Starting /dee2/code/volunteer_pipeline.sh SRR8618215 current disk space = 1545407627264 free memory = 1598460860 SRR8618215 SRAfilesize a366d68b57f02153eef9428c3b0ba83f SRR8618215.sra SRR8618215.sra file validated SRR8618215 is paired end SRR8618215 is conventional basespace SRR8618215 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618215_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90425 34.0 31.0 34.0 31.0 34.0 2 33.1795 34.0 33.0 34.0 31.0 34.0 3 33.29075 34.0 34.0 34.0 31.0 34.0 4 35.416 37.0 37.0 37.0 35.0 37.0 5 35.95975 37.0 37.0 37.0 35.0 37.0 6 36.359 37.0 37.0 37.0 35.0 37.0 7 36.28725 37.0 37.0 37.0 35.0 37.0 8 36.46975 37.0 37.0 37.0 35.0 37.0 9 38.33625 39.0 39.0 39.0 37.0 39.0 10-11 38.42425 39.0 39.0 39.0 37.0 39.0 12-13 38.39725 39.0 39.0 39.0 37.0 39.0 14-15 39.962375 41.0 40.0 41.0 38.0 41.0 16-17 39.998 41.0 40.0 41.0 38.0 41.0 18-19 39.933375 41.0 40.0 41.0 38.0 41.0 20-21 39.858000000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.715625 41.0 40.0 41.0 37.5 41.0 24-25 39.5685 41.0 39.0 41.0 37.0 41.0 26-27 39.44775 40.5 39.0 41.0 36.5 41.0 28-29 39.279875000000004 40.0 39.0 41.0 36.0 41.0 30-31 39.013875 40.0 38.0 41.0 35.0 41.0 32-33 38.946375 40.0 38.0 41.0 35.0 41.0 34-35 39.102125 40.0 38.5 41.0 35.0 41.0 36-37 39.19325 41.0 38.5 41.0 35.0 41.0 38-39 39.04025 40.0 38.0 41.0 35.0 41.0 40-41 38.88275 40.0 37.5 41.0 35.0 41.0 42-43 38.5925 40.0 37.0 41.0 35.0 41.0 44-45 38.423249999999996 40.0 36.0 41.0 35.0 41.0 46-47 38.151375 40.0 35.5 41.0 34.0 41.0 48-49 37.894999999999996 39.0 35.0 41.0 34.0 41.0 50-51 37.65975 39.0 35.0 41.0 33.5 41.0 52-53 37.450125 38.5 35.0 41.0 33.0 41.0 54-55 37.088125000000005 37.5 35.0 41.0 33.0 41.0 56-57 36.802125 37.0 35.0 40.0 33.0 41.0 58-59 36.552 36.0 35.0 40.0 33.0 41.0 60-61 36.195 35.5 35.0 40.0 33.0 41.0 62-63 35.971374999999995 35.0 35.0 39.0 32.5 41.0 64-65 35.6565 35.0 35.0 39.0 32.0 41.0 66-67 35.41875 35.0 34.0 38.5 32.0 40.5 68-69 35.132999999999996 35.0 34.0 37.0 31.0 40.0 70-71 34.901125 35.0 34.0 37.0 31.5 39.0 72-73 34.56975 35.0 34.0 36.0 31.0 39.0 74-75 34.18925 35.0 33.5 35.5 30.0 38.0 76-77 33.40875 34.5 32.5 35.0 29.0 37.0 78-79 33.88525 35.0 33.5 35.0 30.0 37.0 80-81 33.820375 35.0 33.5 35.0 30.0 36.0 82-83 33.494875 35.0 33.0 35.0 30.0 36.0 84-85 33.406000000000006 35.0 33.0 35.0 29.5 36.0 86-87 33.225125000000006 35.0 33.0 35.0 29.5 35.0 88-89 33.040000000000006 35.0 33.0 35.0 29.0 35.0 90-91 32.702749999999995 35.0 33.0 35.0 28.5 35.0 92-93 32.273375 35.0 33.0 35.0 27.0 35.0 94-95 32.085499999999996 35.0 32.0 35.0 27.0 35.0 96-97 31.932250000000003 35.0 32.5 35.0 27.0 35.0 98-99 31.482374999999998 34.0 32.0 35.0 25.0 35.0 100 31.14725 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.06809583858763801 1101 2 -0.07923497267758961 1101 3 -0.03320722992853575 1101 4 -1.3102143757881421 1101 5 -0.6546868432114294 1101 6 -0.10361496427069739 1101 7 -0.34867591424968225 1101 8 -0.11123371164354978 1101 9 -0.08590794451450279 1101 10-11 -0.13611286254729293 1101 12-13 -0.14496637242538668 1101 14-15 0.0026796973518230516 1101 16-17 -0.04056326187473758 1101 18-19 -0.0419031105506491 1101 20-21 -0.08238755779738938 1101 22-23 -0.0751628835645235 1101 24-25 0.020649432534682433 1101 26-27 -0.0176282051282044 1101 28-29 0.003362757461118804 1101 30-31 0.09833438419503437 1101 32-33 0.08488335435056626 