Starting /dee2/code/volunteer_pipeline.sh SRR8450159 current disk space = 1551756578816 free memory = 1393719772 SRR8450159 SRAfilesize 1808ced655f2d57699e3e6dd47a2dc5a SRR8450159.sra SRR8450159.sra file validated SRR8450159 is paired end SRR8450159 is conventional basespace SRR8450159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.14625 37.0 37.0 37.0 37.0 37.0 2 36.389 37.0 37.0 37.0 37.0 37.0 3 36.4375 37.0 37.0 37.0 37.0 37.0 4 36.4745 37.0 37.0 37.0 37.0 37.0 5 36.4705 37.0 37.0 37.0 37.0 37.0 6 36.524 37.0 37.0 37.0 37.0 37.0 7 36.4105 37.0 37.0 37.0 37.0 37.0 8 36.472 37.0 37.0 37.0 37.0 37.0 9 36.4755 37.0 37.0 37.0 37.0 37.0 10-14 36.51950000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4457 37.0 37.0 37.0 37.0 37.0 20-24 36.474000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3985 37.0 37.0 37.0 37.0 37.0 30-34 36.4156 37.0 37.0 37.0 37.0 37.0 35-39 36.3409 37.0 37.0 37.0 37.0 37.0 40-44 36.3998 37.0 37.0 37.0 37.0 37.0 45-49 36.350699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.301 37.0 37.0 37.0 37.0 37.0 55-59 36.2998 37.0 37.0 37.0 37.0 37.0 60-64 36.2393 37.0 37.0 37.0 37.0 37.0 65-69 36.1417 37.0 37.0 37.0 37.0 37.0 70-74 36.263 37.0 37.0 37.0 37.0 37.0 75-79 36.225300000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2359 37.0 37.0 37.0 37.0 37.0 85-89 36.1305 37.0 37.0 37.0 37.0 37.0 90-94 36.18070000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1056 37.0 37.0 37.0 37.0 37.0 100-104 36.0364 37.0 37.0 37.0 37.0 37.0 105-109 36.1111 37.0 37.0 37.0 37.0 37.0 110-114 36.0051 37.0 37.0 37.0 37.0 37.0 115-119 35.9412 37.0 37.0 37.0 37.0 37.0 120-124 35.940000000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.915699999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.892199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.835300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8135 37.0 37.0 37.0 37.0 37.0 145-149 35.7744 37.0 37.0 37.0 37.0 37.0 150-151 35.25775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 4.0 25 7.0 26 5.0 27 14.0 28 14.0 29 21.0 30 35.0 31 31.0 32 52.0 33 84.0 34 165.0 35 323.0 36 2781.0 37 461.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 51.01733232856066 10.600351670434565 7.133885958301935 31.24843004270284 2 26.563281640820406 11.880940470235117 29.089544772386194 32.46623311655828 3 23.45 18.375 21.8 36.375 4 28.449999999999996 23.225 19.75 28.575 5 27.875 27.500000000000004 22.95 21.675 6 24.15 29.075 23.724999999999998 23.05 7 19.35 22.925 37.225 20.5 8 21.25 23.075000000000003 28.15 27.525 9 21.4 21.9 31.624999999999996 25.074999999999996 10-14 24.54 24.82 24.725 25.915 15-19 24.805 24.175 25.285000000000004 25.735000000000003 20-24 24.605 24.265 24.985 26.145000000000003 25-29 24.545 24.15 24.4 26.905 30-34 24.765 24.055 24.66 26.52 35-39 24.104999999999997 24.349999999999998 24.86 26.685 40-44 25.21 24.135 24.43 26.224999999999998 45-49 24.12 23.905 24.985 26.99 50-54 24.665 24.060000000000002 25.314999999999998 25.96 55-59 24.845 24.154999999999998 24.535 26.465 60-64 24.425 23.9 24.145 27.529999999999998 65-69 25.03 24.145 24.27 26.555 70-74 24.98 24.605 24.075 26.340000000000003 75-79 24.945 23.51 24.575 26.97 80-84 