Starting /dee2/code/volunteer_pipeline.sh SRR8450160 current disk space = 1551748075520 free memory = 1604620100 SRR8450160 SRAfilesize e278730743099e8d5613db915d0d4234 SRR8450160.sra SRR8450160.sra file validated SRR8450160 is paired end SRR8450160 is conventional basespace SRR8450160 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.98175 37.0 37.0 37.0 37.0 37.0 2 36.26925 37.0 37.0 37.0 37.0 37.0 3 36.232 37.0 37.0 37.0 37.0 37.0 4 36.344 37.0 37.0 37.0 37.0 37.0 5 36.4215 37.0 37.0 37.0 37.0 37.0 6 36.4265 37.0 37.0 37.0 37.0 37.0 7 36.3765 37.0 37.0 37.0 37.0 37.0 8 36.4675 37.0 37.0 37.0 37.0 37.0 9 36.4135 37.0 37.0 37.0 37.0 37.0 10-14 36.4885 37.0 37.0 37.0 37.0 37.0 15-19 36.4254 37.0 37.0 37.0 37.0 37.0 20-24 36.396 37.0 37.0 37.0 37.0 37.0 25-29 36.332800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.319100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3322 37.0 37.0 37.0 37.0 37.0 40-44 36.2397 37.0 37.0 37.0 37.0 37.0 45-49 36.272400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2405 37.0 37.0 37.0 37.0 37.0 55-59 36.205 37.0 37.0 37.0 37.0 37.0 60-64 36.143299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1169 37.0 37.0 37.0 37.0 37.0 70-74 36.1458 37.0 37.0 37.0 37.0 37.0 75-79 36.1683 37.0 37.0 37.0 37.0 37.0 80-84 36.1732 37.0 37.0 37.0 37.0 37.0 85-89 36.096799999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.1472 37.0 37.0 37.0 37.0 37.0 95-99 36.086200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.97580000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.9682 37.0 37.0 37.0 37.0 37.0 110-114 35.9532 37.0 37.0 37.0 37.0 37.0 115-119 36.0131 37.0 37.0 37.0 37.0 37.0 120-124 35.845299999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.821999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.8176 37.0 37.0 37.0 37.0 37.0 135-139 35.7797 37.0 37.0 37.0 37.0 37.0 140-144 35.755 37.0 37.0 37.0 37.0 37.0 145-149 35.7599 37.0 37.0 37.0 37.0 37.0 150-151 35.16175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 3.0 25 4.0 26 6.0 27 10.0 28 22.0 29 22.0 30 43.0 31 50.0 32 71.0 33 73.0 34 152.0 35 338.0 36 2777.0 37 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.7969339029907 10.806735360643378 6.886152299572757 30.51017843679316 2 27.47060295221416 11.933950462847136 29.522141606204656 31.07330497873405 3 22.650000000000002 18.075 23.0 36.275 4 27.0 24.875 21.975 26.150000000000002 5 26.85 26.5 23.150000000000002 23.5 6 24.525 28.375 23.875 23.225 7 19.55 22.675 37.325 20.45 8 21.224999999999998 23.425 27.875 27.474999999999998 9 21.075 22.35 31.85 24.725 10-14 24.295 25.595000000000002 24.805 25.305 15-19 23.995 24.245 25.979999999999997 25.779999999999998 20-24 24.3 24.295 25.135 26.27 25-29 24.375 24.95 24.45 26.224999999999998 30-34 23.9 24.325 25.45 26.325 35-39 23.830000000000002 24.535 25.009999999999998 26.625 40-44 24.23 23.9 25.155 26.715 45-49 24.245 23.794999999999998 25.335 26.625 50-54 24.709999999999997 24.55 24.675 26.064999999999998 55-59 24.44 24.975 24.255 26.33 60-64 24.905 24.04 24.54 26.515 65-69 24.21 24.555 25.180000000000003 26.055 70-74 24.57 24.325 24.415 26.69 75-79 24.285 23.544999999999998 25.580000000000002 26.590000000000003 80-84 24.55 24.4 24.44 26.61 85-89 24.83 24.305 24.935 25.929999999999996 90-94 25.31 23.93 24.235 