1101 34-35 0.09780895334174033 1101 36-37 0.11606767549390185 1101 38-39 0.036596258932320325 1101 40-41 0.06339323245061479 1101 42-43 0.19829760403531083 1101 44-45 0.20189680538041443 1101 46-47 0.187815258511975 1101 48-49 0.12907208911307322 1101 50-51 0.16453867171080105 1101 52-53 0.1418137873055869 1101 54-55 0.2223623371164294 1101 56-57 0.013293400588487714 1101 58-59 -0.07645018915510349 1101 60-61 0.055406683480455854 1101 62-63 -0.05052017654476515 1101 64-65 -0.2378100042034461 1101 66-67 -0.05354140395124318 1101 68-69 0.16903110550651235 1101 70-71 0.05301597309794204 1101 72-73 -0.0466319882303452 1101 74-75 -0.0478404791929421 1101 76-77 -0.053988020176547025 1101 78-79 -0.06378730559057999 1101 80-81 -0.0543295502311949 1101 82-83 0.005333123160994546 1101 84-85 0.18059058427910912 1101 86-87 -0.13634930643127774 1101 88-89 0.11118116855821825 1101 90-91 -0.15741908364859114 1101 92-93 0.06079234972677483 1101 94-95 0.07710697772173347 1101 96-97 0.02818936527953042 1101 98-99 -0.030553804119374917 1101 100 -0.02516813787305594 1104 1 0.06809583858764512 1104 2 0.07923497267759672 1104 3 0.03320722992854286 1104 4 1.3102143757881493 1104 5 0.6546868432114366 1104 6 0.10361496427070449 1104 7 0.34867591424968225 1104 8 0.11123371164354978 1104 9 0.08590794451450279 1104 10-11 0.13611286254728583 1104 12-13 0.14496637242539379 1104 14-15 -0.002679697351830157 1104 16-17 0.04056326187473758 1104 18-19 0.04190311055065621 1104 20-21 0.08238755779738938 1104 22-23 0.0751628835645235 1104 24-25 -0.020649432534675327 1104 26-27 0.0176282051282044 1104 28-29 -0.003362757461118804 1104 30-31 -0.09833438419504148 1104 32-33 -0.08488335435056626 1104 34-35 -0.09780895334174033 1104 36-37 -0.11606767549390895 1104 38-39 -0.036596258932320325 1104 40-41 -0.06339323245060768 1104 42-43 -0.19829760403531083 1104 44-45 -0.20189680538040733 1104 46-47 -0.1878152585119821 1104 48-49 -0.12907208911307322 1104 50-51 -0.16453867171080816 1104 52-53 -0.1418137873055869 1104 54-55 -0.2223623371164365 1104 56-57 -0.013293400588480608 1104 58-59 0.07645018915510349 1104 60-61 -0.055406683480455854 1104 62-63 0.05052017654476515 1104 64-65 0.2378100042034461 1104 66-67 0.05354140395123608 1104 68-69 -0.16903110550651945 1104 70-71 -0.05301597309794204 1104 72-73 0.0466319882303452 1104 74-75 0.04784047919293499 1104 76-77 0.053988020176547025 1104 78-79 0.06378730559057999 1104 80-81 0.054329550231187795 1104 82-83 -0.005333123160987441 1104 84-85 -0.18059058427910912 1104 86-87 0.13634930643127774 1104 88-89 -0.11118116855821114 1104 90-91 0.15741908364859114 1104 92-93 -0.06079234972677483 1104 94-95 -0.07710697772173347 1104 96-97 -0.028189365279523315 1104 98-99 0.03055380411937847 1104 100 0.02516813787305594 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 12.0 28 28.0 29 40.0 30 65.0 31 84.0 32 129.0 33 166.0 34 251.0 35 519.0 36 769.0 37 977.0 38 828.0 39 129.