25.174999999999997 23.94 24.51 26.375 85-89 24.85 23.915 24.34 26.895000000000003 90-94 25.035 23.79 24.58 26.595000000000002 95-99 25.36 23.575 24.709999999999997 26.355 100-104 25.724999999999998 23.595 23.87 26.810000000000002 105-109 25.275 24.38 24.060000000000002 26.284999999999997 110-114 25.495 23.95 24.59 25.965 115-119 25.31 24.235 24.29 26.165 120-124 24.7 23.765 24.39 27.145000000000003 125-129 25.35 23.355 24.785 26.51 130-134 25.755 23.735 24.19 26.32 135-139 25.47 24.169999999999998 23.95 26.41 140-144 26.375 23.71 23.630000000000003 26.284999999999997 145-149 25.979999999999997 24.075 23.385 26.56 150-151 25.6125 23.3125 23.075000000000003 28.000000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.0 29 5.0 30 7.0 31 9.0 32 13.0 33 12.5 34 19.0 35 31.5 36 44.0 37 44.5 38 50.5 39 79.0 40 99.0 41 131.0 42 154.0 43 149.0 44 165.0 45 175.0 46 179.0 47 191.0 48 170.0 49 156.0 50 150.0 51 129.5 52 130.0 53 127.5 54 113.0 55 105.0 56 94.5 57 77.0 58 82.0 59 98.5 60 96.5 61 89.0 62 79.5 63 66.5 64 68.0 65 77.0 66 73.5 67 59.5 68 50.0 69 53.0 70 59.5 71 51.0 72 38.0 73 33.5 74 29.5 75 23.5 76 15.0 77 14.0 78 11.0 79 4.5 80 3.0 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.77296726504751 89.75 2 4.910242872228088 9.3 3 0.29039070749736007 0.8250000000000001 4 0.0 0.0 5 0.026399155227032733 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATTTTTGTAACATTCTCGAATGCAGCACGATTCTCTTCATTCCTTGGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.2625 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.5499999999999998 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.2125 0.0 0.0 0.0 0.0 138-139 2.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTG 10 0.006830828 145.0 2 TTTTTTT 35 0.0033124194 62.14286 1 >>END_MODULE SRR8450159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.828 37.0 37.0 37.0 37.0 37.0 2 35.2 37.0 37.0 37.0 37.0 37.0 3 35.0625 37.0 37.0 37.0 25.0 37.0 4 35.2265 37.0 37.0 37.0 37.0 37.0 5 35.058 37.0 37.0 37.0 25.0 37.0 6 34.858 37.0 37.0 37.0 25.0 37.0 7 34.7165 37.0 37.0 37.0 25.0 37.0 8 34.9785 37.0 37.0 37.0 25.0 37.0 9 34.9155 37.0 37.0 37.0 25.0 37.0 10-14 34.670899999999996 37.0 37.0 37.0 25.0 37.0 15-19 34.5168 37.0 37.0 37.0 25.0 37.0 20-24 34.4144 37.0 37.0 37.0 25.0 37.0 25-29 34.265 37.0 37.0 37.0 25.0 37.0 30-34 34.209500000000006 37.0 37.0 37.0 25.0 37.0 35-39 34.17659999999999 37.0 37.0 37.0 25.0 37.0 40-44 34.141200000000005 37.0 37.0 37.0 25.0 37.0 45-49 34.0874 37.0 37.0 37.0 25.0 37.0 50-54 34.038399999999996 37.0 37.0 37.0 25.0 37.0 55-59 34.0891 37.0 37.0 37.0 25.0 37.0 60-64 34.0299 37.0 37.0 37.0 25.0 37.0 65-69 33.9913 37.0 37.0 37.0 25.0 37.0 70-74 34.0164 37.0 37.0 37.0 25.0 37.0 75-79 33.9368 37.0 37.0 37.0 25.0 37.0 80-84 33.9484 37.0 37.0 37.0 25.0 37.0 85-89 33.9121 37.0 37.0 37.0 25.0 37.0 90-94 33.8254 37.0 37.0 37.0 25.0 37.0 95-99 33.8568 37.0 37.0 37.0 22.2 37.0 100-104 33.7974 37.0 37.0 37.0 25.0 37.0 105-109 33.7852 37.0 37.0 37.0 22.2 37.0 110-114 33.711600000000004 37.0 37.0 37.0 19.4 37.0 115-119 33.7184 37.0 37.0 37.0 22.2 37.0 120-124 33.7128 37.0 37.0 37.0 25.0 37.0 125-129 33.5847 37.0 37.0 37.0 19.4 37.0 130-134 33.5086 37.0 37.0 37.0 13.8 37.0 135-139 33.4063 