26.525 95-99 24.834999999999997 23.71 24.595 26.86 100-104 24.8 24.32 24.25 26.63 105-109 24.779999999999998 23.35 25.224999999999998 26.645000000000003 110-114 25.655 23.56 24.665 26.119999999999997 115-119 25.305 23.86 24.75 26.085 120-124 24.875 24.404999999999998 24.495 26.224999999999998 125-129 25.224999999999998 24.29 24.145 26.340000000000003 130-134 25.165 24.474999999999998 24.345 26.015 135-139 25.455 24.83 23.75 25.965 140-144 24.67 23.849999999999998 24.48 27.0 145-149 25.224999999999998 23.57 24.85 26.355 150-151 25.8125 23.3125 23.775 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 3.5 28 3.5 29 3.0 30 4.0 31 5.5 32 9.5 33 15.5 34 19.5 35 24.5 36 40.0 37 52.0 38 61.0 39 78.0 40 95.5 41 125.0 42 151.5 43 165.0 44 159.0 45 175.5 46 200.0 47 202.5 48 197.5 49 179.5 50 166.5 51 147.5 52 122.5 53 117.5 54 110.5 55 92.0 56 90.5 57 92.5 58 93.0 59 91.5 60 83.5 61 74.0 62 68.0 63 71.0 64 73.5 65 76.0 66 67.5 67 60.5 68 62.5 69 49.5 70 41.0 71 33.5 72 28.5 73 29.0 74 27.0 75 21.0 76 11.0 77 6.5 78 7.0 79 3.5 80 0.5 81 2.0 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.79524680073126 91.7 2 3.9435884042831026 7.55 3 0.26116479498563594 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1625 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.7125 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATT 10 0.006830828 145.0 7 GTGCTCC 10 0.006830828 145.0 4 >>END_MODULE SRR8450160 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450160_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.787 37.0 37.0 37.0 37.0 37.0 2 35.443 37.0 37.0 37.0 37.0 37.0 3 35.2985 37.0 37.0 37.0 37.0 37.0 4 35.2655 37.0 37.0 37.0 37.0 37.0 5 35.4055 37.0 37.0 37.0 37.0 37.0 6 35.3345 37.0 37.0 37.0 37.0 37.0 7 35.2465 37.0 37.0 37.0 37.0 37.0 8 35.22 37.0 37.0 37.0 37.0 37.0 9 35.3625 37.0 37.0 37.0 37.0 37.0 10-14 35.0664 37.0 37.0 37.0 32.2 37.0 15-19 34.982299999999995 37.0 37.0 37.0 27.4 37.0 20-24 34.9665 37.0 37.0 37.0 27.4 37.0 25-29 34.7821 37.0 37.0 37.0 25.0 37.0 30-34 34.735699999999994 37.0 37.0 37.0 25.0 37.0 35-39 34.7481 37.0 37.0 37.0 25.0 37.0 40-44 34.605399999999996 37.0 37.0 37.0 25.0 37.0 45-49 34.609500000000004 37.0 37.0 37.0 25.0 37.0 50-54 34.4781 37.0 37.0 37.0 25.0 37.0 55-59 34.5724 37.0 37.0 37.0 25.0 37.0 60-64 34.6174 37.0 37.0 37.0 25.0 37.0 65-69 34.5341 37.0 37.0 37.0 25.0 37.0 70-74 34.431799999999996 37.0 37.0 37.0 25.0 37.0 75-79 34.460899999999995 37.0 37.0 37.0 25.0 37.0 80-84 34.424800000000005 37.0 37.0 37.0 25.0 37.0 85-89 34.3864 37.0 37.0 37.0 25.0 37.0 90-94 34.3273 37.0 37.0 37.0 25.0 37.0 95-99 34.367000000000004 37.0 37.0 37.0 25.0 37.0 100-104 34.3043 37.0 37.0 37.0 25.0 37.0 105-109 34.3324 37.0 37.0 37.0 25.0 37.0 110-114 34.2421 37.0 37.0 37.0 25.0 37.0 115-119 34.24679999999999 37.0 37.0 37.0 25.0 37.0 120-124 34.2402 37.0 37.0 37.0 25.0 37.0 125-129 34.1835 37.0 37.0 37.0 25.0 37.0 130-134 33.9913 37.0 37.0 37.0 25.0 37.0 135-139 33.981 37.0 37.0 37.0 25.0 37.0 140-144 33.8155 37.0 37.0 37.0 25.0 37.0 145-149 33.8226 37.0 37.0 37.0 25.0 37.0 150-151 33.1445 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 16.0 14 28.0 15 32.0 16 16.0 17 13.0 18 15.0 19 18.0 20 17.0 21 24.0 22 30.0 23 37.0 24 36.0 25 26.0 26 30.0 27 24.0 28 31.0 29 36.0 30 43.0 31 62.0 32 94.0 33 141.0 34 