Starting /dee2/code/volunteer_pipeline.sh SRR8618214 current disk space = 1545421930496 free memory = 1598089212 SRR8618214 SRAfilesize 5799029b9380e3251f6b64dbc252b30f SRR8618214.sra SRR8618214.sra file validated SRR8618214 is paired end SRR8618214 is conventional basespace SRR8618214 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618214_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.924 34.0 31.0 34.0 31.0 34.0 2 33.22125 34.0 34.0 34.0 31.0 34.0 3 33.37075 34.0 34.0 34.0 31.0 34.0 4 35.47825 37.0 37.0 37.0 35.0 37.0 5 36.032 37.0 37.0 37.0 35.0 37.0 6 36.4215 37.0 37.0 37.0 35.0 37.0 7 35.88825 37.0 37.0 37.0 35.0 37.0 8 36.4035 37.0 37.0 37.0 35.0 37.0 9 38.37975 39.0 39.0 39.0 37.0 39.0 10-11 38.462 39.0 39.0 39.0 37.0 39.0 12-13 38.435375 39.0 39.0 39.0 37.0 39.0 14-15 40.127875 41.0 40.0 41.0 38.0 41.0 16-17 40.082750000000004 41.0 40.0 41.0 38.0 41.0 18-19 40.021375 41.0 40.0 41.0 38.0 41.0 20-21 39.926375 41.0 40.0 41.0 38.0 41.0 22-23 39.85825 41.0 40.0 41.0 38.0 41.0 24-25 39.764624999999995 41.0 40.0 41.0 37.0 41.0 26-27 39.622875 41.0 39.0 41.0 37.0 41.0 28-29 39.422125 40.5 39.0 41.0 36.5 41.0 30-31 39.227374999999995 40.0 39.0 41.0 36.0 41.0 32-33 39.165125 40.0 38.5 41.0 35.0 41.0 34-35 39.3725 40.5 39.0 41.0 36.0 41.0 36-37 39.391875 41.0 39.0 41.0 35.0 41.0 38-39 39.2685 41.0 39.0 41.0 35.0 41.0 40-41 39.05875 40.0 38.0 41.0 35.0 41.0 42-43 38.916250000000005 40.0 37.5 41.0 35.0 41.0 44-45 38.647375 40.0 37.0 41.0 35.0 41.0 46-47 38.37925 40.0 36.0 41.0 35.0 41.0 48-49 38.179874999999996 40.0 35.5 41.0 34.5 41.0 50-51 37.938500000000005 39.0 35.0 41.0 34.0 41.0 52-53 37.674125000000004 39.0 35.0 41.0 34.0 41.0 54-55 37.43725 38.5 35.0 41.0 33.5 41.0 56-57 37.1105 37.5 35.0 41.0 33.0 41.0 58-59 36.859625 37.0 35.0 40.0 33.0 41.0 60-61 36.54474999999999 36.0 35.0 40.0 33.0 41.0 62-63 36.312125 35.5 35.0 39.5 33.0 41.0 64-65 35.867125 35.0 35.0 39.0 32.0 41.0 66-67 35.614999999999995 35.0 35.0 39.0 31.5 41.0 68-69 35.267875000000004 35.0 34.0 37.5 31.5 40.0 70-71 35.12075 35.0 34.0 37.0 31.0 39.5 72-73 34.72775 35.0 34.0 36.5 31.0 39.0 74-75 34.381125 35.0 34.0 36.0 31.0 39.0 76-77 33.569625 34.5 33.0 35.0 29.5 37.0 78-79 33.93662500000001 35.0 33.5 35.0 30.0 37.0 80-81 33.969875 35.0 34.0 35.0 31.0 37.0 82-83 33.631625 35.0 33.0 35.0 29.5 36.0 84-85 33.498875 35.0 33.0 35.0 29.5 36.0 86-87 33.1275 35.0 33.0 35.0 29.0 35.5 88-89 32.966875 35.0 33.0 35.0 29.0 35.0 90-91 32.67375 35.0 33.0 35.0 28.0 35.0 92-93 32.429625 35.0 33.0 35.0 27.0 35.0 94-95 32.40625 35.0 33.0 35.0 27.0 35.0 96-97 32.123125 35.0 33.0 35.0 27.0 35.0 98-99 31.530250000000002 34.5 32.5 35.0 25.5 35.0 100 31.06725 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 8.0 28 16.0 29 40.0 30 52.0 31 108.0 32 93.0 33 153.0 34 267.0 35 433.0 36 775.0 37 954.0 38 929.0 39 169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.116378229245047 10.810132932029095 14.823175319789314 46.250313518936544 2 26.224999999999998 18.224999999999998 30.825000000000003 24.725 3 27.325 21.825 21.825 29.025000000000002 4 30.61594202898551 25.905797101449274 17.158385093167702 26.319875776397517 5 30.55 28.325 19.35 21.775 6 22.650000000000002 31.674999999999997 19.325 26.35 7 20.674999999999997 15.075 37.2 27.05 8 22.975 19.1 23.575 34.35 9 23.275000000000002 18.925 26.900000000000002 