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.915058882485596 9.746930593836131 15.033826108744675 46.3041844149336 2 27.625 17.25 29.725 25.4 3 28.075 21.9 21.825 28.199999999999996 4 31.080031080031077 26.46982646982647 14.814814814814813 27.635327635327634 5 31.4 28.825 17.75 22.025 6 23.425 32.074999999999996 18.675 25.825 7 21.575 12.425 38.824999999999996 27.175 8 23.175 18.4 23.5 34.925 9 23.474999999999998 19.175 27.275 30.075000000000003 10-11 27.5875 25.937500000000004 18.912499999999998 27.5625 12-13 25.62820352544068 20.39004875609451 25.54069258657332 28.441055131891485 14-15 26.7625 22.662499999999998 22.8625 27.712500000000002 16-17 26.325 21.75 22.8875 29.037499999999998 18-19 27.1 22.4875 22.6875 27.725 20-21 26.900000000000002 22.95 22.55 27.6 22-23 26.775 22.7 22.375 28.15 24-25 27.35 22.7 21.525 28.425 26-27 27.737499999999997 22.912499999999998 21.975 27.375 28-29 27.737499999999997 22.575 21.8875 27.800000000000004 30-31 26.974999999999998 22.9375 22.0875 28.000000000000004 32-33 26.887499999999996 22.412499999999998 23.4375 27.2625 34-35 27.737499999999997 22.162499999999998 22.5125 27.5875 36-37 26.9125 23.2375 22.125 27.725 38-39 27.1375 23.0625 22.45 27.35 40-41 28.1 22.4375 21.6125 27.85 42-43 26.187500000000004 23.025000000000002 22.8 27.987499999999997 44-45 27.224999999999998 23.2625 22.625 26.887499999999996 46-47 28.175 22.45 22.225 27.150000000000002 48-49 27.1625 22.162499999999998 22.6 28.075 50-51 27.0125 23.4125 22.2 27.375 52-53 26.974999999999998 23.1125 21.525 28.3875 54-55 26.8 22.2125 22.75 28.237499999999997 56-57 27.075 22.8125 22.0625 28.050000000000004 58-59 28.15 22.25 21.6125 27.987499999999997 60-61 25.912499999999998 23.05 23.525 27.5125 62-63 27.474999999999998 22.7125 22.400000000000002 27.4125 64-65 27.325 23.1625 21.637500000000003 27.875 66-67 26.437500000000004 22.6125 23.2875 27.6625 68-69 27.425 22.112499999999997 22.75 27.712500000000002 70-71 27.987499999999997 21.375 22.5125 28.125 72-73 27.737499999999997 21.9 22.075 28.287499999999998 74-75 27.212500000000002 23.075000000000003 23.0125 26.700000000000003 76-77 26.55 22.3875 22.8875 28.175 78-79 27.375 22.1875 22.900000000000002 27.537499999999998 80-81 27.150000000000002 23.25 22.1875 27.4125 82-83 27.700000000000003 22.175 23.0125 27.1125 84-85 27.1 23.1375 22.2 27.5625 86-87 28.1125 22.55 22.6375 26.700000000000003 88-89 28.050000000000004 22.325 22.7 26.924999999999997 90-91 28.012500000000003 22.625 22.4875 26.875 92-93 27.964934251721978 22.442078897933627 22.654978083907327 26.938008766437072 94-95 28.769692423105774 22.918229557389346 22.443110777694425 25.868967241810452 96-97 26.724999999999998 22.8 22.55 27.925 98-99 28.1 22.8 22.9375 26.1625 100 26.700000000000003 22.45 22.625 28.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 2.0 30 3.0 31 4.5 32 6.0 33 10.5 34 12.0 35 15.5 36 25.5 37 33.5 38 47.0 39 62.0 40 73.0 41 95.5 42 113.0 43 120.0 44 131.5 45 133.0 46 125.5 47 128.5 48 125.5 49 117.0 50 119.0 51 113.5 52 105.0 53 96.5 54 87.0 55 84.5 56 87.0 57 91.5 58 108.0 59 124.5 60 137.0 61 132.5 62 119.0 63 107.0 64 111.0 65 125.5 66 121.5 67 113.5 68 110.5 69 103.0 70 81.0 71 70.5 72 64.0 73 52.5 74 44.0 75 30.5 76 22.0 77 15.5 78 9.5 79 8.5 80 6.0 81 5.0 82 3.0 83 1.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 3.4750000000000005 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.1875 94-95 0.025 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618215 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618215_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.32625 34.0 31.0 34.0 31.0 34.0 2 32.77875 34.0 31.0 34.0 31.0 34.0 3 33.079 34.0 33.0 34.0 31.0 34.0 4 36.5215 37.0 37.0 37.0 35.0 37.0 5 36.54275 37.0 37.0 37.0 35.0 37.0 6 36.5205 37.0 37.0 37.0 