Starting /dee2/code/volunteer_pipeline.sh SRR8450162 current disk space = 1551403155456 free memory = 1605434068 SRR8450162 SRAfilesize e3c84efb015b02a48b6503398e7ca8ec SRR8450162.sra SRR8450162.sra file validated SRR8450162 is paired end SRR8450162 is conventional basespace SRR8450162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1145 37.0 37.0 37.0 37.0 37.0 2 36.264 37.0 37.0 37.0 37.0 37.0 3 36.3245 37.0 37.0 37.0 37.0 37.0 4 36.427 37.0 37.0 37.0 37.0 37.0 5 36.4385 37.0 37.0 37.0 37.0 37.0 6 36.4835 37.0 37.0 37.0 37.0 37.0 7 36.38 37.0 37.0 37.0 37.0 37.0 8 36.419 37.0 37.0 37.0 37.0 37.0 9 36.507 37.0 37.0 37.0 37.0 37.0 10-14 36.4702 37.0 37.0 37.0 37.0 37.0 15-19 36.39699999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.432700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3497 37.0 37.0 37.0 37.0 37.0 30-34 36.3736 37.0 37.0 37.0 37.0 37.0 35-39 36.3299 37.0 37.0 37.0 37.0 37.0 40-44 36.3027 37.0 37.0 37.0 37.0 37.0 45-49 36.1311 37.0 37.0 37.0 37.0 37.0 50-54 36.152699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0284 37.0 37.0 37.0 37.0 37.0 60-64 35.9774 37.0 37.0 37.0 37.0 37.0 65-69 35.9374 37.0 37.0 37.0 37.0 37.0 70-74 36.108900000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.173700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.168600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.092 37.0 37.0 37.0 37.0 37.0 90-94 36.1255 37.0 37.0 37.0 37.0 37.0 95-99 36.1057 37.0 37.0 37.0 37.0 37.0 100-104 36.018100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0103 37.0 37.0 37.0 37.0 37.0 110-114 36.0133 37.0 37.0 37.0 37.0 37.0 115-119 35.9995 37.0 37.0 37.0 37.0 37.0 120-124 35.902699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8409 37.0 37.0 37.0 37.0 37.0 130-134 35.8446 37.0 37.0 37.0 37.0 37.0 135-139 35.8245 37.0 37.0 37.0 37.0 37.0 140-144 35.7574 37.0 37.0 37.0 37.0 37.0 145-149 35.715 37.0 37.0 37.0 37.0 37.0 150-151 35.171499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 2.0 25 8.0 26 4.0 27 7.0 28 19.0 29 23.0 30 33.0 31 42.0 32 84.0 33 131.0 34 133.0 35 352.0 36 2751.0 37 408.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.233048719236564 10.82370668006027 9.16624811652436 33.77699648417881 2 26.325 12.725 28.425 32.525 3 21.825 14.475 24.2 39.5 4 28.599999999999998 20.05 20.75 30.599999999999998 5 27.625 24.5 24.825 23.05 6 26.8 27.6 23.325000000000003 22.275 7 19.275000000000002 24.0 36.875 19.85 8 22.425 23.775 27.975 25.825 9 21.325 21.425 32.05 25.2 10-14 23.84 25.41 25.324999999999996 25.424999999999997 15-19 24.58 23.825 25.374999999999996 26.22 20-24 24.035 24.54 25.319999999999997 26.105 25-29 24.205 24.55 24.315 26.93 30-34 23.69 24.255 25.119999999999997 26.935 35-39 23.919999999999998 23.875 25.34 26.865 40-44 24.515 24.01 24.75 26.724999999999998 45-49 24.709999999999997 23.974999999999998 24.805 26.51 50-54 25.124999999999996 23.905 24.4 26.57 55-59 24.82 23.455000000000002 24.725 27.0 60-64 25.445 23.775 24.025 26.755000000000003 65-69 25.385 23.78 24.240000000000002 26.595000000000002 70-74 25.645 23.45 24.555 26.35 75-79 25.82 23.919999999999998 23.875 26.384999999999998 80-84 25.61 23.580000000000002 24.26 26.55 85-89 25.595000000000002 23.275000000000002 24.54 26.590000000000003 90-94 26.105 22.555 25.005 26.334999999999997 95-99 25.745 