Starting /dee2/code/volunteer_pipeline.sh SRR8450161 current disk space = 1551757119488 free memory = 1604602124 SRR8450161 SRAfilesize 505080a73dfaa8e145010d2297e6e4db SRR8450161.sra SRR8450161.sra file validated SRR8450161 is paired end SRR8450161 is conventional basespace SRR8450161 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450161_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.04875 37.0 37.0 37.0 37.0 37.0 2 36.2505 37.0 37.0 37.0 37.0 37.0 3 36.2835 37.0 37.0 37.0 37.0 37.0 4 36.4615 37.0 37.0 37.0 37.0 37.0 5 36.4445 37.0 37.0 37.0 37.0 37.0 6 36.492 37.0 37.0 37.0 37.0 37.0 7 36.416 37.0 37.0 37.0 37.0 37.0 8 36.425 37.0 37.0 37.0 37.0 37.0 9 36.471 37.0 37.0 37.0 37.0 37.0 10-14 36.479699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.3977 37.0 37.0 37.0 37.0 37.0 20-24 36.4319 37.0 37.0 37.0 37.0 37.0 25-29 36.3079 37.0 37.0 37.0 37.0 37.0 30-34 36.3626 37.0 37.0 37.0 37.0 37.0 35-39 36.3377 37.0 37.0 37.0 37.0 37.0 40-44 36.3091 37.0 37.0 37.0 37.0 37.0 45-49 36.3156 37.0 37.0 37.0 37.0 37.0 50-54 36.275999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2368 37.0 37.0 37.0 37.0 37.0 60-64 36.2012 37.0 37.0 37.0 37.0 37.0 65-69 36.065599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2173 37.0 37.0 37.0 37.0 37.0 75-79 36.2024 37.0 37.0 37.0 37.0 37.0 80-84 36.21640000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1619 37.0 37.0 37.0 37.0 37.0 90-94 36.1687 37.0 37.0 37.0 37.0 37.0 95-99 36.0908 37.0 37.0 37.0 37.0 37.0 100-104 36.0364 37.0 37.0 37.0 37.0 37.0 105-109 35.9962 37.0 37.0 37.0 37.0 37.0 110-114 35.935 37.0 37.0 37.0 37.0 37.0 115-119 35.9791 37.0 37.0 37.0 37.0 37.0 120-124 35.8575 37.0 37.0 37.0 37.0 37.0 125-129 35.866200000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8627 37.0 37.0 37.0 37.0 37.0 135-139 35.8377 37.0 37.0 37.0 37.0 37.0 140-144 35.8125 37.0 37.0 37.0 37.0 37.0 145-149 35.71470000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.188 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 3.0 25 2.0 26 7.0 27 7.0 28 23.0 29 23.0 30 32.0 31 40.0 32 63.0 33 113.0 34 132.0 35 340.0 36 2770.0 37 440.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.937106918238996 12.150943396226415 8.327044025157234 29.58490566037736 2 25.78789394697349 13.856928464232116 29.314657328664335 31.040520260130066 3 22.8 19.125 24.925 33.15 4 26.275 25.15 21.475 27.1 5 27.800000000000004 27.400000000000002 22.35 22.45 6 23.175 29.875 23.400000000000002 23.549999999999997 7 19.075 22.900000000000002 37.724999999999994 20.3 8 22.275 23.200000000000003 28.999999999999996 25.525 9 22.650000000000002 21.075 30.45 25.825 10-14 24.085 25.7 24.165 26.05 15-19 24.065 24.310000000000002 24.765 26.86 20-24 24.43 24.325 25.215 26.029999999999998 25-29 24.015 24.46 25.2 26.325 30-34 24.16 25.1 24.665 26.075 35-39 24.665 24.325 24.81 26.200000000000003 40-44 24.685000000000002 24.555 24.38 26.38 45-49 24.404999999999998 24.095 24.59 26.91 50-54 24.52 24.16 24.325 26.995 55-59 24.4 23.9 25.155 26.545 60-64 24.82 24.605 23.849999999999998 26.724999999999998 65-69 24.68 23.974999999999998 24.915000000000003 26.43 70-74 25.009999999999998 24.255 24.48 26.255 75-79 25.174999999999997 23.66 24.435000000000002 