70-74 24.19 24.315 24.84 26.655 75-79 24.93 24.34 24.395 26.334999999999997 80-84 24.92 24.115000000000002 24.875 26.090000000000003 85-89 25.124999999999996 23.835 24.654999999999998 26.384999999999998 90-94 24.69 23.880000000000003 24.065 27.365000000000002 95-99 25.355 23.485 24.145 27.015 100-104 24.505 23.835 25.11 26.55 105-109 25.245 23.794999999999998 24.465 26.495 110-114 25.11 23.69 24.54 26.66 115-119 25.0 23.5 24.64 26.86 120-124 25.055 23.71 24.81 26.424999999999997 125-129 25.490000000000002 23.565 24.779999999999998 26.165 130-134 25.629999999999995 24.099999999999998 24.2 26.07 135-139 24.565 24.55 24.55 26.334999999999997 140-144 25.25 23.71 24.69 26.35 145-149 25.005 24.104999999999997 24.48 26.41 150-151 25.0 24.0375 24.625 26.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 3.0 29 6.0 30 8.5 31 8.5 32 12.5 33 20.5 34 26.0 35 32.0 36 35.5 37 50.5 38 74.5 39 83.5 40 105.0 41 124.0 42 140.0 43 159.5 44 183.5 45 201.0 46 190.0 47 174.5 48 174.5 49 174.0 50 150.5 51 146.5 52 143.0 53 117.0 54 97.0 55 99.5 56 103.5 57 83.0 58 81.0 59 85.0 60 74.5 61 80.5 62 87.0 63 74.5 64 61.5 65 66.5 66 64.0 67 53.0 68 54.0 69 50.0 70 43.5 71 36.0 72 36.0 73 32.0 74 22.0 75 20.5 76 13.5 77 11.0 78 9.5 79 5.5 80 5.0 81 2.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.72156241752441 89.725 2 4.98812351543943 9.45 3 0.2903140670361573 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0125 52-53 0.0 0.0 0.025 0.0 0.025 54-55 0.0 0.0 0.025 0.0 0.025 56-57 0.0 0.0 0.025 0.0 0.025 58-59 0.0 0.0 0.025 0.0 0.025 60-61 0.0 0.0 0.025 0.0 0.025 62-63 0.0 0.0 0.025 0.0 0.025 64-65 0.0 0.0 0.025 0.0 0.025 66-67 0.0 0.0 0.025 0.0 0.025 68-69 0.0 0.0 0.025 0.0 0.025 70-71 0.0 0.0 0.025 0.0 0.025 72-73 0.0 0.0 0.025 0.0 0.025 74-75 0.0 0.0 0.025 0.0 0.025 76-77 0.0 0.0 0.025 0.0 0.025 78-79 0.0 0.0 0.025 0.0 0.025 80-81 0.0 0.0 0.025 0.0 0.025 82-83 0.0 0.0 0.025 0.0 0.025 84-85 0.0 0.0 0.025 0.0 0.025 86-87 0.0 0.0 0.025 0.0 0.025 88-89 0.025 0.0 0.025 0.0 0.025 90-91 0.037500000000000006 0.0 0.025 0.0 0.025 92-93 0.075 0.0 0.025 0.0 0.025 94-95 0.075 0.0 0.025 0.0 0.025 96-97 0.075 0.0 0.025 0.0 0.025 98-99 0.075 0.0 0.025 0.0 0.025 100-101 0.075 0.0 0.025 0.0 0.025 102-103 0.075 0.0 0.025 0.0 0.025 104-105 0.075 0.0 0.025 0.0 0.025 106-107 0.11249999999999999 0.0 0.025 0.0 0.025 108-109 0.175 0.0 0.025 0.0 0.025 110-111 0.1875 0.0 0.025 0.0 0.025 112-113 0.2 0.0 0.025 0.0 0.025 114-115 0.2625 0.0 0.025 0.0 0.025 116-117 0.3125 0.0 0.025 0.0 0.025 118-119 0.3625 0.0 0.025 0.0 0.025 120-121 0.44999999999999996 0.0 0.025 0.0 0.025 122-123 0.5875 0.0 0.025 0.0 0.025 124-125 0.75 0.0 0.025 0.0 0.025 126-127 0.925 0.0 0.025 0.0 0.025 128-129 1.0625 0.0 0.025 0.0 0.025 130-131 1.175 0.0 0.025 0.0 0.025 132-133 1.3125 0.0 0.025 0.0 0.025 134-135 1.55 0.0 0.025 0.0 0.025 136-137 1.7625 0.0 0.025 0.0 0.025 138-139 1.9874999999999998 0.0 0.025 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTC 10 0.006832588 144.9875 3 TCCGGTG 10 0.006832588 144.9875 145 CAAGTTA 10 0.006832588 144.9875 9 >>END_MODULE SRR8450157 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450157_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8525 37.0 37.0 37.0 37.0 37.0 2 35.4125 37.0 37.0 37.0 37.0 37.0 3 35.355 37.0 37.0 37.0 37.0 37.0 4 35.4415 37.0 37.0 37.0 37.0 37.0 5 35.3585 37.0 37.0 37.0 37.0 37.0 6 35.2805 37.0 37.0 37.0 37.0 37.0 7 35.277 37.0 37.0 37.0 37.0 37.0 8 35.323 37.0 37.0 37.0 37.0 37.0 9 35.285 37.0 37.0 37.0 37.0 37.0 10-14 35.1858 37.0 37.0 37.0 37.0 37.0 15-19 35.0884 37.0 37.0 37.0 32.2 37.0 20-24 35.049800000000005 37.0 37.0 