232.0 35 528.0 36 2288.0 37 182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.4 18.475 10.075000000000001 27.05 2 35.475 20.599999999999998 22.475 21.45 3 27.3 24.4 24.4 23.9 4 31.674999999999997 28.975 18.45 20.9 5 30.475 28.9 18.55 22.075 6 26.3 32.475 18.675 22.55 7 26.625 19.85 29.7 23.825 8 26.900000000000002 23.825 21.525 27.750000000000004 9 25.900000000000002 21.975 24.075 28.050000000000004 10-14 28.67 25.255 21.08 24.995 15-19 28.43 25.180000000000003 21.7 24.69 20-24 27.74 24.884999999999998 22.065 25.31 25-29 27.589999999999996 25.330000000000002 22.075 25.005 30-34 26.995 25.474999999999998 22.11 25.419999999999998 35-39 25.915 26.11 22.134999999999998 25.840000000000003 40-44 26.700000000000003 25.895000000000003 22.49 24.915000000000003 45-49 26.61 25.580000000000002 22.24 25.569999999999997 50-54 27.04 25.7 22.415 24.845 55-59 27.315 25.669999999999998 21.990000000000002 25.025 60-64 26.39 26.68 22.21 24.72 65-69 26.71 26.674999999999997 21.905 24.709999999999997 70-74 27.02 25.885 22.215 24.88 75-79 26.32 26.3 22.23 25.15 80-84 26.484999999999996 25.979999999999997 22.14 25.395 85-89 26.415 26.015 22.165000000000003 25.405 90-94 26.575 26.605 22.195 24.625 95-99 27.02 26.384999999999998 22.025 24.57 100-104 26.405 25.91 22.73 24.955 105-109 26.71 26.75 21.975 24.565 110-114 26.83 26.595000000000002 22.45 24.125 115-119 27.72 26.255 22.075 23.95 120-124 26.740000000000002 26.72 22.27 24.27 125-129 26.705000000000002 26.56 21.654999999999998 25.080000000000002 130-134 27.169999999999998 26.76 21.634999999999998 24.435000000000002 135-139 27.125 27.029999999999998 22.125 23.72 140-144 26.875 26.83 22.305 23.990000000000002 145-149 27.105 26.640000000000004 22.7 23.555 150-151 27.325 26.424999999999997 21.6625 24.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 1.5 6 2.5 7 3.5 8 2.5 9 2.5 10 3.0 11 3.0 12 3.5 13 3.5 14 3.0 15 3.0 16 3.0 17 2.5 18 1.5 19 2.0 20 6.0 21 5.0 22 2.0 23 3.5 24 4.0 25 4.0 26 5.5 27 7.5 28 6.5 29 7.0 30 11.0 31 11.0 32 15.5 33 18.0 34 20.5 35 24.5 36 28.5 37 47.0 38 64.5 39 73.0 40 85.5 41 102.5 42 109.5 43 131.5 44 158.0 45 157.0 46 149.0 47 148.5 48 147.5 49 143.5 50 134.0 51 140.0 52 130.5 53 114.5 54 114.5 55 103.5 56 101.5 57 102.5 58 97.0 59 84.0 60 77.5 61 85.0 62 86.5 63 85.0 64 92.5 65 86.0 66 70.5 67 69.0 68 77.0 69 69.0 70 49.5 71 41.5 72 43.5 73 37.0 74 29.5 75 22.0 76 12.5 77 15.0 78 13.5 79 6.5 80 4.5 81 3.5 82 4.5 83 3.0 84 1.0 85 1.5 86 1.0 87 0.5 88 1.0 89 2.0 90 2.0 91 1.0 92 2.0 93 3.0 94 2.5 95 2.5 96 1.5 97 2.0 98 2.5 99 3.0 100 13.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 96.15587151132175 91.3 2 3.4755134281200633 6.6000000000000005 3 0.18430753027909424 0.525 4 0.105318588730911 0.4 5 0.02632964718272775 0.125 6 0.02632964718272775 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02632964718272775 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 36 0.8999999999999999 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 6 0.15 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.07500000000000001 0.0 0.0 0.0 0.025 94-95 0.1 0.0 0.0 0.0 0.025 96-97 0.1125 0.0 0.0 0.0 0.025 98-99 0.125 0.0 0.0 0.0 0.025 100-101 0.1375 0.0 0.0 0.0 0.025 102-103 0.2 0.0 0.0 0.0 0.025 104-105 0.3 0.0 0.0 0.0 0.025 106-107 0.3375 0.0 0.0 0.0 0.025 108-109 0.4 0.0 