26.729999999999997 80-84 24.625 23.54 24.575 27.26 85-89 25.14 24.15 23.775 26.935 90-94 25.395 23.805 23.849999999999998 26.950000000000003 95-99 25.495 23.72 23.945 26.840000000000003 100-104 24.895 23.755000000000003 24.58 26.77 105-109 25.365 23.445 24.695 26.495 110-114 24.990000000000002 23.77 24.465 26.775 115-119 25.505 23.29 24.235 26.97 120-124 25.580000000000002 23.724999999999998 24.32 26.375 125-129 25.7 23.119999999999997 24.535 26.645000000000003 130-134 25.405 23.345 24.82 26.43 135-139 25.405 24.14 24.235 26.22 140-144 26.095000000000002 23.365 23.965 26.575 145-149 25.369999999999997 23.54 23.830000000000002 27.26 150-151 25.0375 23.525 24.275 27.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 2.0 28 2.5 29 4.5 30 5.0 31 7.0 32 11.0 33 20.5 34 26.0 35 31.5 36 41.5 37 50.0 38 71.0 39 87.0 40 105.5 41 129.0 42 132.5 43 145.0 44 159.0 45 164.5 46 176.0 47 174.5 48 175.0 49 166.5 50 158.0 51 148.5 52 130.5 53 125.0 54 108.5 55 97.0 56 98.0 57 99.0 58 86.0 59 76.5 60 91.0 61 96.5 62 80.0 63 75.5 64 80.5 65 69.5 66 62.5 67 54.0 68 52.5 69 52.0 70 42.5 71 36.0 72 36.0 73 37.0 74 27.5 75 23.5 76 19.0 77 14.5 78 10.5 79 5.5 80 4.5 81 4.0 82 2.5 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.77710366657874 89.825 2 4.985491954629386 9.45 3 0.1846478501714587 0.525 4 0.052756528620416784 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.48750000000000004 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.2625000000000002 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.7375 0.0 0.0 0.0 0.0 138-139 1.9874999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTGC 10 0.006830828 145.0 5 TTGGTAG 10 0.006830828 145.0 6 GCCAACC 10 0.006830828 145.0 1 CCCGCGG 20 0.00593511 29.0 45-49 >>END_MODULE SRR8450161 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450161_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7375 37.0 37.0 37.0 37.0 37.0 2 35.1845 37.0 37.0 37.0 37.0 37.0 3 35.0995 37.0 37.0 37.0 37.0 37.0 4 35.163 37.0 37.0 37.0 37.0 37.0 5 35.0445 37.0 37.0 37.0 25.0 37.0 6 34.9225 37.0 37.0 37.0 25.0 37.0 7 34.8765 37.0 37.0 37.0 25.0 37.0 8 35.0815 37.0 37.0 37.0 25.0 37.0 9 34.8765 37.0 37.0 37.0 25.0 37.0 10-14 34.7411 37.0 37.0 37.0 25.0 37.0 15-19 34.573699999999995 37.0 37.0 37.0 25.0 37.0 20-24 34.4289 37.0 37.0 37.0 25.0 37.0 25-29 34.2838 37.0 37.0 37.0 25.0 37.0 30-34 34.2347 37.0 37.0 37.0 25.0 37.0 35-39 34.2876 37.0 37.0 37.0 25.0 37.0 40-44 34.003600000000006 37.0 37.0 37.0 25.0 37.0 45-49 34.1474 37.0 37.0 37.0 25.0 37.0 50-54 34.0609 37.0 37.0 37.0 25.0 37.0 55-59 34.0809 37.0 37.0 37.0 25.0 37.0 60-64 34.1098 37.0 37.0 37.0 25.0 37.0 65-69 33.9458 37.0 37.0 37.0 25.0 37.0 70-74 33.8718 37.0 37.0 37.0 25.0 37.0 75-79 33.919200000000004 37.0 37.0 37.0 25.0 37.0 80-84 33.9933 37.0 37.0 37.0 25.0 37.0 85-89 33.8443 37.0 37.0 37.0 25.0 37.0 90-94 33.8879 37.0 37.0 37.0 25.0 37.0 95-99 33.7615 37.0 37.0 37.0 25.0 37.0 100-104 33.8035 37.0 37.0 37.0 25.0 37.0 105-109 33.847 37.0 37.0 37.0 25.0 37.0 110-114 33.7857 37.0 37.0 37.0 25.0 37.0 115-119 33.8119 37.0 37.0 37.0 25.0 37.0 120-124 33.7247 37.0 37.0 37.0 22.2 37.0 125-129 33.669799999999995 37.0 37.0 37.0 25.0 37.0 130-134 33.640499999999996 37.0 37.0 37.0 22.2 37.0 135-139 33.533100000000005 37.0 37.0 37.0 19.4 37.0 140-144 33.266 37.0 37.0 37.0 11.0 37.0 145-149 33.3858 37.0 37.0 37.0 13.8 37.0 150-151 32.68325 37.0 37.