30.9 10-11 27.1125 26.5375 19.325 27.025 12-13 25.687500000000004 20.7875 24.474999999999998 29.049999999999997 14-15 25.874999999999996 23.125 23.35 27.650000000000002 16-17 26.8375 22.5 23.5 27.1625 18-19 25.900000000000002 24.349999999999998 22.2625 27.487499999999997 20-21 26.937499999999996 23.25 22.925 26.887499999999996 22-23 26.087500000000002 22.5625 23.5 27.85 24-25 26.25 23.4625 22.5625 27.725 26-27 26.4625 22.8875 23.2875 27.3625 28-29 26.637499999999996 22.925 23.05 27.3875 30-31 25.674999999999997 23.325000000000003 23.375 27.625 32-33 25.95 23.9125 22.425 27.712500000000002 34-35 26.75 23.025000000000002 22.975 27.250000000000004 36-37 25.7875 22.975 23.4875 27.750000000000004 38-39 26.687499999999996 24.1125 21.6875 27.5125 40-41 27.0 23.549999999999997 22.3875 27.0625 42-43 26.9625 23.1625 23.125 26.75 44-45 26.025 23.599999999999998 23.05 27.325 46-47 27.237499999999997 23.0125 22.912499999999998 26.8375 48-49 26.6 23.1125 22.575 27.712500000000002 50-51 26.5375 23.2375 21.6625 28.5625 52-53 26.8125 22.9375 23.075000000000003 27.175 54-55 25.7 23.7625 22.9625 27.575 56-57 26.2875 23.25 22.1 28.3625 58-59 26.387500000000003 23.1625 22.35 28.1 60-61 26.025 22.8625 23.775 27.3375 62-63 26.6125 23.225 22.95 27.212500000000002 64-65 26.625 23.0125 22.625 27.737499999999997 66-67 26.1 23.4125 22.2 28.287499999999998 68-69 27.3125 23.075000000000003 22.3125 27.3 70-71 26.0625 23.974999999999998 21.95 28.012500000000003 72-73 26.9625 22.125 23.1625 27.750000000000004 74-75 26.437500000000004 23.8125 23.175 26.575 76-77 27.0625 22.6875 23.1 27.150000000000002 78-79 25.837500000000002 22.8625 23.4875 27.8125 80-81 26.8375 23.1 22.787499999999998 27.275 82-83 27.1625 22.912499999999998 22.975 26.950000000000003 84-85 26.55 22.8875 23.5125 27.05 86-87 26.900000000000002 23.2125 22.1375 27.750000000000004 88-89 27.950000000000003 22.675 21.95 27.425 90-91 27.525 23.4125 22.9875 26.075 92-93 27.44582237254165 22.698233746711765 23.261931604659903 26.59401227608668 94-95 27.325 23.05 22.7 26.924999999999997 96-97 26.55 22.400000000000002 23.8125 27.237499999999997 98-99 28.3625 23.05 22.537499999999998 26.05 100 27.525 23.125 23.775 25.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 1.0 26 0.5 27 0.5 28 0.5 29 1.5 30 5.0 31 7.0 32 6.0 33 10.0 34 16.0 35 19.0 36 27.0 37 36.5 38 53.0 39 75.5 40 89.0 41 112.0 42 124.0 43 120.5 44 137.0 45 147.5 46 144.5 47 143.5 48 137.0 49 125.0 50 121.0 51 128.0 52 110.5 53 86.0 54 80.5 55 84.0 56 86.5 57 99.0 58 114.5 59 109.5 60 118.0 61 115.5 62 100.0 63 108.0 64 107.5 65 102.0 66 104.5 67 94.5 68 84.5 69 88.5 70 79.5 71 66.0 72 58.5 73 48.0 74 43.5 75 34.0 76 27.0 77 20.0 78 10.5 79 9.0 80 6.5 81 4.0 82 4.0 83 2.5 84 1.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 3.4000000000000004 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.21250000000000002 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618214 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618214_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72375 34.0 31.0 34.0 31.0 34.0 2 32.6155 34.0 31.0 34.0 31.0 34.0 3 33.1475 34.0 33.0 34.0 31.0 34.0 4 36.589 37.0 37.0 37.0 35.0 37.0 5 36.62275 37.0 37.0 37.0 35.0 37.0 6 36.63625 37.0 37.0 37.0 35.0 37.0 7 36.59975 37.0 37.0 37.0 35.0 37.0 8 36.64075 37.0 37.0 37.0 35.0 37.0 9 38.44225 39.0 