Starting /dee2/code/volunteer_pipeline.sh SRR8618216 current disk space = 1545062699008 free memory = 1597640712 SRR8618216 SRAfilesize 3dcf4451454ab7728f04e5b31b26b1d7 SRR8618216.sra SRR8618216.sra file validated SRR8618216 is paired end SRR8618216 is conventional basespace SRR8618216 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618216_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98375 34.0 31.0 34.0 31.0 34.0 2 33.20625 34.0 33.0 34.0 31.0 34.0 3 33.32925 34.0 34.0 34.0 31.0 34.0 4 35.4695 37.0 37.0 37.0 35.0 37.0 5 35.98675 37.0 37.0 37.0 35.0 37.0 6 36.4385 37.0 37.0 37.0 35.0 37.0 7 36.23 37.0 37.0 37.0 35.0 37.0 8 36.4475 37.0 37.0 37.0 35.0 37.0 9 38.36475 39.0 39.0 39.0 37.0 39.0 10-11 38.42325 39.0 39.0 39.0 37.0 39.0 12-13 38.392875000000004 39.0 39.0 39.0 37.0 39.0 14-15 40.00875 41.0 40.0 41.0 38.0 41.0 16-17 39.945875 41.0 40.0 41.0 38.0 41.0 18-19 39.91975 41.0 40.0 41.0 38.0 41.0 20-21 39.859125 41.0 40.0 41.0 38.0 41.0 22-23 39.67937499999999 41.0 39.5 41.0 37.0 41.0 24-25 39.56525 41.0 39.5 41.0 37.0 41.0 26-27 39.445 41.0 39.0 41.0 36.5 41.0 28-29 39.332750000000004 40.0 39.0 41.0 36.0 41.0 30-31 39.065 40.0 38.0 41.0 35.5 41.0 32-33 39.011750000000006 40.0 38.0 41.0 35.0 41.0 34-35 39.217749999999995 40.5 38.5 41.0 35.0 41.0 36-37 39.23524999999999 41.0 39.0 41.0 35.0 41.0 38-39 39.051874999999995 40.0 38.0 41.0 35.0 41.0 40-41 38.890375 40.0 38.0 41.0 35.0 41.0 42-43 38.653125 40.0 37.0 41.0 35.0 41.0 44-45 38.451625 40.0 36.5 41.0 35.0 41.0 46-47 38.202125 40.0 35.5 41.0 34.0 41.0 48-49 38.033 39.5 35.0 41.0 34.0 41.0 50-51 37.772375 39.0 35.0 41.0 34.0 41.0 52-53 37.496875 39.0 35.0 41.0 33.0 41.0 54-55 37.161 38.0 35.0 41.0 33.0 41.0 56-57 36.935 37.0 35.0 40.5 33.0 41.0 58-59 36.712 36.5 35.0 40.0 33.0 41.0 60-61 36.333 36.0 35.0 40.0 33.0 41.0 62-63 36.080875 35.0 35.0 39.5 32.5 41.0 64-65 35.755750000000006 35.0 35.0 39.0 31.5 41.0 66-67 35.534 35.0 34.5 38.5 31.5 41.0 68-69 35.223 35.0 34.0 37.0 31.5 40.0 70-71 34.926 35.0 34.0 37.0 31.0 39.5 72-73 34.630875 35.0 34.0 36.5 31.0 39.0 74-75 34.416125 35.0 34.0 36.0 31.0 39.0 76-77 33.542625 34.5 32.5 35.0 29.5 37.0 78-79 33.840875 35.0 33.0 35.0 30.0 37.0 80-81 33.886624999999995 35.0 33.5 35.0 30.5 36.5 82-83 33.559375 35.0 33.0 35.0 29.5 36.0 84-85 33.454 35.0 33.0 35.0 29.5 36.0 86-87 33.148375 35.0 33.0 35.0 29.0 36.0 88-89 33.031875 35.0 33.0 35.0 29.0 35.0 90-91 32.783375 35.0 33.0 35.0 29.0 35.0 92-93 32.371875 35.0 33.0 35.0 27.0 35.0 94-95 32.14175 35.0 32.5 35.0 27.0 35.0 96-97 32.025999999999996 35.0 32.5 35.0 27.0 35.0 98-99 31.505 34.0 32.0 35.0 26.0 35.0 100 31.157 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.1509807359903803 1101 2 -0.0941907362408898 1101 3 0.002905884415937976 1101 4 -1.519652295899192 1101 5 -0.7763972043387852 1101 6 -0.26682782634835434 1101 7 -0.3518249455146645 1101 8 -0.17375184749116812 1101 9 -0.0407825847340888 1101 10-11 0.02913399634259406 1101 12-13 0.05271925649439879 1101 14-15 0.08682582229013747 1101 16-17 0.07162629324381697 1101 18-19 0.10250757784513809 1101 20-21 0.05890052356021158 1101 22-23 0.1665121871790305 1101 24-25 0.12575465317267032 1101 26-27 -0.12861043613317236 1101 28-29 -0.07530875021919314 1101 30-31 -0.03170169593426664 1101 32-33 -0.1908614945264162 1101 34-35 -0.10389163055186401 1101 36-37 -0.17791026829329581 1101 38-39 0.05507402490042779 1101 40-41 0.008786542749071202 1101 42-43 -0.06886445051228662 1101 44-45 0.09650792855531876 1101 46-47 -0.03175806007164539 1101 48-49 -0.08531651594478973 1101 50-51 -0.022833738320095165 1101 52-53 -0.029772789899546126 1101 54-55 -0.031231994789450823 1101 56-57 0.007534006362881485 1101 58-59 0.11402464991608241 1101 60-61 0.16049374984343245 1101 62-63 0.19157544026653994 1101 64-65 0.20070643052181225 1101 66-67 0.1838598161276579 1101 68-69 0.16603622335229318 1101 70-71 0.1949009243718578 1101 72-73 0.08463388361432322 1101 74-75 0.13955760414840057 1101 76-77 -0.02254565495127281 1101 78-79 0.05762919912822895 1101 80-81 0.12785265161952708 1101 82-83 0.14050953180189651 1101 84-85 0.13908164032164905 1101 86-87 -0.06684786693053724 1101 