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 6.0 13 33.0 14 51.0 15 28.0 16 25.0 17 25.0 18 20.0 19 32.0 20 17.0 21 35.0 22 45.0 23 40.0 24 32.0 25 31.0 26 29.0 27 26.0 28 22.0 29 37.0 30 50.0 31 54.0 32 68.0 33 127.0 34 213.0 35 552.0 36 2213.0 37 188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.125 17.7 9.4 26.775 2 35.4 21.975 21.425 21.2 3 30.375000000000004 23.575 23.3 22.75 4 33.175 27.925 16.5 22.400000000000002 5 31.6 30.5 17.0 20.9 6 28.199999999999996 31.05 18.05 22.7 7 28.475 17.849999999999998 29.125 24.55 8 29.325000000000003 21.8 20.65 28.225 9 28.549999999999997 23.35 23.7 24.4 10-14 29.79 24.935 19.485 25.790000000000003 15-19 28.84 24.72 21.625 24.815 20-24 28.725 25.3 21.005 24.97 25-29 28.285 25.974999999999998 20.919999999999998 24.82 30-34 27.58 25.775 21.785 24.86 35-39 27.63 25.85 21.185000000000002 25.335 40-44 27.845 26.355 20.595 25.205 45-49 26.85 26.44 20.985 25.724999999999998 50-54 26.71 26.43 21.445 25.415 55-59 27.22 26.57 20.8 25.41 60-64 27.375 26.11 21.305 25.21 65-69 26.88 26.395000000000003 21.545 25.180000000000003 70-74 27.24 26.205000000000002 21.255 25.3 75-79 26.51 26.634999999999998 21.65 25.205 80-84 27.685 25.85 21.224999999999998 25.240000000000002 85-89 27.495000000000005 26.5 21.075 24.93 90-94 26.534999999999997 26.445 21.78 25.240000000000002 95-99 26.755000000000003 26.865 21.64 24.740000000000002 100-104 27.37 26.400000000000002 21.42 24.81 105-109 27.175 26.119999999999997 22.225 24.48 110-114 27.02 27.325 21.375 24.279999999999998 115-119 26.529999999999998 26.884999999999998 21.685 24.9 120-124 26.68 27.29 21.5 24.529999999999998 125-129 27.235 26.724999999999998 21.4 24.64 130-134 27.650000000000002 26.775 21.185000000000002 24.39 135-139 26.845000000000002 27.655 21.325 24.175 140-144 26.47 27.634999999999998 21.495 24.4 145-149 27.505000000000003 27.07 20.925 24.5 150-151 27.775 26.450000000000003 21.3625 24.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 1.5 5 1.5 6 2.0 7 2.5 8 2.5 9 4.0 10 3.5 11 1.5 12 1.0 13 4.0 14 5.0 15 3.0 16 1.5 17 3.0 18 3.5 19 3.5 20 4.0 21 2.0 22 4.5 23 5.5 24 4.0 25 5.5 26 9.0 27 8.5 28 5.0 29 11.5 30 13.5 31 11.0 32 12.0 33 15.5 34 20.0 35 24.0 36 29.0 37 33.0 38 49.0 39 67.5 40 91.5 41 106.0 42 104.5 43 111.0 44 131.0 45 143.5 46 141.0 47 149.0 48 151.0 49 154.0 50 131.5 51 122.0 52 129.0 53 117.0 54 105.0 55 90.5 56 93.5 57 103.5 58 106.5 59 102.0 60 87.0 61 78.0 62 91.0 63 97.5 64 90.5 65 79.0 66 71.0 67 68.0 68 75.5 69 79.0 70 70.0 71 50.0 72 43.0 73 44.5 74 36.0 75 31.5 76 25.0 77 17.5 78 12.5 79 10.5 80 7.5 81 5.0 82 4.0 83 2.0 84 1.5 85 2.5 86 2.5 87 2.5 88 4.0 89 4.0 90 2.5 91 1.5 92 1.5 93 2.0 94 2.0 95 2.0 96 2.0 97 5.0 98 7.0 99 4.5 100 8.