0.0 0.0 0.025 110-111 0.425 0.0 0.0 0.0 0.025 112-113 0.48750000000000004 0.0 0.0 0.0 0.025 114-115 0.675 0.0 0.0 0.0 0.025 116-117 0.7875 0.0 0.0 0.0 0.025 118-119 0.9 0.0 0.0 0.0 0.025 120-121 0.95 0.0 0.0 0.0 0.025 122-123 1.0499999999999998 0.0 0.0 0.0 0.025 124-125 1.1124999999999998 0.0 0.0 0.0 0.025 126-127 1.3125 0.0 0.0 0.0 0.025 128-129 1.5125 0.0 0.0 0.0 0.025 130-131 1.7374999999999998 0.0 0.0 0.0 0.025 132-133 1.8250000000000002 0.0 0.0 0.0 0.025 134-135 1.85 0.0 0.0 0.0 0.025 136-137 2.0125 0.0 0.0 0.0 0.025 138-139 2.3 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGAC 10 0.006830828 145.0 145 GACTGGT 10 0.006830828 145.0 145 GCCAAAG 10 0.006830828 145.0 7 >>END_MODULE Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646018 spots for SRR8450160.sra Written 1646018 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra Read 1646015 spots for SRR8450160.sra Written 1646015 spots for SRR8450160.sra SRR ids: ['SRR8450160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4c58527h SRR8450160.sra spots: 32920303 blocks: [[1, 1646015], [1646016, 3292030], [3292031, 4938045], [4938046, 6584060], [6584061, 8230075], [8230076, 9876090], [9876091, 11522105], [11522106, 13168120], [13168121, 14814135], [14814136, 16460150], [16460151, 18106165], [18106166, 19752180], [19752181, 21398195], [21398196, 23044210], [23044211, 24690225], [24690226, 26336240], [26336241, 27982255], [27982256, 29628270], [29628271, 31274285], [31274286, 32920303]] SRR8450160 file size 11133910 SRR8450160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450160 SRR8450160_1.fastq SRR8450160_2.fastq Input file: SRR8450160_1.fastq Paired file: SRR8450160_2.fastq trimmed: SRR8450160-trimmed-pair1.fastq, SRR8450160-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:41:52 2024 >> started Fri Dec 6 10:42:40 2024 >> done (48.558s) 32920303 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 24305 ( 0.07%) empty read pairs filtered out after trimming by size control 32895952 (99.93%) read pairs available; of these: 1347688 ( 4.10%) trimmed read pairs available after processing 31548264 (95.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 5 0.00% 21 8 0.00% 22 7 0.00% 23 7 0.00% 24 5 0.00% 25 10 0.00% 26 11 0.00% 27 14 0.00% 28 11 0.00% 29 17 0.00% 30 13 0.00% 31 15 0.00% 32 24 0.00% 33 16 0.00% 34 15 0.00% 35 32 0.00% 36 21 0.00% 37 30 0.00% 38 29 0.00% 39 12 0.00% 40 23 0.00% 41 26 0.00% 42 28 0.00% 43 27 0.00% 44 35 0.00% 45 30 0.00% 46 39 0.00% 47 42 0.00% 48 44 0.00% 49 47 0.00% 50 49 0.00% 51 50 0.00% 52 55 0.00% 53 56 0.00% 54 53 0.00% 55 64 0.00% 56 61 0.00% 57 56 0.00% 58 77 0.00% 59 95 0.00% 60 98 0.00% 61 114 0.00% 62 114 0.00% 63 111 0.00% 64 131 0.00% 65 133 0.00% 66 160 0.00% 67 157 0.00% 68 204 0.00% 69 241 0.00% 70 272 0.00% 71 259 0.00% 72 374 0.00% 73 362 0.00% 74 427 0.00% 75 422 0.00% 76 467 0.00% 77 557 0.00% 78 620 0.00% 79 676 0.00% 80 905 0.00% 81 949 0.00% 82 1051 0.00% 83 1211 0.00% 84 1354 0.00% 85 1474 0.00% 86 1623 0.00% 87 1867 0.01% 88 2001 0.01% 89 2135 0.01% 90 2436 0.01% 91 2691 0.01% 92 3008 0.01% 93 3296 0.01% 94 3757 0.01% 95 3965 0.01% 96 4295 0.01% 97 4621 0.01% 98 4983 0.02% 99 5543 0.02% 100 5813 0.02% 101 6213 0.02% 102 6922 0.02% 103 7080 0.02% 104 7753 0.02% 105 8058 0.02% 106 8722 0.03% 107 9282 