22.705000000000002 24.169999999999998 27.38 100-104 25.845000000000002 23.525 23.955000000000002 26.674999999999997 105-109 26.58 23.075000000000003 24.154999999999998 26.19 110-114 26.31 23.115 24.08 26.495 115-119 26.36 23.385 23.400000000000002 26.855 120-124 26.13 23.465 24.015 26.39 125-129 26.355 22.64 23.865 27.139999999999997 130-134 26.090000000000003 23.65 23.43 26.83 135-139 25.945 22.825 24.14 27.089999999999996 140-144 26.155 22.93 23.9 27.015 145-149 26.015 23.745 23.630000000000003 26.61 150-151 26.337500000000002 23.425 22.8 27.437499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 1.5 28 1.5 29 2.5 30 5.5 31 8.5 32 12.0 33 15.5 34 19.0 35 24.5 36 35.0 37 43.5 38 63.5 39 84.0 40 94.5 41 112.5 42 134.0 43 158.5 44 171.0 45 163.5 46 174.5 47 171.5 48 154.5 49 158.0 50 163.5 51 142.0 52 119.5 53 123.5 54 119.5 55 106.0 56 97.0 57 96.5 58 87.5 59 87.5 60 91.5 61 100.5 62 97.0 63 77.0 64 83.5 65 88.5 66 73.5 67 60.0 68 57.5 69 54.0 70 40.5 71 37.5 72 38.0 73 32.5 74 30.5 75 24.5 76 18.0 77 12.0 78 7.0 79 7.0 80 5.5 81 2.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.47130068457082 90.64999999999999 2 4.160084254870985 7.9 3 0.2632964718272775 0.75 4 0.0526592943654555 0.2 5 0.0 0.0 6 0.02632964718272775 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02632964718272775 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCATCACCATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 3 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCATCACCATCGCGTAT 6 0.15 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.6499999999999999 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.175 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.5125000000000002 0.0 0.0 0.0 0.0 134-135 1.7 0.0 0.0 0.0 0.0 136-137 1.9125 0.0 0.0 0.0 0.0 138-139 2.2125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGACGC 10 0.006830828 145.0 7 CCGTTGG 10 0.006830828 145.0 1 CGTTGGC 10 0.006830828 145.0 2 GACCCAT 10 0.006830828 145.0 1 CCGATCC 10 0.006830828 145.0 145 >>END_MODULE SRR8450162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8450162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.981 37.0 37.0 37.0 37.0 37.0 2 35.7415 37.0 37.0 37.0 37.0 37.0 3 35.581 37.0 37.0 37.0 37.0 37.0 4 35.6855 37.0 37.0 37.0 37.0 37.0 5 35.6045 37.0 37.0 37.0 37.0 37.0 6 35.5765 37.0 37.0 37.0 37.0 37.0 7 35.613 37.0 37.0 37.0 37.0 37.0 8 35.5555 37.0 37.0 37.0 37.0 37.0 9 35.5415 37.0 37.0 37.0 37.0 37.0 10-14 35.3868 37.0 37.0 37.0 37.0 37.0 15-19 35.401599999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.3559 37.0 37.0 37.0 37.0 37.0 25-29 35.165200000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.050599999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.1081 37.0 37.0 37.0 37.0 37.0 40-44 34.987399999999994 37.0 37.0 37.0 27.4 37.0 45-49 35.00189999999999 37.0 37.0 37.0 32.2 37.0 50-54 34.926 37.0 37.0 37.0 27.4 37.0 55-59 34.96050000000001 37.0 37.0 37.0 27.4 37.0 60-64 34.9784 37.0 37.0 37.0 25.0 37.0 65-69 34.9275 37.0 37.0 37.0 27.4 37.0 70-74 34.9091 37.0 37.0 37.0 27.4 37.0 75-79 34.87 37.0 37.0 37.0 25.0 37.0 80-84 34.816 37.0 37.0 37.0 25.0 37.0 85-89 34.947199999999995 37.0 37.0 37.0 25.0 37.0 90-94 34.951 37.0 37.0 37.0 25.0 37.0 95-99 35.0353 37.0 37.0 37.0 29.8 37.0 100-104 35.0106 37.0 37.0 37.0 25.0 37.0 