37.0 37.0 37.0 11.0 37.0 140-144 33.322900000000004 37.0 37.0 37.0 11.0 37.0 145-149 33.1892 37.0 37.0 37.0 11.0 37.0 150-151 32.5955 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 8.0 13 26.0 14 47.0 15 43.0 16 25.0 17 21.0 18 20.0 19 24.0 20 30.0 21 38.0 22 61.0 23 43.0 24 34.0 25 28.0 26 21.0 27 19.0 28 25.0 29 28.0 30 32.0 31 55.0 32 75.0 33 130.0 34 208.0 35 517.0 36 2254.0 37 188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.225 17.9 8.75 28.125 2 35.0 22.675 20.0 22.325 3 29.525000000000002 24.175 24.175 22.125 4 34.75 26.575 16.5 22.175 5 32.925 29.475 16.05 21.55 6 28.4 30.975 18.7 21.925 7 29.2 19.6 28.4 22.8 8 28.999999999999996 21.725 20.9 28.375 9 28.65 21.9 23.400000000000002 26.05 10-14 30.009999999999998 24.62 20.62 24.75 15-19 29.285 24.995 21.325 24.395 20-24 28.139999999999997 25.245 21.495 25.119999999999997 25-29 27.810000000000002 26.075 20.565 25.55 30-34 27.77 25.805 20.86 25.564999999999998 35-39 27.08 26.6 21.05 25.27 40-44 26.955000000000002 26.83 21.01 25.205 45-49 27.57 26.314999999999998 20.985 25.130000000000003 50-54 27.08 26.064999999999998 21.5 25.355 55-59 27.66 25.974999999999998 21.01 25.355 60-64 27.165 26.290000000000003 21.2 25.345000000000002 65-69 27.1 26.674999999999997 21.475 24.75 70-74 27.255000000000003 26.645000000000003 21.099999999999998 25.0 75-79 26.795 26.27 21.77 25.165 80-84 27.465 26.06 21.545 24.93 85-89 27.79 26.465 20.82 24.925 90-94 27.54 26.505000000000003 21.48 24.474999999999998 95-99 27.355 26.465 21.63 24.55 100-104 27.215 27.029999999999998 20.93 24.825 105-109 27.384999999999998 25.96 22.14 24.515 110-114 27.76 26.66 21.335 24.245 115-119 28.12 26.51 20.995 24.375 120-124 26.625 27.025 21.43 24.92 125-129 27.445000000000004 27.060000000000002 21.404999999999998 24.09 130-134 26.8 27.125 21.315 24.759999999999998 135-139 27.07 26.93 22.05 23.95 140-144 27.815 27.37 21.12 23.695 145-149 27.339999999999996 27.139999999999997 21.75 23.77 150-151 27.200000000000003 27.6875 21.1625 23.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 1.0 6 1.0 7 2.0 8 2.5 9 3.5 10 4.5 11 3.0 12 2.0 13 1.5 14 2.0 15 2.0 16 2.0 17 4.0 18 4.5 19 4.5 20 5.0 21 5.5 22 5.5 23 3.5 24 1.5 25 2.0 26 5.0 27 7.5 28 9.5 29 13.0 30 11.0 31 10.0 32 11.0 33 11.0 34 17.5 35 21.0 36 27.5 37 44.0 38 56.5 39 70.0 40 90.5 41 98.5 42 124.0 43 152.5 44 156.5 45 153.5 46 142.0 47 139.0 48 146.0 49 145.0 50 132.0 51 125.0 52 109.5 53 104.5 54 107.0 55 95.5 56 90.5 57 93.0 58 87.5 59 89.0 60 88.0 61 89.0 62 97.5 63 87.5 64 77.5 65 74.5 66 70.0 67 67.0 68 72.0 69 75.0 70 66.0 71 53.0 72 50.0 73 48.0 74 36.5 75 23.5 76 20.0 77 15.0 78 10.0 79 7.0 80 5.0 81 7.5 82 5.0 83 2.0 84 3.5 85 4.5 86 3.5 87 3.0 88 3.0 89 2.0 90 3.0 91 2.5 92 2.5 93 3.5 94 2.5 95 2.5 96 5.0 97 5.0 98 4.0 99 4.0 100 20.