Starting /dee2/code/volunteer_pipeline.sh SRR8450158 current disk space = 1551852486656 free memory = 1602317204 SRR8450158 SRAfilesize b171bfcb00309a12a0d4f79526359d9b SRR8450158.sra SRR8450158.sra file validated SRR8450158 is paired end SRR8450158 is conventional basespace SRR8450158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18575 37.0 37.0 37.0 37.0 37.0 2 36.36 37.0 37.0 37.0 37.0 37.0 3 36.474 37.0 37.0 37.0 37.0 37.0 4 36.409 37.0 37.0 37.0 37.0 37.0 5 36.431 37.0 37.0 37.0 37.0 37.0 6 36.4235 37.0 37.0 37.0 37.0 37.0 7 36.37 37.0 37.0 37.0 37.0 37.0 8 36.4565 37.0 37.0 37.0 37.0 37.0 9 36.422 37.0 37.0 37.0 37.0 37.0 10-14 36.4658 37.0 37.0 37.0 37.0 37.0 15-19 36.43650000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4491 37.0 37.0 37.0 37.0 37.0 25-29 36.285700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3857 37.0 37.0 37.0 37.0 37.0 35-39 36.35690000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3677 37.0 37.0 37.0 37.0 37.0 45-49 36.310700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.241499999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.2478 37.0 37.0 37.0 37.0 37.0 60-64 36.227999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.1452 37.0 37.0 37.0 37.0 37.0 70-74 36.2342 37.0 37.0 37.0 37.0 37.0 75-79 36.206599999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2222 37.0 37.0 37.0 37.0 37.0 85-89 36.12409999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.1654 37.0 37.0 37.0 37.0 37.0 95-99 36.0754 37.0 37.0 37.0 37.0 37.0 100-104 36.067699999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.0792 37.0 37.0 37.0 37.0 37.0 110-114 36.0354 37.0 37.0 37.0 37.0 37.0 115-119 36.0372 37.0 37.0 37.0 37.0 37.0 120-124 35.9114 37.0 37.0 37.0 37.0 37.0 125-129 35.9034 37.0 37.0 37.0 37.0 37.0 130-134 35.905699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8369 37.0 37.0 37.0 37.0 37.0 140-144 35.83669999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7863 37.0 37.0 37.0 37.0 37.0 150-151 35.245999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 6.0 26 3.0 27 10.0 28 12.0 29 30.0 30 31.0 31 47.0 32 72.0 33 89.0 34 130.0 35 366.0 36 2720.0 37 482.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.53654860587792 11.152976639035419 9.394624466214518 34.91585028887214 2 26.325 12.9 28.449999999999996 32.324999999999996 3 22.7 16.475 21.0 39.825 4 27.025 20.849999999999998 21.475 30.65 5 27.325 26.950000000000003 22.625 23.1 6 23.5 29.549999999999997 22.875 24.075 7 20.200000000000003 24.8 36.425000000000004 18.575 8 23.05 23.549999999999997 27.775 25.624999999999996 9 20.5 22.425 31.574999999999996 25.5 10-14 23.96 24.62 25.39 26.029999999999998 15-19 23.674999999999997 24.38 25.35 26.595000000000002 20-24 24.104999999999997 24.425 25.324999999999996 26.145000000000003 25-29 24.044999999999998 24.68 25.145 26.13 30-34 24.08 24.51 24.79 26.619999999999997 35-39 24.5 24.005000000000003 25.3 26.195 40-44 24.175 24.115000000000002 25.105 26.605 45-49 24.490000000000002 24.555 24.855 26.1 50-54 24.51 24.455 24.415 26.619999999999997 55-59 24.86 23.275000000000002 24.990000000000002 26.875 60-64 24.955 24.02 24.445 26.58 65-69 24.9 23.3 24.605 27.195000000000004 70-74 25.14 23.835 24.48 26.545 75-79 24.355 