105-109 35.029199999999996 37.0 37.0 37.0 27.4 37.0 110-114 34.910000000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.9037 37.0 37.0 37.0 25.0 37.0 120-124 34.903299999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.7863 37.0 37.0 37.0 25.0 37.0 130-134 34.7495 37.0 37.0 37.0 25.0 37.0 135-139 34.76950000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.439899999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.4965 37.0 37.0 37.0 25.0 37.0 150-151 33.726 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 21.0 15 15.0 16 14.0 17 9.0 18 2.0 19 14.0 20 12.0 21 13.0 22 22.0 23 25.0 24 31.0 25 33.0 26 23.0 27 19.0 28 18.0 29 28.0 30 37.0 31 59.0 32 74.0 33 122.0 34 244.0 35 588.0 36 2369.0 37 200.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 18.45 11.725 31.825 2 34.625 22.900000000000002 21.325 21.15 3 28.675 24.575 22.75 24.0 4 29.75 28.375 17.474999999999998 24.4 5 30.349999999999998 28.875 19.025 21.75 6 26.900000000000002 31.55 18.175 23.375 7 26.150000000000002 19.275000000000002 29.95 24.625 8 27.474999999999998 22.55 21.125 28.849999999999998 9 28.199999999999996 23.474999999999998 23.549999999999997 24.775 10-14 29.165000000000003 24.525 20.255000000000003 26.055 15-19 28.325 24.7 21.705 25.27 20-24 27.750000000000004 24.945 21.740000000000002 25.564999999999998 25-29 27.295 25.55 21.355 25.8 30-34 26.939999999999998 25.305 22.009999999999998 25.745 35-39 26.91 25.665 21.875 25.55 40-44 27.025 25.665 21.475 25.835 45-49 27.500000000000004 25.264999999999997 21.345 25.89 50-54 27.18 24.73 22.134999999999998 25.955000000000002 55-59 27.655 24.995 22.05 25.3 60-64 27.91 24.834999999999997 21.69 25.564999999999998 65-69 27.495000000000005 25.455 21.44 25.61 70-74 27.29 24.83 21.925 25.955000000000002 75-79 27.400000000000002 24.91 22.314999999999998 25.374999999999996 80-84 27.32 24.740000000000002 22.215 25.724999999999998 85-89 27.72 24.93 21.33 26.02 90-94 27.775 25.345000000000002 21.72 25.16 95-99 27.605 24.66 22.37 25.365 100-104 28.16 25.5 21.515 24.825 105-109 26.784999999999997 25.53 22.15 25.535000000000004 110-114 27.3 25.674999999999997 21.67 25.355 115-119 28.044999999999998 25.165 20.97 25.82 120-124 28.125 24.610000000000003 21.68 25.585 125-129 27.794999999999998 25.1 21.7 25.405 130-134 28.155 25.53 21.36 24.955 135-139 27.839999999999996 25.525 21.675 24.959999999999997 140-144 27.534999999999997 26.035000000000004 21.5 24.93 145-149 28.42 25.4 21.709999999999997 24.47 150-151 27.787499999999998 25.7875 21.325 25.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.5 4 2.0 5 1.5 6 2.5 7 1.5 8 0.0 9 0.0 10 1.0 11 2.0 12 3.0 13 2.5 14 1.0 15 1.0 16 2.0 17 1.5 18 1.0 19 2.0 20 1.5 21 2.0 22 2.5 23 2.5 24 2.5 25 1.5 26 4.0 27 4.5 28 4.5 29 6.5 30 5.5 31 6.5 32 10.5 33 14.0 34 16.5 35 17.0 36 29.5 37 43.0 38 54.5 39 72.5 40 89.5 41 97.0 42 115.0 43 124.0 44 125.5 45 141.5 46 136.5 47 138.0 48 153.0 49 161.0 50 140.0 51 126.0 52 127.5 53 114.0 54 121.5 55 123.5 56 103.0 57 97.5 58 98.5 59 90.5 60 87.5 61 93.0 62 94.0 63 88.0 64 80.0 65 81.0 66 79.5 67 68.5 68 66.5 69 72.5 70 66.5 71 59.0 72 60.0 73 53.0 74 48.0 75 35.5 76 21.5 77 17.0 78 11.5 79 8.5 80 5.0 81 2.5 82 3.0 83 3.5 84 2.5 85 1.5 86 2.5 87 3.0 88 4.0 89 3.5 90 3.5 91 4.5 92 2.0 93 1.5 94 1.0 95 0.0 96 0.5 97 1.0 98 1.5 99 2.