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.74694311536418 90.05 2 3.8011695906432745 7.1499999999999995 3 0.3189792663476874 0.8999999999999999 4 0.053163211057947905 0.2 5 0.026581605528973953 0.125 6 0.0 0.0 7 0.026581605528973953 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026581605528973953 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 56 1.4000000000000001 No Hit CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 7 0.17500000000000002 No Hit GAACATGATAAAGGAGGGAAAGATTGTTCCATCGGAGGTAACTATAAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.3250000000000002 0.0 0.0 0.0 0.0 128-129 1.3875 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.6124999999999998 0.0 0.0 0.0 0.0 134-135 2.0374999999999996 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAATG 10 0.006830828 145.0 9 TCTTTCC 10 0.006830828 145.0 5 >>END_MODULE Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421497 spots for SRR8450159.sra Written 1421497 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra Read 1421493 spots for SRR8450159.sra Written 1421493 spots for SRR8450159.sra SRR ids: ['SRR8450159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ybufmonv SRR8450159.sra spots: 28429864 blocks: [[1, 1421493], [1421494, 2842986], [2842987, 4264479], [4264480, 5685972], [5685973, 7107465], [7107466, 8528958], [8528959, 9950451], [9950452, 11371944], [11371945, 12793437], [12793438, 14214930], [14214931, 15636423], [15636424, 17057916], [17057917, 18479409], [18479410, 19900902], [19900903, 21322395], [21322396, 22743888], [22743889, 24165381], [24165382, 25586874], [25586875, 27008367], [27008368, 28429864]] SRR8450159 file size 9612247 SRR8450159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450159 SRR8450159_1.fastq SRR8450159_2.fastq Input file: SRR8450159_1.fastq Paired file: SRR8450159_2.fastq trimmed: SRR8450159-trimmed-pair1.fastq, SRR8450159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:39:24 2024 >> started Fri Dec 6 10:39:59 2024 >> done (34.641s) 28429864 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 19359 ( 0.07%) empty read pairs filtered out after trimming by size control 28410479 (99.93%) read pairs available; of these: 1053206 ( 3.71%) trimmed read pairs available after processing 27357273 (96.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 2 0.00% 21 8 0.00% 22 9 0.00% 23 6 0.00% 24 11 0.00% 25 11 0.00% 26 6 0.00% 27 17 0.00% 28 12 0.00% 29 12 0.00% 30 17 0.00% 31 16 0.00% 32 12 0.00% 33 13 0.00% 34 14 0.00% 35 16 0.00% 36 13 0.00% 37 17 0.00% 38 17 0.00% 39 22 0.00% 40 14 0.00% 41 17 0.00% 42 19 0.00% 43 14 0.00% 44 27 0.00% 45 20 0.00% 46 26 0.00% 47 38 0.00% 48 29 0.00% 49 36 0.00% 50 28 0.00% 51 43 0.00% 52 39 0.00% 53 45 0.00% 54 33 0.00% 55 47 0.00% 56 34 0.00% 57 43 0.00% 58 54 0.00% 59 65 0.00% 60 65 0.00% 61 82 0.00% 62 82 0.00% 63 98 0.00% 64 78 0.00% 65 83 0.00% 66 82 0.00% 67 114 0.00% 68 126 0.00% 69 138 0.00% 70 161 0.00% 71 191 0.00% 72 230 0.00% 73 223 0.00% 74 275 0.00% 75 300 0.00% 76 326 0.00% 77 368 0.00% 78 401 0.00% 79 474 0.00% 80 548 0.00% 81 562 0.00% 82 681 0.00% 83 739 0.00% 84 795 0.00% 85 1029 0.00% 86 1051 0.00% 87 1204 0.00% 88 1292 0.00% 89 1426 0.01% 90 1571 0.01% 91 1812 0.01% 92 1902 0.01% 93 2208 0.01% 94 2450 0.01% 95 2665 0.01% 96 2870 0.01% 97 3246 0.01% 98 3583 0.01% 99 3766 0.01% 100 4180 0.01% 101 4417 0.02% 102 4901 0.02% 103 5247 0.02% 104 5624 0.02% 105 6191 0.02% 106 6651 0.02% 107 6909 0.02% 108 7221 0.03% 109 7770 0.03% 110 8309 0.03% 111 8508 0.03% 112 9410 0.03% 113 9811 0.03% 114 10748 0.04% 115 11144 0.04% 116 11793 0.04% 117 12298 0.04% 118 12916 