23.630000000000003 24.385 27.63 80-84 24.85 24.27 24.044999999999998 26.834999999999997 85-89 25.28 23.56 24.474999999999998 26.685 90-94 24.81 24.08 24.52 26.590000000000003 95-99 25.145 23.77 24.349999999999998 26.735 100-104 24.75 23.825 24.884999999999998 26.540000000000003 105-109 25.085 23.655 24.07 27.189999999999998 110-114 25.655 23.79 23.985 26.57 115-119 25.025 23.885 24.395 26.695 120-124 24.725 23.055 25.055 27.165 125-129 25.27 23.56 24.135 27.034999999999997 130-134 25.419999999999998 24.185000000000002 23.625 26.77 135-139 25.575 23.685000000000002 24.305 26.435 140-144 25.89 23.375 24.425 26.31 145-149 25.685000000000002 23.95 23.5 26.865 150-151 25.55 23.3375 23.2375 27.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.5 28 2.0 29 2.0 30 3.0 31 7.5 32 13.5 33 16.5 34 22.0 35 30.0 36 39.5 37 53.0 38 65.5 39 79.5 40 97.5 41 119.0 42 149.5 43 155.0 44 151.5 45 169.0 46 172.0 47 173.0 48 166.5 49 154.0 50 150.0 51 149.5 52 141.0 53 134.0 54 134.0 55 117.5 56 106.0 57 108.0 58 95.0 59 79.5 60 78.5 61 76.5 62 80.0 63 80.0 64 76.5 65 71.0 66 67.0 67 63.5 68 54.0 69 44.5 70 41.0 71 41.0 72 38.5 73 35.5 74 23.0 75 18.5 76 20.0 77 13.5 78 7.5 79 2.5 80 1.5 81 2.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 95.62254259501965 91.2 2 3.958060288335518 7.55 3 0.3669724770642202 1.05 4 0.05242463958060288 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.5499999999999998 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138-139 2.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAGT 10 0.006830828 145.0 145 >>END_MODULE SRR8450158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1285 37.0 37.0 37.0 37.0 37.0 2 35.71 37.0 37.0 37.0 37.0 37.0 3 35.7755 37.0 37.0 37.0 37.0 37.0 4 35.715 37.0 37.0 37.0 37.0 37.0 5 35.8475 37.0 37.0 37.0 37.0 37.0 6 35.798 37.0 37.0 37.0 37.0 37.0 7 35.582 37.0 37.0 37.0 37.0 37.0 8 35.755 37.0 37.0 37.0 37.0 37.0 9 35.771 37.0 37.0 37.0 37.0 37.0 10-14 35.686600000000006 37.0 37.0 37.0 37.0 37.0 15-19 35.635400000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.5852 37.0 37.0 37.0 37.0 37.0 25-29 35.4989 37.0 37.0 37.0 37.0 37.0 30-34 35.44199999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.514300000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.4036 37.0 37.0 37.0 37.0 37.0 45-49 35.428200000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.2938 37.0 37.0 37.0 37.0 37.0 55-59 35.328199999999995 37.0 37.0 37.0 34.6 37.0 60-64 35.3066 37.0 37.0 37.0 37.0 37.0 65-69 35.2658 37.0 37.0 37.0 34.6 37.0 70-74 35.2314 37.0 37.0 37.0 34.6 37.0 75-79 35.18429999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.2167 37.0 37.0 37.0 37.0 37.0 85-89 35.157799999999995 37.0 37.0 37.0 32.2 37.0 90-94 35.150800000000004 37.0 37.0 37.0 29.8 37.0 95-99 35.152300000000004 37.0 37.0 37.0 34.6 37.0 100-104 35.1977 37.0 37.0 37.0 34.6 37.0 105-109 35.1934 37.0 37.0 37.0 34.6 37.0 110-114 35.153999999999996 37.0 37.0 37.0 34.6 37.0 115-119 35.05 37.0 37.0 37.0 25.0 37.0 120-124 35.00430000000001 37.0 37.0 37.0 27.4 37.0 125-129 34.9655 37.0 37.0 37.0 25.0 37.0 130-134 34.9756 37.0 37.0 37.0 25.0 37.0 135-139 34.81909999999999 37.0 37.0 37.0 25.0 37.0 140-144 34.594500000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.6679 37.0 37.0 37.0 25.0 37.0 150-151 33.82925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 12.0 14 9.0 15 15.0 16 13.0 17 6.0 18 8.0 19 9.0 20 12.0 21 16.0 22 12.0 23 21.0 24 28.0 25 21.0 26 14.0 27 10.0 28 20.0 29 36.0 30 31.0 31 53.0 32 66.0 33 113.0 34 211.0 35 482.0 36 2551.0 37 231.