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7184134489099 91.10000000000001 2 3.91384292093512 7.449999999999999 3 0.2626740215392698 0.75 4 0.052534804307853955 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026267402153926978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026267402153926978 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2 0.0 0.0 0.0 0.0 130-131 1.3250000000000002 0.0 0.0 0.0 0.0 132-133 1.5499999999999998 0.0 0.0 0.0 0.0 134-135 1.725 0.0 0.0 0.0 0.0 136-137 1.95 0.0 0.0 0.0 0.0 138-139 2.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGAAG 10 0.006830828 145.0 8 CCCCCCC 30 0.0014437955 24.166668 115-119 >>END_MODULE Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408072 spots for SRR8450162.sra Written 1408072 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra Read 1408053 spots for SRR8450162.sra Written 1408053 spots for SRR8450162.sra SRR ids: ['SRR8450162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s2wjx5da SRR8450162.sra spots: 28161079 blocks: [[1, 1408053], [1408054, 2816106], [2816107, 4224159], [4224160, 5632212], [5632213, 7040265], [7040266, 8448318], [8448319, 9856371], [9856372, 11264424], [11264425, 12672477], [12672478, 14080530], [14080531, 15488583], [15488584, 16896636], [16896637, 18304689], [18304690, 19712742], [19712743, 21120795], [21120796, 22528848], [22528849, 23936901], [23936902, 25344954], [25344955, 26753007], [26753008, 28161079]] SRR8450162 file size 9521165 SRR8450162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8450162 SRR8450162_1.fastq SRR8450162_2.fastq Input file: SRR8450162_1.fastq Paired file: SRR8450162_2.fastq trimmed: SRR8450162-trimmed-pair1.fastq, SRR8450162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:45:42 2024 >> started Fri Dec 6 10:46:14 2024 >> done (32.026s) 28161079 read pairs processed; of these: 63 ( 0.00%) short read pairs filtered out after trimming by size control 282930 ( 1.00%) empty read pairs filtered out after trimming by size control 27878086 (99.00%) read pairs available; of these: 1114731 ( 4.00%) trimmed read pairs available after processing 26763355 (96.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 6 0.00% 20 3 0.00% 21 9 0.00% 22 4 0.00% 23 6 0.00% 24 6 0.00% 25 10 0.00% 26 10 0.00% 27 11 0.00% 28 18 0.00% 29 12 0.00% 30 17 0.00% 31 14 0.00% 32 12 0.00% 33 16 0.00% 34 18 0.00% 35 28 0.00% 36 21 0.00% 37 20 0.00% 38 22 0.00% 39 22 0.00% 40 22 0.00% 41 18 0.00% 42 38 0.00% 43 31 0.00% 44 25 0.00% 45 36 0.00% 46 32 0.00% 47 19 0.00% 48 28 0.00% 49 33 0.00% 50 36 0.00% 51 40 0.00% 52 39 0.00% 53 40 0.00% 54 36 0.00% 55 54 0.00% 56 46 0.00% 57 55 0.00% 58 46 0.00% 59 54 0.00% 60 60 0.00% 61 67 0.00% 62 77 0.00% 63 74 0.00% 64 73 0.00% 65 81 0.00% 66 79 0.00% 67 99 0.00% 68 122 0.00% 69 97 0.00% 70 126 0.00% 71 133 0.00% 72 164 0.00% 73 175 0.00% 74 231 0.00% 75 225 0.00% 76 243 0.00% 77 290 0.00% 78 297 0.00% 79 357 0.00% 80 397 0.00% 81 479 0.00% 82 565 0.00% 83 599 0.00% 84 765 0.00% 85 807 0.00% 86 909 0.00% 87 988 0.00% 88 1101 0.00% 89 1233 0.00% 90 1390 0.00% 91 1638 0.01% 92 1697 0.01% 93 1892 0.01% 94 2213 0.01% 95 2532 0.01% 96 2718 0.01% 97 2896 0.01% 98 3304 0.01% 99 3488 0.01% 100 3824 0.01% 101 4248 0.02% 102 4506 0.02% 103 4952 0.02% 104 5333 0.02% 105 5836 0.02% 106 6169 0.02% 107 6692 0.02% 108 