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7660756813972 90.47500000000001 2 3.7840698597512565 7.1499999999999995 3 0.3440063508864779 0.975 4 0.05292405398253506 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02646202699126753 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02646202699126753 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 41 1.0250000000000001 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.2374999999999998 0.0 0.0 0.0 0.0 132-133 1.3875000000000002 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.8625 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1884082 spots for SRR8450161.sra Written 1884082 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra Read 1884066 spots for SRR8450161.sra Written 1884066 spots for SRR8450161.sra SRR ids: ['SRR8450161.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_62mzthpr SRR8450161.sra spots: 37681336 blocks: [[1, 1884066], [1884067, 3768132], [3768133, 5652198], [5652199, 7536264], [7536265, 9420330], [9420331, 11304396], [11304397, 13188462], [13188463, 15072528], [15072529, 16956594], [16956595, 18840660], [18840661, 20724726], [20724727, 22608792], [22608793, 24492858], [24492859, 26376924], [26376925, 28260990], [28260991, 30145056], [30145057, 32029122], [32029123, 33913188], [33913189, 35797254], [35797255, 37681336]] SRR8450161 file size 12747267 SRR8450161 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450161 SRR8450161_1.fastq SRR8450161_2.fastq Input file: SRR8450161_1.fastq Paired file: SRR8450161_2.fastq trimmed: SRR8450161-trimmed-pair1.fastq, SRR8450161-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:44:14 2024 >> started Fri Dec 6 10:44:53 2024 >> done (38.809s) 37681336 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 19854 ( 0.05%) empty read pairs filtered out after trimming by size control 37661432 (99.95%) read pairs available; of these: 1440314 ( 3.82%) trimmed read pairs available after processing 36221118 (96.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 14 0.00% 20 10 0.00% 21 10 0.00% 22 10 0.00% 23 9 0.00% 24 10 0.00% 25 16 0.00% 26 18 0.00% 27 18 0.00% 28 23 0.00% 29 23 0.00% 30 17 0.00% 31 27 0.00% 32 27 0.00% 33 22 0.00% 34 22 0.00% 35 44 0.00% 36 20 0.00% 37 31 0.00% 38 39 0.00% 39 36 0.00% 40 33 0.00% 41 32 0.00% 42 33 0.00% 43 34 0.00% 44 37 0.00% 45 32 0.00% 46 55 0.00% 47 41 0.00% 48 49 0.00% 49 56 0.00% 50 36 0.00% 51 47 0.00% 52 73 0.00% 53 59 0.00% 54 74 0.00% 55 63 0.00% 56 63 0.00% 57 61 0.00% 58 71 0.00% 59 73 0.00% 60 97 0.00% 61 95 0.00% 62 101 0.00% 63 111 0.00% 64 113 0.00% 65 117 0.00% 66 127 0.00% 67 150 0.00% 68 168 0.00% 69 177 0.00% 70 209 0.00% 71 252 0.00% 72 257 0.00% 73 296 0.00% 74 320 0.00% 75 351 0.00% 76 425 0.00% 77 419 0.00% 78 455 0.00% 79 555 0.00% 80 619 0.00% 81 652 0.00% 82 830 0.00% 83 899 0.00% 84 1092 0.00% 85 1181 0.00% 86 1241 0.00% 87 1372 0.00% 88 1482 0.00% 89 1661 0.00% 90 1885 0.01% 91 2054 0.01% 92 2355 0.01% 93 2742 0.01% 94 3047 0.01% 95 3419 0.01% 96 3658 0.01% 97 3905 0.01% 98 4208 0.01% 99 4466 0.01% 100 4990 0.01% 101 5366 0.01% 102 5903 0.02% 103 6578 0.02% 104 7137 0.02% 105 7711 0.02% 106 8138 0.02% 107 8368 0.02% 108 9040 0.02% 109 9669 0.03% 110 10088 0.03% 111 11110 0.03% 112 11866 0.03% 113 12666 0.03% 114 13741 0.04% 115 14736 0.04% 116 15501 0.04% 117 16085 0.04% 118 16731 0.04% 119 17081 0.05% 120 18252 0.05% 121 19242 0.05% 122 20411 0.05% 123 21714 0.06% 124 23583 0.06% 125 24627 0.07% 126 25840 0.07% 127 26814 0.07% 128 27438 0.07% 129 28461 0.08% 130 29557 0.08% 131 30256 0.08% 132 32133 0.09% 133 