35.0 37.0 7 36.48475 37.0 37.0 37.0 35.0 37.0 8 36.5125 37.0 37.0 37.0 35.0 37.0 9 38.33325 39.0 39.0 39.0 37.0 39.0 10-11 38.318 39.0 39.0 39.0 37.0 39.0 12-13 38.32825 39.0 39.0 39.0 37.0 39.0 14-15 39.95375 41.0 40.0 41.0 38.0 41.0 16-17 39.980875 41.0 40.0 41.0 38.0 41.0 18-19 39.908375 41.0 40.0 41.0 38.0 41.0 20-21 39.8905 41.0 40.0 41.0 38.0 41.0 22-23 39.815625 41.0 40.0 41.0 37.5 41.0 24-25 39.6735 41.0 40.0 41.0 37.0 41.0 26-27 39.598375 41.0 39.5 41.0 37.0 41.0 28-29 39.422 41.0 39.0 41.0 36.0 41.0 30-31 39.309375 40.0 39.0 41.0 36.0 41.0 32-33 39.26175 40.5 39.0 41.0 35.0 41.0 34-35 39.14375 40.0 39.0 41.0 35.0 41.0 36-37 38.900125 40.0 38.0 41.0 35.0 41.0 38-39 38.6555 40.0 38.0 41.0 35.0 41.0 40-41 38.489000000000004 40.0 37.0 41.0 34.5 41.0 42-43 38.178 40.0 36.5 41.0 34.0 41.0 44-45 37.880875 39.0 35.5 41.0 33.0 41.0 46-47 37.6085 39.0 35.0 41.0 33.0 41.0 48-49 37.450375 39.0 35.0 41.0 33.0 41.0 50-51 36.8725 38.0 34.5 40.0 32.0 40.5 52-53 36.979375000000005 38.0 35.0 40.0 33.0 41.0 54-55 37.158 37.5 35.0 41.0 33.0 41.0 56-57 36.912 37.0 35.0 41.0 33.0 41.0 58-59 36.749125 36.5 35.0 40.0 33.0 41.0 60-61 36.485875 36.0 35.0 40.0 33.0 41.0 62-63 36.264625 35.0 35.0 39.0 33.0 41.0 64-65 35.974875 35.0 35.0 39.0 33.0 41.0 66-67 35.629374999999996 35.0 35.0 38.5 32.5 41.0 68-69 35.37375 35.0 35.0 37.0 32.5 40.0 70-71 35.048125 35.0 34.5 37.0 31.5 39.0 72-73 34.754875 35.0 34.0 36.0 31.0 39.0 74-75 34.517 35.0 34.0 36.0 31.0 39.0 76-77 34.196250000000006 35.0 34.0 35.0 30.5 37.0 78-79 33.82775 35.0 34.0 35.0 30.0 37.0 80-81 33.819 35.0 33.5 35.0 30.0 36.5 82-83 33.675 35.0 33.5 35.0 30.0 36.0 84-85 33.402625 35.0 33.0 35.0 29.5 36.0 86-87 33.232124999999996 35.0 33.0 35.0 29.0 35.0 88-89 33.083625 35.0 33.0 35.0 29.0 35.0 90-91 32.763374999999996 35.0 33.0 35.0 29.0 35.0 92-93 32.439875 35.0 33.0 35.0 27.0 35.0 94-95 32.330375000000004 35.0 33.0 35.0 27.0 35.0 96-97 32.003375 35.0 32.5 35.0 27.0 35.0 98-99 31.484375 34.5 32.0 35.0 25.0 35.0 100 31.0935 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.026166456494323143 1101 2 -0.2854140395124034 1101 3 -0.06389239176124306 1101 4 -0.03368011769651247 1101 5 0.02254098360656087 1101 6 0.009457755359392195 1101 7 -0.005044136191678206 1101 8 0.04576502732241039 1101 9 -0.06667717528373629 1101 10-11 -0.09244955863808713 1101 12-13 -0.08383249264397108 1101 14-15 0.03241908364859114 1101 16-17 -0.01839007986549035 1101 18-19 0.007697562000842595 1101 20-21 -0.04755149222361865 1101 22-23 -0.09103089533417119 1101 24-25 -0.16863703236654004 1101 26-27 -0.034179277007147846 1101 28-29 0.08328079024800417 1101 30-31 0.0703551912568301 1101 32-33 0.08362232030264494 1101 34-35 0.19475094577553165 1101 36-37 0.1736286254728867 1101 38-39 0.25935266918873623 1101 40-41 0.1669819251786464 1101 42-43 0.027637662883570613 1101 44-45 0.07710697772173347 1101 46-47 0.22598781000419876 1101 48-49 0.008117906683480669 1101 50-51 -0.09975304749895031 1101 52-53 0.02684951660361179 1101 54-55 0.007671290458176827 1101 56-57 0.08955968894493083 1101 58-59 0.20441887347624998 1101 60-61 0.19811370323665045 1101 62-63 0.10936843211433711 1101 64-65 -0.05729823455232719 1101 66-67 -0.21758091635140886 1101 68-69 -0.16204287515762417 1101 70-71 -0.1516130727196341 1101 72-73 -0.06189575451870155 1101 74-75 -0.31693989071038686 1101 76-77 -0.22929802437999314 1101 78-79 -0.2791876839008012 1101 80-81 -0.07166876839008296 1101 82-83 -0.016419714165614607 1101 84-85 -0.05535414039511721 1101 86-87 0.08871899957965468 1101 88-89 -0.036832702816312235 1101 90-91 -0.1205075662042816 1101 92-93 -0.138740016813788 1101 94-95 -0.2349464060529627 1101 96-97 -0.05761349306431285 1101 98-99 0.031814838167296244 1101 100 0.12147961328289014 1104 1 -0.026166456494330248 1104 2 0.2854140395124034 1104 3 0.06389239176124306 1104 4 0.03368011769651247 1104 5 -0.022540983606553766 1104 6 -0.009457755359392195 1104 7 0.005044136191678206 1104 8 -0.045765027322403284 1104 9 0.06667717528372918 1104 10-11 0.09244955863808713 1104 12-13 0.08383249264396397 1104 14-15 -0.032419083648598246 1104 16-17 0.01839007986549035 1104 18-19 -0.0076975620008354895 1104 20-21 0.04755149222362576 1104 22-23 0.0910308953341783 1104 24-25 0.16863703236654004 1104 26-27 0.034179277007147846 1104 28-29 -0.08328079024800417 1104 30-31 -0.0703551912568301 1104 32-33 -0.08362232030265204 1104 34-35 -0.19475094577553875 1104 36-37 -0.1736286254728867 1104 38-39 -0.2593526691887291 1104 40-41 -0.1669819251786464 1104 42-43 -0.027637662883563507 1104 44-45 -0.07710697772173347 1104 46-47 -0.22598781000419876 1104 48-49 -0.008117906683480669 1104 50-51 0.09975304749895031 1104 52-53 -0.02684951660361179 1104 54-55 -0.007671290458176827 1104 56-57 -0.08955968894493793 1104 58-59 -0.20441887347624998 1104 60-61 -0.19811370323665045 1104 62-63 -0.10936843211433711 1104 64-65 0.05729823455233429 1104 66-67 0.21758091635140175 1104 68-69 0.16204287515763127 1104 70-71 0.15161307271962698 1104 72-73 0.06189575451870866 1104 74-75 0.31693989071038686 1104 76-77 0.22929802437999314 1104 78-79 0.2791876839008012 1104 80-81 0.07166876839008296 1104 82-83 0.016419714165614607 1104 84-85 0.05535414039512432 1104 86-87 -0.08871899957966178 1104 88-89 0.03683270281630513 1104 90-91 0.12050756620428871 1104 92-93 0.13874001681378445 1104 94-95 0.2349464060529627 1104 96-97 0.05761349306431285 1104 98-99 -0.031814838167296244 1104 100 -0.1214796132828937 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 14.0 28 33.0 29 52.0 30 56.0 31 86.0 32 103.0 33 176.0 34 258.0 35 486.0 36 813.0 37 927.0 38 863.0 39 132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.366834170854272 8.492462311557789 13.99497487437186 49.14572864321608 2 28.375 18.0 28.775000000000002 24.85 3 28.875 21.375 21.2 28.549999999999997 4 29.975 26.6 16.0 27.425 5 31.15 28.000000000000004 19.075 21.775 6 23.65 31.624999999999996 18.95 25.775 7 23.028785982478098 14.042553191489363 35.59449311639549 27.334167709637047 8 23.35419274092616 19.549436795994993 23.103879849812266 33.99249061326658 9 22.811405702851424 18.284142071035518 27.66383191595798 31.240620310155077 10-11 27.597849193447544 25.97223958984619 18.281855695885955 28.148055520820307 12-13 24.5625 19.412499999999998 26.0125 30.012499999999996 14-15 26.375 22.0625 23.674999999999997 27.8875 16-17 26.724999999999998 21.475 22.5625 29.2375 18-19 26.8125 22.912499999999998 22.275 28.000000000000004 20-21 26.9125 22.412499999999998 22.125 28.549999999999997 22-23 27.975 22.2125 21.55 28.262500000000003 24-25 26.387500000000003 22.912499999999998 22.400000000000002 28.299999999999997 26-27 27.237499999999997 22.6125 23.0 27.150000000000002 28-29 26.5625 22.625 22.3 