7168 0.03% 109 7676 0.03% 110 8059 0.03% 111 8607 0.03% 112 9277 0.03% 113 9844 0.04% 114 10540 0.04% 115 11342 0.04% 116 12023 0.04% 117 12434 0.04% 118 13096 0.05% 119 13895 0.05% 120 14653 0.05% 121 15397 0.06% 122 16050 0.06% 123 17007 0.06% 124 17912 0.06% 125 18990 0.07% 126 19758 0.07% 127 21003 0.08% 128 21609 0.08% 129 22685 0.08% 130 23225 0.08% 131 24390 0.09% 132 25336 0.09% 133 26445 0.09% 134 27690 0.10% 135 28865 0.10% 136 29999 0.11% 137 30888 0.11% 138 31447 0.11% 139 33026 0.12% 140 33991 0.12% 141 34710 0.12% 142 37026 0.13% 143 38092 0.14% 144 39323 0.14% 145 41178 0.15% 146 41944 0.15% 147 42872 0.15% 148 44740 0.16% 149 45882 0.16% 150 47383 0.17% 151 26763355 96.00% 27878086 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=20 prefix-density=0.66 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=32.55 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.85 fanout-score-rank=41 prefix-density=0.44 prefix-fanout=1.5 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=125.05 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.5 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTT SRR8450162 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:47:04 Started mapping on | Dec 06 10:47:04 Finished on | Dec 06 10:50:06 Mapping speed, Million of reads per hour | 551.43 Number of input reads | 27878086 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25693797 Uniquely mapped reads % | 92.16% Average mapped length | 299.36 Number of splices: Total | 27459956 Number of splices: Annotated (sjdb) | 25797880 Number of splices: GT/AG | 27091376 Number of splices: GC/AG | 320136 Number of splices: AT/AC | 11037 Number of splices: Non-canonical | 37407 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.85 Insertion rate per base | 0.01% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331907 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 37553 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.53% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1852382 1852382 1852382 N_multimapping 331907 331907 331907 N_noFeature 752619 24947367 952177 N_ambiguous 666205 4036 120783 UnstrandedReadsAssigned:24274973 PositiveStrandReadsAssigned:742394 NegativeStrandReadsAssigned:24620837 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR8450162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8450162-trimmed-pair1.fastq SRR8450162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,878,086 reads, 25,432,783 reads pseudoaligned [quant] estimated average fragment length: 304.684 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR8450162.ke.tsv 35125 SRR8450162.se.tsv 88098 total ==> SRR8450162.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 633.068 0 0 PNS24247 1044 740.316 45.9975 3.18043 PNS24249 1928 1624.32 189.502 5.97191 PNS24246 1044 740.316 45.9975 3.18043 PNS24248 1044 740.316 45.9975 3.18043 PNS24244 1471 1167.32 39.5053 1.73235 PNS24243 293 79.0825 0 0 KQK14069 1603 1299.32 7607.62 299.711 KQK14071 474 204.703 53.3638 13.3442 ==> SRR8450162.se.tsv <== BRADI_1g14170v3 7731 BRADI_1g53295v3 209 BRADI_1g59795v3 343 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 324 BRADI_1g74790v3 130 BRADI_1g09890v3 0 BRADI_1g77505v3 423 BRADI_1g48960v3 0 SRR8450162 completed mapping pipeline successfully