37.0 29.8 37.0 25-29 34.938100000000006 37.0 37.0 37.0 27.4 37.0 30-34 34.895300000000006 37.0 37.0 37.0 25.0 37.0 35-39 34.959900000000005 37.0 37.0 37.0 27.4 37.0 40-44 34.839099999999995 37.0 37.0 37.0 25.0 37.0 45-49 34.8379 37.0 37.0 37.0 25.0 37.0 50-54 34.7349 37.0 37.0 37.0 25.0 37.0 55-59 34.76270000000001 37.0 37.0 37.0 25.0 37.0 60-64 34.6813 37.0 37.0 37.0 25.0 37.0 65-69 34.7716 37.0 37.0 37.0 25.0 37.0 70-74 34.623400000000004 37.0 37.0 37.0 25.0 37.0 75-79 34.602700000000006 37.0 37.0 37.0 25.0 37.0 80-84 34.6756 37.0 37.0 37.0 25.0 37.0 85-89 34.675599999999996 37.0 37.0 37.0 25.0 37.0 90-94 34.525800000000004 37.0 37.0 37.0 25.0 37.0 95-99 34.557500000000005 37.0 37.0 37.0 25.0 37.0 100-104 34.5508 37.0 37.0 37.0 25.0 37.0 105-109 34.554500000000004 37.0 37.0 37.0 25.0 37.0 110-114 34.4851 37.0 37.0 37.0 25.0 37.0 115-119 34.4083 37.0 37.0 37.0 25.0 37.0 120-124 34.4054 37.0 37.0 37.0 25.0 37.0 125-129 34.3314 37.0 37.0 37.0 25.0 37.0 130-134 34.3272 37.0 37.0 37.0 25.0 37.0 135-139 34.1451 37.0 37.0 37.0 25.0 37.0 140-144 33.9977 37.0 37.0 37.0 22.2 37.0 145-149 34.046299999999995 37.0 37.0 37.0 25.0 37.0 150-151 33.259 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 18.0 14 28.0 15 13.0 16 14.0 17 7.0 18 3.0 19 12.0 20 15.0 21 19.0 22 29.0 23 30.0 24 34.0 25 25.0 26 23.0 27 28.0 28 29.0 29 39.0 30 47.0 31 65.0 32 99.0 33 127.0 34 280.0 35 659.0 36 2193.0 37 160.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.9 17.4 10.85 30.85 2 34.275 20.375 23.0 22.35 3 26.0 23.474999999999998 25.3 25.224999999999998 4 29.275000000000002 29.275000000000002 18.525 22.925 5 31.125000000000004 30.8 17.25 20.825 6 27.400000000000002 31.05 18.275 23.275000000000002 7 24.525 19.6 31.65 24.224999999999998 8 28.025 22.125 21.3 28.549999999999997 9 26.3 22.125 24.3 27.275 10-14 28.565 24.435000000000002 20.724999999999998 26.275 15-19 27.465 24.755 22.32 25.46 20-24 27.66 24.895 22.15 25.295 25-29 27.415 24.605 22.39 25.590000000000003 30-34 26.845000000000002 25.165 22.185 25.805 35-39 27.0 25.1 22.384999999999998 25.515 40-44 26.69 25.290000000000003 22.015 26.005 45-49 26.825 25.665 21.665 25.845000000000002 50-54 26.965 24.87 22.24 25.924999999999997 55-59 27.089999999999996 25.385 21.654999999999998 25.869999999999997 60-64 26.525 25.45 22.509999999999998 25.515 65-69 26.63 26.174999999999997 21.975 25.22 70-74 27.235 24.625 22.165000000000003 25.974999999999998 75-79 27.26 25.240000000000002 22.259999999999998 25.240000000000002 80-84 27.175 25.240000000000002 22.13 25.455 85-89 27.705000000000002 24.72 22.105 25.47 90-94 26.61 25.505 22.18 25.705 95-99 27.005000000000003 25.540000000000003 22.29 25.165 100-104 26.855 25.509999999999998 22.57 25.064999999999998 105-109 27.224999999999998 25.755 21.895 25.124999999999996 110-114 26.85 25.72 22.11 25.319999999999997 115-119 26.979999999999997 25.745 22.105 25.169999999999998 120-124 27.084999999999997 25.740000000000002 22.16 25.014999999999997 125-129 27.134999999999998 25.97 22.085 24.81 130-134 27.495000000000005 26.035000000000004 21.755 24.715 135-139 26.795 26.179999999999996 22.27 24.755 140-144 27.595 25.66 21.975 24.77 145-149 27.084999999999997 25.405 22.825 24.685000000000002 150-151 27.55 26.775 22.25 23.