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 16.950000000000003 12.65 31.175000000000004 2 33.6 22.325 22.075 22.0 3 27.525 23.75 24.775 23.95 4 29.45 27.425 19.8 23.325000000000003 5 30.9 31.05 18.2 19.85 6 26.35 32.550000000000004 18.775 22.325 7 26.224999999999998 19.400000000000002 30.3 24.075 8 27.325 21.85 21.325 29.5 9 25.75 23.575 25.900000000000002 24.775 10-14 27.965 24.875 21.425 25.735000000000003 15-19 27.650000000000002 24.58 22.465 25.305 20-24 27.185 25.115 21.765 25.935000000000002 25-29 27.015 25.135 22.17 25.679999999999996 30-34 26.32 25.130000000000003 22.485 26.064999999999998 35-39 26.87 25.305 22.48 25.345000000000002 40-44 27.29 25.085 22.24 25.385 45-49 26.555 25.074999999999996 22.515 25.855 50-54 27.165 24.75 22.43 25.655 55-59 27.439999999999998 25.180000000000003 22.015 25.365 60-64 26.575 25.05 22.355 26.02 65-69 27.045 25.15 22.57 25.235000000000003 70-74 27.05 24.685000000000002 22.36 25.905 75-79 26.465 24.8 22.915 25.82 80-84 26.939999999999998 24.905 22.73 25.424999999999997 85-89 27.150000000000002 24.759999999999998 22.415 25.674999999999997 90-94 26.99 25.09 22.650000000000002 25.27 95-99 27.02 25.455 22.145 25.380000000000003 100-104 27.52 25.069999999999997 22.134999999999998 25.275 105-109 27.155 25.180000000000003 22.535 25.130000000000003 110-114 27.045 25.295 22.66 25.0 115-119 27.395000000000003 25.765 21.815 25.025 120-124 26.779999999999998 25.224999999999998 22.465 25.53 125-129 27.37 26.200000000000003 21.26 25.169999999999998 130-134 27.575 25.965 21.7 24.759999999999998 135-139 27.68 26.16 21.94 24.22 140-144 27.455000000000002 25.779999999999998 22.32 24.445 145-149 27.834999999999997 25.679999999999996 22.235 24.25 150-151 27.925 26.35 21.462500000000002 24.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 1.5 8 1.5 9 1.0 10 2.5 11 2.5 12 1.5 13 0.5 14 0.5 15 1.5 16 1.5 17 0.5 18 1.0 19 2.0 20 2.0 21 3.0 22 2.5 23 3.0 24 3.0 25 1.5 26 2.5 27 3.0 28 4.0 29 4.0 30 4.0 31 6.5 32 11.0 33 13.0 34 18.5 35 27.0 36 31.5 37 42.0 38 55.5 39 76.5 40 92.5 41 104.0 42 122.0 43 138.0 44 136.5 45 139.0 46 155.0 47 152.5 48 151.0 49 149.5 50 138.0 51 133.0 52 124.0 53 120.5 54 116.5 55 105.0 56 110.5 57 113.0 58 101.0 59 98.0 60 94.0 61 86.5 62 93.5 63 93.5 64 87.0 65 88.5 66 83.0 67 73.5 68 66.0 69 60.5 70 55.0 71 50.0 72 47.5 73 39.0 74 29.0 75 22.0 76 16.0 77 11.0 78 12.5 79 12.0 80 5.0 81 3.0 82 3.0 83 2.0 84 2.0 85 0.5 86 0.5 87 0.5 88 1.5 89 1.5 90 0.5 91 2.0 92 3.0 93 2.5 94 1.0 95 0.0 96 1.0 97 1.5 98 0.5 99 0.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 95.23052464228935 89.85 2 4.1070482246952835 7.75 3 0.5829358770535241 1.6500000000000001 4 0.052994170641229466 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026497085320614733 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.5499999999999998 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.8875000000000002 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.35 0.0 0.0 0.0 0.0 138-139 2.