28.512500000000003 30-31 25.7 23.4625 23.0125 27.825 32-33 26.75 22.775000000000002 22.3 28.175 34-35 27.325 21.4375 22.9375 28.299999999999997 36-37 27.425 22.025 22.4625 28.0875 38-39 27.462500000000002 23.225 22.0875 27.224999999999998 40-41 28.1 21.7375 22.3375 27.825 42-43 26.55 22.7625 23.4125 27.275 44-45 26.8125 23.0625 22.35 27.775 46-47 27.3875 22.625 21.6625 28.325 48-49 27.375 21.912499999999998 23.05 27.6625 50-51 26.4625 23.0125 22.287499999999998 28.237499999999997 52-53 27.1 21.4875 22.287499999999998 29.125 54-55 26.275 22.475 23.575 27.675 56-57 27.1625 22.725 22.3125 27.800000000000004 58-59 27.1625 22.15 22.825 27.8625 60-61 27.200000000000003 22.9625 22.45 27.3875 62-63 26.724999999999998 23.2375 22.5 27.537499999999998 64-65 27.6625 22.0 22.275 28.0625 66-67 27.224999999999998 22.9375 22.475 27.3625 68-69 26.487500000000004 23.175 23.0625 27.275 70-71 28.175 22.075 21.9625 27.787499999999998 72-73 27.175 21.9625 23.1375 27.725 74-75 27.987499999999997 22.412499999999998 22.925 26.674999999999997 76-77 27.675 21.05 22.9375 28.3375 78-79 27.3375 21.7875 23.375 27.500000000000004 80-81 28.65 22.875 21.85 26.625 82-83 27.237499999999997 22.5625 22.1875 28.012500000000003 84-85 26.674999999999997 22.725 22.6 28.000000000000004 86-87 26.450000000000003 22.85 23.5875 27.1125 88-89 28.9375 21.8 22.8 26.4625 90-91 27.650000000000002 22.35 22.425 27.575 92-93 27.547830436413655 23.42128298111792 22.170814055270725 26.860072527197698 94-95 28.59107388423553 22.42780347543443 21.665208151018877 27.315914489311165 96-97 27.55 22.400000000000002 22.4375 27.6125 98-99 27.55 22.9625 23.1875 26.3 100 27.800000000000004 21.925 22.225 28.050000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 0.0 29 0.0 30 1.5 31 4.5 32 8.0 33 12.5 34 14.0 35 19.5 36 26.5 37 33.5 38 45.5 39 68.0 40 76.5 41 81.5 42 103.5 43 120.0 44 128.0 45 126.5 46 121.0 47 124.5 48 134.0 49 132.0 50 121.0 51 113.5 52 114.0 53 100.0 54 81.0 55 81.0 56 86.5 57 94.0 58 105.5 59 116.5 60 116.5 61 109.5 62 121.0 63 125.5 64 115.0 65 126.5 66 128.5 67 119.5 68 110.0 69 90.5 70 83.5 71 75.5 72 57.5 73 50.5 74 48.5 75 33.0 76 21.0 77 18.5 78 17.0 79 14.0 80 9.5 81 6.0 82 3.0 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.125 8 0.125 9 0.05 10-11 0.0375 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0375 94-95 0.0125 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7571933366986371 1.5 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557762 spots for SRR8618215.sra Written 557762 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra Read 557752 spots for SRR8618215.sra Written 557752 spots for SRR8618215.sra SRR ids: ['SRR8618215.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_swjf6_sf SRR8618215.sra spots: 11155050 blocks: [[1, 557752], [557753, 1115504], [1115505, 1673256], [1673257, 2231008], [2231009, 2788760], [2788761, 3346512], [3346513, 3904264], [3904265, 4462016], [4462017, 5019768], [5019769, 5577520], [5577521, 6135272], [6135273, 6693024], [6693025, 7250776], [7250777, 7808528], [7808529, 8366280], [8366281, 8924032], [8924033, 9481784], [9481785, 10039536], [10039537, 10597288], [10597289, 11155050]] SRR8618215 file size 2903072 SRR8618215 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618215 SRR8618215_1.fastq SRR8618215_2.fastq Input file: SRR8618215_1.fastq Paired file: SRR8618215_2.fastq trimmed: SRR8618215-trimmed-pair1.fastq, SRR8618215-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:31:45 2024 >> started Sat Dec 7 06:31:55 2024 >> done (10.897s) 11155050 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11155050 (100.00%) read pairs available; of these: 1459038 (13.08%) trimmed read pairs available after processing 9696012 (86.