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 1.0 8 1.5 9 1.0 10 1.5 11 1.5 12 1.5 13 2.5 14 2.0 15 2.0 16 1.5 17 0.5 18 1.5 19 2.5 20 2.5 21 3.5 22 4.0 23 2.5 24 3.5 25 4.5 26 4.0 27 2.5 28 6.0 29 10.5 30 7.0 31 11.5 32 16.5 33 16.5 34 21.0 35 27.5 36 34.0 37 43.0 38 58.5 39 75.0 40 92.0 41 104.0 42 129.0 43 145.0 44 143.0 45 141.5 46 138.0 47 140.5 48 133.5 49 134.0 50 126.5 51 118.0 52 117.5 53 111.5 54 108.5 55 99.5 56 93.5 57 101.0 58 97.5 59 89.5 60 100.0 61 95.5 62 91.5 63 97.0 64 99.5 65 95.5 66 72.5 67 70.0 68 80.5 69 73.0 70 71.0 71 56.0 72 42.5 73 45.0 74 37.5 75 22.5 76 17.0 77 15.0 78 10.5 79 9.5 80 8.0 81 6.0 82 2.5 83 1.0 84 1.0 85 3.0 86 4.0 87 2.5 88 1.0 89 1.0 90 1.0 91 1.0 92 0.5 93 0.5 94 0.5 95 1.0 96 1.0 97 0.5 98 1.5 99 1.0 100 10.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.11806845317061 89.625 2 4.43088352348103 8.35 3 0.3183868400106129 0.8999999999999999 4 0.07959671000265323 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02653223666755107 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02653223666755107 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 26 0.65 No Hit GCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.11249999999999999 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.5875 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.175 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.55 0.0 0.0 0.0 0.0 136-137 1.7625 0.0 0.0 0.0 0.0 138-139 1.9874999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAGG 10 0.006830828 145.0 9 GAACAAG 10 0.006830828 145.0 8 GGAACAA 10 0.006830828 145.0 7 GTGGAAC 10 0.006830828 145.0 5 TCGAGCT 10 0.006830828 145.0 7 >>END_MODULE Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660432 spots for SRR8450157.sra Written 1660432 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra Read 1660420 spots for SRR8450157.sra Written 1660420 spots for SRR8450157.sra SRR ids: ['SRR8450157.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x01v1tzc SRR8450157.sra spots: 33208412 blocks: [[1, 1660420], [1660421, 3320840], [3320841, 4981260], [4981261, 6641680], [6641681, 8302100], [8302101, 9962520], [9962521, 11622940], [11622941, 13283360], [13283361, 14943780], [14943781, 16604200], [16604201, 18264620], [18264621, 19925040], [19925041, 21585460], [21585461, 23245880], [23245881, 24906300], [24906301, 26566720], [26566721, 28227140], [28227141, 29887560], [29887561, 31547980], [31547981, 33208412]] SRR8450157 file size 11231540 SRR8450157 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450157 SRR8450157_1.fastq SRR8450157_2.fastq Input file: SRR8450157_1.fastq Paired file: SRR8450157_2.fastq trimmed: SRR8450157-trimmed-pair1.fastq, SRR8450157-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:22:01 2024 >> started Fri Dec 6 10:22:43 2024 >> done (42.114s) 33208412 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 18028 ( 0.05%) empty read pairs filtered out after trimming by size control 33190348 (99.95%) read pairs available; of these: 1103878 ( 3.33%) trimmed read pairs available after processing 32086470 (96.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 2 0.00% 21 9 0.00% 22 3 0.00% 23 9 0.00% 24 14 0.00% 25 14 0.00% 26 19 0.00% 27 17 0.00% 28 21 0.00% 29 23 0.00% 30 20 0.00% 31 25 0.00% 32 26 0.00% 33 28 0.00% 34 24 0.00% 35 22 0.00% 36 20 0.00% 37 24 0.00% 38 32 0.00% 39 26 0.00% 40 33 0.00% 41 32 0.00% 42 35 0.00% 43 51 0.00% 44 33 0.00% 45 30 0.00% 46 36 0.00% 47 40 0.00% 48 30 0.00% 49 47 0.00% 50 43 0.00% 51 51 0.00% 52 64 0.00% 53 62 0.00% 54 39 0.00% 55 65 0.00% 56 52 0.00% 57 70 0.00% 58 59 0.00% 59 66 0.00% 60 72 0.00% 61 85 0.00% 62 84 0.00% 63 106 0.00% 64 107 0.00% 65 141 0.00% 66 123 0.00% 67 121 0.00% 68 141 0.00% 69 133 0.00% 70 187 0.00% 71 198 0.00% 72 231 0.00% 73 241 0.00% 74 283 0.00% 75 284 0.00% 76 292 0.00% 77 360 0.00% 78 416 0.00% 79 465 0.00% 80 510 0.00% 81 586 0.00% 82 688 0.00% 83 784 0.00% 84 859 0.00% 85 952 