33682 0.09% 134 36184 0.10% 135 37853 0.10% 136 39217 0.10% 137 39592 0.11% 138 40624 0.11% 139 42271 0.11% 140 43500 0.12% 141 44544 0.12% 142 46806 0.12% 143 49097 0.13% 144 51014 0.14% 145 53246 0.14% 146 55621 0.15% 147 57414 0.15% 148 59022 0.16% 149 59711 0.16% 150 61049 0.16% 151 36221118 96.18% 37661432 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=6.30 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=4.0 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=22.29 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.4 sequence=TTTTTTTTAGTTAAACCAGGGCGATTTTATTTATGGGGGGTTACAAGCATGGCATGGGATGGCATGCATGCACCCGTACAAAGGGAAATAAGGGCCTAGCTTGTGCAGCTAGCCTTGGATCGGTTCATGGTAGCGGTAGATCGAGTAGCTATATGTAGATGGTCGTTGCATGCGTCCCTGGCATGCAAATTAAGCTGCTGCAGCAGATTGAGATCTAGCAGCTGCAGC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=27 prefix-density=0.94 prefix-fanout=1.7 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=269.72 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.3 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTT SRR8450161 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:45:42 Started mapping on | Dec 06 10:45:42 Finished on | Dec 06 10:52:37 Mapping speed, Million of reads per hour | 326.70 Number of input reads | 37661432 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 32690557 Uniquely mapped reads % | 86.80% Average mapped length | 299.10 Number of splices: Total | 32991969 Number of splices: Annotated (sjdb) | 30992966 Number of splices: GT/AG | 32542915 Number of splices: GC/AG | 381032 Number of splices: AT/AC | 18959 Number of splices: Non-canonical | 49063 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.64 Insertion rate per base | 0.01% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341119 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 23290 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.76% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4629756 4629756 4629756 N_multimapping 341119 341119 341119 N_noFeature 955133 31706694 1252734 N_ambiguous 823020 4933 137676 UnstrandedReadsAssigned:30912404 PositiveStrandReadsAssigned:978930 NegativeStrandReadsAssigned:31300147 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450161 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450161-trimmed-pair1.fastq SRR8450161-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,661,432 reads, 33,594,460 reads pseudoaligned [quant] estimated average fragment length: 298.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52973 SRR8450161.ke.tsv 35125 SRR8450161.se.tsv 88098 total ==> SRR8450161.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 639.151 0 0 PNS24247 1044 746.693 95.0447 4.8312 PNS24249 1928 1630.69 294.62 6.85742 PNS24246 1044 746.693 95.0447 4.8312 PNS24248 1044 746.693 95.0447 4.8312 PNS24244 1471 1173.69 88.2456 2.8537 PNS24243 293 79.1211 0 0 KQK14069 1603 1305.69 9483.03 275.661 KQK14071 474 208.71 9.63546 1.75226 ==> SRR8450161.se.tsv <== BRADI_1g14170v3 8932 BRADI_1g53295v3 206 BRADI_1g59795v3 323 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 515 BRADI_1g74790v3 169 BRADI_1g09890v3 1 BRADI_1g77505v3 577 BRADI_1g48960v3 0 SRR8450161 completed mapping pipeline successfully