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCAT 10 0.006830828 145.0 9 >>END_MODULE Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443468 spots for SRR8450158.sra Written 1443468 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra Read 1443467 spots for SRR8450158.sra Written 1443467 spots for SRR8450158.sra SRR ids: ['SRR8450158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xeqwn0c1 SRR8450158.sra spots: 28869341 blocks: [[1, 1443467], [1443468, 2886934], [2886935, 4330401], [4330402, 5773868], [5773869, 7217335], [7217336, 8660802], [8660803, 10104269], [10104270, 11547736], [11547737, 12991203], [12991204, 14434670], [14434671, 15878137], [15878138, 17321604], [17321605, 18765071], [18765072, 20208538], [20208539, 21652005], [21652006, 23095472], [23095473, 24538939], [24538940, 25982406], [25982407, 27425873], [27425874, 28869341]] SRR8450158 file size 9761172 SRR8450158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450158 SRR8450158_1.fastq SRR8450158_2.fastq Input file: SRR8450158_1.fastq Paired file: SRR8450158_2.fastq trimmed: SRR8450158-trimmed-pair1.fastq, SRR8450158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:23:51 2024 >> started Fri Dec 6 10:24:26 2024 >> done (34.543s) 28869341 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 18124 ( 0.06%) empty read pairs filtered out after trimming by size control 28851186 (99.94%) read pairs available; of these: 1337493 ( 4.64%) trimmed read pairs available after processing 27513693 (95.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 3 0.00% 24 8 0.00% 25 8 0.00% 26 11 0.00% 27 12 0.00% 28 14 0.00% 29 10 0.00% 30 16 0.00% 31 6 0.00% 32 17 0.00% 33 14 0.00% 34 19 0.00% 35 12 0.00% 36 17 0.00% 37 11 0.00% 38 25 0.00% 39 19 0.00% 40 23 0.00% 41 23 0.00% 42 20 0.00% 43 33 0.00% 44 22 0.00% 45 22 0.00% 46 39 0.00% 47 31 0.00% 48 35 0.00% 49 41 0.00% 50 30 0.00% 51 33 0.00% 52 31 0.00% 53 39 0.00% 54 39 0.00% 55 47 0.00% 56 43 0.00% 57 44 0.00% 58 46 0.00% 59 60 0.00% 60 56 0.00% 61 64 0.00% 62 63 0.00% 63 89 0.00% 64 79 0.00% 65 96 0.00% 66 90 0.00% 67 144 0.00% 68 137 0.00% 69 130 0.00% 70 147 0.00% 71 171 0.00% 72 188 0.00% 73 238 0.00% 74 233 0.00% 75 263 0.00% 76 303 0.00% 77 340 0.00% 78 446 0.00% 79 480 0.00% 80 515 0.00% 81 590 0.00% 82 677 0.00% 83 827 0.00% 84 952 0.00% 85 1074 0.00% 86 1191 0.00% 87 1279 0.00% 88 1412 0.00% 89 1587 0.01% 90 1791 0.01% 91 2111 0.01% 92 2314 0.01% 93 2421 0.01% 94 2790 0.01% 95 3129 0.01% 96 3449 0.01% 97 3703 0.01% 98 3977 0.01% 99 4310 0.01% 100 4893 0.02% 101 5178 0.02% 102 5702 0.02% 103 6202 0.02% 104 6642 0.02% 105 7352 0.03% 106 8015 0.03% 107 8318 0.03% 108 8947 0.03% 109 9417 0.03% 110 10261 0.04% 111 10753 0.04% 112 11432 0.04% 113 12217 0.04% 114 13252 0.05% 115 14035 0.05% 116 14821 0.05% 117 15572 0.05% 118 16214 0.06% 119 16884 0.06% 120 17818 0.06% 121 18416 0.06% 122 19694 0.07% 123 20542 0.07% 124 22138 0.08% 125 22994 0.08% 126 24245 0.08% 127 24874 0.09% 128 25986 0.09% 129 27127 0.09% 130 28103 0.10% 131 29298 0.10% 132 30170 0.10% 133 31517 0.11% 134 32979 0.11% 135 34438 0.12% 136 35770 0.12% 137 36617 0.13% 138 37397 0.13% 139 39709 0.14% 140 40411 0.14% 141 41459 0.14% 142 43833 0.15% 143 44643 0.15% 144 