0.00% 86 1088 0.00% 87 1147 0.00% 88 1271 0.00% 89 1424 0.00% 90 1591 0.00% 91 1787 0.01% 92 1946 0.01% 93 2178 0.01% 94 2474 0.01% 95 2659 0.01% 96 3031 0.01% 97 3163 0.01% 98 3491 0.01% 99 3757 0.01% 100 4060 0.01% 101 4271 0.01% 102 4769 0.01% 103 5345 0.02% 104 5741 0.02% 105 6153 0.02% 106 6453 0.02% 107 6988 0.02% 108 7161 0.02% 109 7853 0.02% 110 8354 0.03% 111 8821 0.03% 112 9409 0.03% 113 9996 0.03% 114 10842 0.03% 115 11519 0.03% 116 12115 0.04% 117 12650 0.04% 118 12988 0.04% 119 13553 0.04% 120 14625 0.04% 121 15081 0.05% 122 15849 0.05% 123 16700 0.05% 124 18072 0.05% 125 18918 0.06% 126 19644 0.06% 127 20340 0.06% 128 21087 0.06% 129 21957 0.07% 130 22408 0.07% 131 23678 0.07% 132 24723 0.07% 133 26157 0.08% 134 26909 0.08% 135 28486 0.09% 136 29345 0.09% 137 29702 0.09% 138 30859 0.09% 139 32057 0.10% 140 32937 0.10% 141 34148 0.10% 142 35885 0.11% 143 37127 0.11% 144 38280 0.12% 145 39902 0.12% 146 41282 0.12% 147 42891 0.13% 148 43517 0.13% 149 45327 0.14% 150 46163 0.14% 151 32086470 96.67% 33190348 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=21 prefix-density=0.74 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=28.99 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=22 prefix-density=0.54 prefix-fanout=2.8 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=18 fanout-score=78.14 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=12.1 sequence=CCGCCGCCGCCG SRR8450157 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:24:09 Started mapping on | Dec 06 10:24:09 Finished on | Dec 06 10:28:37 Mapping speed, Million of reads per hour | 445.84 Number of input reads | 33190348 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30350396 Uniquely mapped reads % | 91.44% Average mapped length | 299.43 Number of splices: Total | 33650986 Number of splices: Annotated (sjdb) | 31599930 Number of splices: GT/AG | 33198238 Number of splices: GC/AG | 389955 Number of splices: AT/AC | 13575 Number of splices: Non-canonical | 49218 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.94 Insertion rate per base | 0.01% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 389299 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 36348 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.49% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2450653 2450653 2450653 N_multimapping 389299 389299 389299 N_noFeature 931427 29496674 1163265 N_ambiguous 759971 5152 140824 UnstrandedReadsAssigned:28658998 PositiveStrandReadsAssigned:848570 NegativeStrandReadsAssigned:29046307 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450157 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450157-trimmed-pair1.fastq SRR8450157-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,190,348 reads, 30,300,466 reads pseudoaligned [quant] estimated average fragment length: 314.368 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR8450157.ke.tsv 35125 SRR8450157.se.tsv 88098 total ==> SRR8450157.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 623.636 0 0 PNS24247 1044 730.632 65.4912 3.98187 PNS24249 1928 1614.63 149.901 4.12414 PNS24246 1044 730.632 65.4912 3.98187 PNS24248 1044 730.632 65.4912 3.98187 PNS24244 1471 1157.63 51.6254 1.98105 PNS24243 293 76.2109 0 0 KQK14069 1603 1289.63 8443.82 290.854 KQK14071 474 199.671 92.9264 20.6741 ==> SRR8450157.se.tsv <== BRADI_1g14170v3 8485 BRADI_1g53295v3 351 BRADI_1g59795v3 309 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 510 BRADI_1g74790v3 189 BRADI_1g09890v3 0 BRADI_1g77505v3 537 BRADI_1g48960v3 0 SRR8450157 completed mapping pipeline successfully