0.05% 119 13776 0.05% 120 13966 0.05% 121 14684 0.05% 122 15571 0.05% 123 16194 0.06% 124 17381 0.06% 125 18332 0.06% 126 19164 0.07% 127 19877 0.07% 128 20152 0.07% 129 21010 0.07% 130 21987 0.08% 131 22562 0.08% 132 23590 0.08% 133 24890 0.09% 134 25684 0.09% 135 26616 0.09% 136 27632 0.10% 137 28470 0.10% 138 29166 0.10% 139 30471 0.11% 140 30801 0.11% 141 32219 0.11% 142 33296 0.12% 143 34504 0.12% 144 36085 0.13% 145 37116 0.13% 146 38226 0.13% 147 39884 0.14% 148 40776 0.14% 149 41883 0.15% 150 42964 0.15% 151 27357273 96.29% 28410479 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=24 prefix-density=0.74 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.29 sequence-density-rank=6 fanout-score=21.45 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=6.6 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=16 prefix-density=0.46 prefix-fanout=3.1 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=73.20 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=11.4 sequence=CCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR8450159 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:41:22 Started mapping on | Dec 06 10:41:22 Finished on | Dec 06 10:46:49 Mapping speed, Million of reads per hour | 312.78 Number of input reads | 28410479 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24176471 Uniquely mapped reads % | 85.10% Average mapped length | 299.03 Number of splices: Total | 26403771 Number of splices: Annotated (sjdb) | 24832696 Number of splices: GT/AG | 26049978 Number of splices: GC/AG | 305692 Number of splices: AT/AC | 10596 Number of splices: Non-canonical | 37505 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.80 Insertion rate per base | 0.01% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312731 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 32738 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.83% % of reads unmapped: other | 0.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3921277 3921277 3921277 N_multimapping 312731 312731 312731 N_noFeature 744659 23500527 941576 N_ambiguous 589537 3701 112455 UnstrandedReadsAssigned:22842275 PositiveStrandReadsAssigned:672243 NegativeStrandReadsAssigned:23122440 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450159-trimmed-pair1.fastq SRR8450159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,410,479 reads, 25,179,012 reads pseudoaligned [quant] estimated average fragment length: 294.335 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR8450159.ke.tsv 35125 SRR8450159.se.tsv 88098 total ==> SRR8450159.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 643.376 0 0 PNS24247 1044 750.665 59.5498 4.28828 PNS24249 1928 1634.67 196.857 6.50984 PNS24246 1044 750.665 59.5498 4.28828 PNS24248 1044 750.665 59.5498 4.28828 PNS24244 1471 1177.67 35.494 1.62923 PNS24243 293 76.9244 0 0 KQK14069 1603 1309.67 11122.3 459.073 KQK14071 474 207.063 147.751 38.5725 ==> SRR8450159.se.tsv <== BRADI_1g14170v3 10976 BRADI_1g53295v3 202 BRADI_1g59795v3 201 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 340 BRADI_1g74790v3 162 BRADI_1g09890v3 0 BRADI_1g77505v3 335 BRADI_1g48960v3 0 SRR8450159 completed mapping pipeline successfully