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 77 1 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 9 0.00% 82 26 0.00% 83 110 0.00% 84 5532 0.05% 85 5875 0.05% 86 6432 0.06% 87 7413 0.07% 88 8879 0.08% 89 11127 0.10% 90 18104 0.16% 91 33467 0.30% 92 47725 0.43% 93 66029 0.59% 94 88027 0.79% 95 113330 1.02% 96 149027 1.34% 97 205177 1.84% 98 295127 2.65% 99 397621 3.56% 100 9696012 86.92% 11155050 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=28 prefix-density=0.47 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=29 fanout-score=7.64 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=4.5 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=27 prefix-density=0.47 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.30 sequence-density-rank=7 fanout-score=7.82 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=3.5 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618215 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:32:32 Started mapping on | Dec 07 06:32:32 Finished on | Dec 07 06:33:15 Mapping speed, Million of reads per hour | 933.91 Number of input reads | 11155050 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10926027 Uniquely mapped reads % | 97.95% Average mapped length | 198.35 Number of splices: Total | 6170187 Number of splices: Annotated (sjdb) | 5888373 Number of splices: GT/AG | 6088824 Number of splices: GC/AG | 67571 Number of splices: AT/AC | 1477 Number of splices: Non-canonical | 12315 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 94384 % of reads mapped to multiple loci | 0.85% Number of reads mapped to too many loci | 8127 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 134639 134639 134639 N_multimapping 94384 94384 94384 N_noFeature 203181 5441731 5488886 N_ambiguous 241027 21380 22341 UnstrandedReadsAssigned:10481819 PositiveStrandReadsAssigned:5462916 NegativeStrandReadsAssigned:5414800 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618215 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618215-trimmed-pair1.fastq SRR8618215-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,155,050 reads, 10,666,398 reads pseudoaligned [quant] estimated average fragment length: 163.111 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52973 SRR8618215.ke.tsv 35125 SRR8618215.se.tsv 88098 total ==> SRR8618215.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.99 0 0 PNS24247 1044 881.889 21.4045 2.96099 PNS24249 1928 1765.89 70.6688 4.88215 PNS24246 1044 881.889 21.4045 2.96099 PNS24248 1044 881.889 21.4045 2.96099 PNS24244 1471 1308.89 11.1178 1.03625 PNS24243 293 136.9 4 3.56454 KQK14069 1603 1440.89 4495.64 380.634 KQK14071 474 313.089 403.826 157.352 ==> SRR8618215.se.tsv <== BRADI_1g14170v3 5128 BRADI_1g53295v3 126 BRADI_1g59795v3 180 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 200 BRADI_1g74790v3 63 BRADI_1g09890v3 1 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR8618215 completed mapping pipeline successfully