0.03% 108 9910 0.03% 109 10349 0.03% 110 10897 0.03% 111 11538 0.04% 112 12338 0.04% 113 12955 0.04% 114 13870 0.04% 115 14773 0.04% 116 15445 0.05% 117 16196 0.05% 118 16690 0.05% 119 17405 0.05% 120 18256 0.06% 121 18762 0.06% 122 19817 0.06% 123 20921 0.06% 124 21724 0.07% 125 23437 0.07% 126 24159 0.07% 127 25241 0.08% 128 25594 0.08% 129 26978 0.08% 130 27875 0.08% 131 28686 0.09% 132 29831 0.09% 133 30949 0.09% 134 32034 0.10% 135 33690 0.10% 136 34903 0.11% 137 35874 0.11% 138 36430 0.11% 139 38038 0.12% 140 38973 0.12% 141 40406 0.12% 142 42428 0.13% 143 43538 0.13% 144 44664 0.14% 145 46842 0.14% 146 47825 0.15% 147 49438 0.15% 148 51322 0.16% 149 52872 0.16% 150 53636 0.16% 151 31548264 95.90% 32895952 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=27 prefix-density=0.55 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=30.21 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=23 prefix-density=0.79 prefix-fanout=1.8 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=116.58 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.1 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTT SRR8450160 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:43:27 Started mapping on | Dec 06 10:43:28 Finished on | Dec 06 10:48:59 Mapping speed, Million of reads per hour | 357.78 Number of input reads | 32895952 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 29329408 Uniquely mapped reads % | 89.16% Average mapped length | 299.00 Number of splices: Total | 31025701 Number of splices: Annotated (sjdb) | 29072220 Number of splices: GT/AG | 30602264 Number of splices: GC/AG | 362729 Number of splices: AT/AC | 14197 Number of splices: Non-canonical | 46511 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.83 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292384 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 21953 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.42% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3274160 3274160 3274160 N_multimapping 292384 292384 292384 N_noFeature 967809 28483576 1197654 N_ambiguous 747348 4789 132759 UnstrandedReadsAssigned:27614251 PositiveStrandReadsAssigned:841043 NegativeStrandReadsAssigned:27998995 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450160 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450160-trimmed-pair1.fastq SRR8450160-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,895,952 reads, 29,623,673 reads pseudoaligned [quant] estimated average fragment length: 303.953 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52973 SRR8450160.ke.tsv 35125 SRR8450160.se.tsv 88098 total ==> SRR8450160.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 633.879 0.000478935 3.45038e-05 PNS24247 1044 741.047 95.998 5.9158 PNS24249 1928 1625.05 220.152 6.18663 PNS24246 1044 741.047 95.998 5.9158 PNS24248 1044 741.047 95.998 5.9158 PNS24244 1471 1168.05 78.853 3.08287 PNS24243 293 79.4902 0 0 KQK14069 1603 1300.05 9198.56 323.115 KQK14071 474 207.204 124.435 27.4247 ==> SRR8450160.se.tsv <== BRADI_1g14170v3 9483 BRADI_1g53295v3 256 BRADI_1g59795v3 695 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 925 BRADI_1g74790v3 140 BRADI_1g09890v3 3 BRADI_1g77505v3 448 BRADI_1g48960v3 0 SRR8450160 completed mapping pipeline successfully