46430 0.16% 145 47520 0.16% 146 49324 0.17% 147 50919 0.18% 148 52910 0.18% 149 53915 0.19% 150 55385 0.19% 151 27513693 95.36% 28851186 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=3.0 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=27.01 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.7 sequence=GCACATCATGGAATGGATTATTGACCAGTAATCACAGAGCTGCAAAAGCTATACTCGTGCGTGAAACCAAACAAGGGCCACGGACACCTTACATAGGACAGATTTACGTTAAACACGCATGCGTAAAGTAGCTTGCCCTATACACAAAGTAAGGACGAGGCCTGCATTAATCAGAAGCTAATTTAGCTGCTTAATTAAGCCACTACTTCTGGAAGTAGTCCTCGGTCCTGCCCTTGAACCCGATCTGGCCAAAGGTGAGCGCGATGAACAGACCCAAGTGCCACGTCACCAACCACAGCCAGAACTGGGAGGTGAGCGCCGGGGGCGAGGGGAAGTGGGCGAGCTCCTCGCCGATGCTGGAGAAGAAGAGCCCCGTGAGGCTGTTGCCGTTGATGAGCGGGATGCTCGACGGCGCCAGCCACCCGATGAGCCCGAACCCGATCACGTTCAGGTCCCTCCGCAGCCAGTCCCGCGGGAACGTCATGCAGGTGATCCTGCCGTTCCTCTCCAG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.86 fanout-score-rank=41 prefix-density=0.37 prefix-fanout=1.5 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=14 fanout-score=67.99 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=10.0 sequence=CCGCCGCCGCCG SRR8450158 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:25:45 Started mapping on | Dec 06 10:25:45 Finished on | Dec 06 10:30:26 Mapping speed, Million of reads per hour | 369.62 Number of input reads | 28851186 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25861695 Uniquely mapped reads % | 89.64% Average mapped length | 299.12 Number of splices: Total | 26922807 Number of splices: Annotated (sjdb) | 25256951 Number of splices: GT/AG | 26559940 Number of splices: GC/AG | 314767 Number of splices: AT/AC | 9246 Number of splices: Non-canonical | 38854 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.84 Insertion rate per base | 0.01% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 472315 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 65865 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.84% % of reads unmapped: other | 1.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2517176 2517176 2517176 N_multimapping 472315 472315 472315 N_noFeature 881711 25046236 1106803 N_ambiguous 712509 3852 123436 UnstrandedReadsAssigned:24267475 PositiveStrandReadsAssigned:811607 NegativeStrandReadsAssigned:24631456 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450158-trimmed-pair1.fastq SRR8450158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,851,186 reads, 25,513,008 reads pseudoaligned [quant] estimated average fragment length: 291.796 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR8450158.ke.tsv 35125 SRR8450158.se.tsv 88098 total ==> SRR8450158.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 645.795 2.13677e-08 1.73946e-09 PNS24247 1044 753.204 98.0447 6.84327 PNS24249 1928 1637.2 219.19 7.03834 PNS24246 1044 753.204 98.0447 6.84327 PNS24248 1044 753.204 98.0447 6.84327 PNS24244 1471 1180.2 98.6759 4.39548 PNS24243 293 80.3235 0 0 KQK14069 1603 1312.2 25243.1 1011.33 KQK14071 474 211.286 267.748 66.6204 ==> SRR8450158.se.tsv <== BRADI_1g14170v3 25709 BRADI_1g53295v3 156 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 155 BRADI_1g74790v3 200 BRADI_1g09890v3 0 BRADI_1g77505v3 381 BRADI_1g48960v3 0 SRR8450158 completed mapping pipeline successfully