39.0 39.0 37.0 39.0 10-11 38.38225 39.0 39.0 39.0 37.0 39.0 12-13 38.436375 39.0 39.0 39.0 37.0 39.0 14-15 40.1395 41.0 40.0 41.0 38.0 41.0 16-17 40.126374999999996 41.0 40.0 41.0 38.0 41.0 18-19 40.06325 41.0 40.0 41.0 38.0 41.0 20-21 39.968875 41.0 40.0 41.0 38.0 41.0 22-23 39.9745 41.0 40.0 41.0 38.0 41.0 24-25 39.829499999999996 41.0 40.0 41.0 37.5 41.0 26-27 39.731750000000005 41.0 40.0 41.0 37.0 41.0 28-29 39.641375 41.0 40.0 41.0 37.0 41.0 30-31 39.368375 40.5 39.0 41.0 36.0 41.0 32-33 39.397125 41.0 39.0 41.0 36.0 41.0 34-35 39.305875 41.0 39.0 41.0 35.5 41.0 36-37 39.060874999999996 40.0 38.0 41.0 35.0 41.0 38-39 38.907375 40.0 38.0 41.0 35.0 41.0 40-41 38.7155 40.0 38.0 41.0 35.0 41.0 42-43 38.413624999999996 40.0 37.0 41.0 34.0 41.0 44-45 38.237125 40.0 36.0 41.0 34.0 41.0 46-47 37.949 39.5 35.5 41.0 33.5 41.0 48-49 37.73350000000001 39.0 35.0 41.0 33.0 41.0 50-51 37.161625 38.5 34.5 40.0 33.0 40.5 52-53 37.247249999999994 38.5 35.0 40.0 33.0 41.0 54-55 37.340875 38.5 35.0 41.0 33.0 41.0 56-57 37.219625 37.5 35.0 41.0 33.0 41.0 58-59 36.903875 37.0 35.0 41.0 33.0 41.0 60-61 36.657125 36.0 35.0 40.0 33.0 41.0 62-63 36.372125 35.5 35.0 40.0 33.0 41.0 64-65 36.036249999999995 35.0 35.0 39.0 32.5 41.0 66-67 35.779250000000005 35.0 35.0 39.0 32.5 41.0 68-69 35.463499999999996 35.0 35.0 38.5 31.5 41.0 70-71 35.2025 35.0 34.5 37.0 31.0 40.0 72-73 34.892250000000004 35.0 34.0 37.0 31.0 39.0 74-75 34.679500000000004 35.0 34.0 36.0 31.0 39.0 76-77 34.176375 35.0 34.0 36.0 30.5 37.5 78-79 34.011625 35.0 34.0 35.0 30.0 37.0 80-81 33.821875000000006 35.0 34.0 35.0 29.5 37.0 82-83 33.700375 35.0 33.5 35.0 29.5 36.0 84-85 33.455625 35.0 33.0 35.0 29.5 36.0 86-87 33.189375 35.0 33.0 35.0 29.0 35.5 88-89 33.025375 35.0 33.0 35.0 29.0 35.0 90-91 32.773875000000004 35.0 33.0 35.0 28.0 35.0 92-93 32.28975 35.0 33.0 35.0 27.0 35.0 94-95 32.18075 35.0 32.5 35.0 27.0 35.0 96-97 31.790375 35.0 32.0 35.0 26.0 35.0 98-99 31.1545 34.0 31.5 35.0 24.0 35.0 100 30.83225 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 7.0 28 26.0 29 39.0 30 71.0 31 92.0 32 98.0 33 169.0 34 257.0 35 449.0 36 713.0 37 973.0 38 931.0 39 173.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.07150050352467 9.692849949647533 13.645518630412889 48.5901309164149 2 25.7 17.25 31.900000000000002 25.15 3 25.900000000000002 21.125 23.849999999999998 29.125 4 29.95 26.6 15.4 28.050000000000004 5 30.675 29.775000000000002 18.6 20.95 6 22.175 33.074999999999996 19.625 25.124999999999996 7 21.75 13.750000000000002 37.7 26.8 8 23.525 18.75 24.75 32.975 9 23.525 19.075 27.200000000000003 30.2 10-11 27.132849637227917 26.64498373780335 18.689016762571928 27.5331498623968 12-13 25.162499999999998 20.7125 25.7125 28.4125 14-15 26.400000000000002 22.875 23.375 27.35 16-17 26.937499999999996 21.825 22.75 28.487499999999997 18-19 26.150000000000002 23.175 23.0875 27.5875 20-21 26.650000000000002 22.4375 22.6375 28.275 22-23 26.325 22.75 22.625 28.299999999999997 24-25 26.150000000000002 23.7375 22.537499999999998 27.575 26-27 25.662499999999998 24.6 23.1625 26.575 28-29 26.625 23.3125 21.8125 28.249999999999996 30-31 26.087500000000002 22.525000000000002 23.6625 27.725 32-33 27.287499999999998 22.6375 23.05 27.025 34-35 26.687499999999996 22.7 23.25 27.3625 36-37 26.400000000000002 23.8375 22.662499999999998 27.1 38-39 26.0125 24.224999999999998 22.85 26.9125 40-41 26.087500000000002 23.474999999999998 22.4625 27.975 42-43 26.3625 22.6375 23.5 27.500000000000004 44-45 26.3125 23.175 22.55 27.962500000000002 46-47 26.25 23.2375 21.837500000000002 28.675 48-49 26.0625 23.525 23.1625 27.250000000000004 50-51 26.4125 22.9625 22.9625 27.6625 52-53 26.887499999999996 22.55 22.825 27.737499999999997 54-55 26.787499999999998 23.0625 23.325000000000003 26.825 56-57 27.474999999999998 22.5125 23.525 26.487500000000004 58-59 27.0625 22.5125 22.5125 27.9125 60-61 26.787499999999998 22.725 23.1625 27.325 62-63 27.325 22.5625 22.95 27.1625 64-65 26.025 23.7875 22.725 27.462500000000002 66-67 27.037499999999998 23.0 23.0625 26.900000000000002 68-69 27.6375 22.725 22.95 26.687499999999996 70-71 26.987499999999997 22.650000000000002 23.325000000000003 27.037499999999998 72-73 25.687500000000004 22.425 24.3625 27.525 74-75 26.937499999999996 22.8875 23.2375 26.937499999999996 76-77 26.8 23.45 22.4625 27.287499999999998 78-79 27.075 22.875 22.8625 27.187499999999996 80-81 27.05 23.25 22.6875 27.0125 82-83 27.9125 22.4875 22.400000000000002 27.200000000000003 84-85 27.287499999999998 23.0 22.1875 27.525 86-87 28.1 23.225 22.25 26.424999999999997 88-89 27.675 22.6875 22.05 27.5875 90-91 27.150000000000002 22.725 22.7125 27.4125 92-93 27.04190118824265 23.61475922451532 23.039399624765476 26.303939962476548 94-95 27.378422302787847 23.47793474184273 23.002875359419928 26.140767595949495 96-97 26.950000000000003 22.8625 23.549999999999997 26.637499999999996 98-99 27.875 22.925 23.200000000000003 26.0 100 29.025000000000002 21.625 22.900000000000002 26.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.5 27 0.5 28 1.5 29 2.5 30 3.5 31 5.0 32 8.5 33 11.0 34 12.0 35 21.5 36 30.5 37 43.5 38 57.5 39 65.5 40 81.5 41 106.5 42 116.5 43 121.0 44 138.0 45 148.5 46 142.5 47 135.0 48 142.0 49 138.0 50 119.5 51 111.5 52 109.5 53 99.0 54 93.5 55 96.5 56 94.5 57 89.5 58 91.5 59 109.0 60 125.5 61 109.5 62 110.5 63 116.0 64 99.5 65 99.5 66 100.5 67 96.5 68 91.5 69 83.0 70 74.0 71 65.0 72 49.0 73 42.5 74 46.5 75 37.5 76 25.0 77 22.5 78 18.0 79 13.5 80 7.0 81 4.5 82 5.5 83 2.5 84 2.5 85 1.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.075 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0625 94-95 0.0125 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09182643794148 98.2 2 0.9081735620585267 1.7999999999999998 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563078 spots for SRR8618214.sra Written 563078 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra Read 563064 spots for SRR8618214.sra Written 563064 spots for SRR8618214.sra SRR ids: ['SRR8618214.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8lrow7og SRR8618214.sra spots: 11261294 blocks: [[1, 563064], [563065, 1126128], [1126129, 1689192], [1689193, 2252256], [2252257, 2815320], [2815321, 3378384], [3378385, 3941448], [3941449, 4504512], [4504513, 5067576], [5067577, 5630640], [5630641, 6193704], [6193705, 6756768], [6756769, 7319832], [7319833, 7882896], [7882897, 8445960], [8445961, 9009024], [9009025, 9572088], [9572089, 10135152], [10135153, 10698216], [10698217, 11261294]] SRR8618214 file size 2930828 SRR8618214 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618214 SRR8618214_1.fastq SRR8618214_2.fastq Input file: SRR8618214_1.fastq Paired file: SRR8618214_2.fastq trimmed: SRR8618214-trimmed-pair1.fastq, SRR8618214-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:31:06 2024 >> started Sat Dec 7 06:31:27 2024 >> done (20.346s) 11261294 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11261294 (100.00%) read pairs available; of these: 1413907 (12.56%) trimmed read pairs available after processing 9847387 (87.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 78 1 0.00% 79 0 0.00% 80 0 0.00% 81 9 0.00% 82 36 0.00% 83 103 0.00% 84 5649 0.05% 85 6086 0.05% 86 6668 0.06% 87 7511 0.07% 88 8995 0.08% 89 11042 0.10% 90 18116 0.16% 91 32794 0.29% 92 46347 0.41% 93 63721 0.57% 94 84855 0.75% 95 109647 0.97% 96 143270 1.27% 97 197589 1.75% 98 285796 2.54% 99 385672 3.42% 100 9847387 87.44% 11261294 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=21 prefix-density=0.37 prefix-fanout=2.3 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=33 fanout-score=7.63 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.4 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=22 prefix-density=0.38 prefix-fanout=2.3 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=29 fanout-score=9.47 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.1 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618214 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:31:58 Started mapping on | Dec 07 06:31:58 Finished on | Dec 07 06:32:34 Mapping speed, Million of reads per hour | 1126.13 Number of input reads | 11261294 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11030004 Uniquely mapped reads % | 97.95% Average mapped length | 198.36 Number of splices: Total | 6576432 Number of splices: Annotated (sjdb) | 6252545 Number of splices: GT/AG | 6486191 Number of splices: GC/AG | 75053 Number of splices: AT/AC | 1940 Number of splices: Non-canonical | 13248 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 93036 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 5600 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 138254 138254 138254 N_multimapping 93036 93036 93036 N_noFeature 263560 5515217 5573001 N_ambiguous 248061 21147 22879 UnstrandedReadsAssigned:10518383 PositiveStrandReadsAssigned:5493640 NegativeStrandReadsAssigned:5434124 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618214 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618214-trimmed-pair1.fastq SRR8618214-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,261,294 reads, 10,720,436 reads pseudoaligned [quant] estimated average fragment length: 164.407 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52973 SRR8618214.ke.tsv 35125 SRR8618214.se.tsv 88098 total ==> SRR8618214.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.794 0 0 PNS24247 1044 880.593 21.448 3.07791 PNS24249 1928 1764.59 88.1723 6.3144 PNS24246 1044 880.593 21.448 3.07791 PNS24248 1044 880.593 21.448 3.07791 PNS24244 1471 1307.59 21.4839 2.07628 PNS24243 293 136.347 6 5.56097 KQK14069 1603 1439.59 5268.57 462.485 KQK14071 474 312.126 467.501 189.277 ==> SRR8618214.se.tsv <== BRADI_1g14170v3 6148 BRADI_1g53295v3 189 BRADI_1g59795v3 318 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 149 BRADI_1g74790v3 48 BRADI_1g09890v3 0 BRADI_1g77505v3 143 BRADI_1g48960v3 0 SRR8618214 completed mapping pipeline successfully