88-89 0.09198000951927554 1101 90-91 -0.013170420100699687 1101 92-93 -0.1748478168290788 1101 94-95 -0.17713369573386473 1101 96-97 -0.09276284476063523 1101 98-99 -0.09002605275682996 1101 100 -0.31492522357774533 1104 1 0.1509807359903803 1104 2 0.0941907362408827 1104 3 -0.0029058844159450814 1104 4 1.5196522958991991 1104 5 0.7763972043387923 1104 6 0.26682782634836144 1104 7 0.3518249455146716 1104 8 0.17375184749116812 1104 9 0.0407825847340888 1104 10-11 -0.02913399634259406 1104 12-13 -0.0527192564944059 1104 14-15 -0.08682582229013747 1104 16-17 -0.07162629324381697 1104 18-19 -0.10250757784513098 1104 20-21 -0.05890052356021158 1104 22-23 -0.1665121871790376 1104 24-25 -0.12575465317267742 1104 26-27 0.12861043613316525 1104 28-29 0.07530875021919314 1104 30-31 0.03170169593426664 1104 32-33 0.19086149452642331 1104 34-35 0.10389163055186401 1104 36-37 0.1779102682932887 1104 38-39 -0.05507402490042068 1104 40-41 -0.008786542749071202 1104 42-43 0.06886445051229373 1104 44-45 -0.09650792855532586 1104 46-47 0.03175806007164539 1104 48-49 0.08531651594478262 1104 50-51 0.022833738320095165 1104 52-53 0.029772789899546126 1104 54-55 0.031231994789443718 1104 56-57 -0.007534006362881485 1104 58-59 -0.1140246499160753 1104 60-61 -0.16049374984343245 1104 62-63 -0.19157544026653994 1104 64-65 -0.20070643052180515 1104 66-67 -0.1838598161276579 1104 68-69 -0.16603622335228607 1104 70-71 -0.1949009243718507 1104 72-73 -0.08463388361432322 1104 74-75 -0.13955760414840057 1104 76-77 0.022545654951279914 1104 78-79 -0.05762919912823605 1104 80-81 -0.12785265161953419 1104 82-83 -0.14050953180190362 1104 84-85 -0.13908164032164905 1104 86-87 0.06684786693053724 1104 88-89 -0.09198000951927554 1104 90-91 0.013170420100699687 1104 92-93 0.1748478168290788 1104 94-95 0.17713369573386473 1104 96-97 0.09276284476064234 1104 98-99 0.09002605275683351 1104 100 0.31492522357774533 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 9.0 28 17.0 29 41.0 30 66.0 31 94.0 32 136.0 33 187.0 34 242.0 35 456.0 36 782.0 37 930.0 38 882.0 39 156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.78056112224449 10.420841683366733 15.00501002004008 46.7935871743487 2 26.525 17.275 30.85 25.35 3 27.500000000000004 22.1 21.925 28.475 4 30.743330743330745 27.169127169127172 15.255115255115257 26.83242683242683 5 31.0 28.725 18.099999999999998 22.175 6 22.75 31.624999999999996 20.3 25.324999999999996 7 20.1 15.275 37.05 27.575 8 22.625 19.475 23.325000000000003 34.575 9 23.1 18.35 27.375 31.175000000000004 10-11 27.287499999999998 26.2125 18.712500000000002 27.787499999999998 12-13 25.1875 21.4 24.9375 28.475 14-15 26.075 23.5 24.087500000000002 26.337500000000002 16-17 26.85 22.95 22.3 27.900000000000002 18-19 25.55 23.3 23.4375 27.712500000000002 20-21 26.8625 23.875 21.475 27.787499999999998 22-23 27.35 22.85 22.2625 27.537499999999998 24-25 27.075 22.675 22.45 27.800000000000004 26-27 27.187499999999996 21.912499999999998 23.0 27.900000000000002 28-29 26.75 22.825 22.525000000000002 27.900000000000002 30-31 26.137500000000003 23.025000000000002 23.200000000000003 27.6375 32-33 26.625 23.5125 22.6375 27.224999999999998 34-35 27.05 22.287499999999998 22.775000000000002 27.8875 36-37 27.750000000000004 23.0875 22.5125 26.650000000000002 38-39 26.387500000000003 23.3125 22.900000000000002 27.400000000000002 40-41 27.425 23.1625 23.4375 25.974999999999998 42-43 26.387500000000003 22.8125 23.5375 27.2625 44-45 26.674999999999997 23.2875 23.2375 26.8 46-47 26.8625 23.150000000000002 22.037499999999998 27.950000000000003 48-49 26.575 22.3625 22.925 28.1375 50-51 26.325 23.125 22.787499999999998 27.762500000000003 52-53 27.8375 22.625 22.025 27.5125 54-55 25.637500000000003 23.400000000000002 23.025000000000002 27.9375 56-57 26.775 22.912499999999998 22.25 28.0625 58-59 27.150000000000002 22.825 22.162499999999998 27.8625 60-61 26.650000000000002 23.0 23.200000000000003 27.150000000000002 62-63 26.625 22.787499999999998 22.4625 28.125 64-65 27.474999999999998 22.7125 21.975 27.8375 66-67 25.587500000000002 23.175 23.0875 28.15 68-69 27.825 21.375 23.6125 27.187499999999996 70-71 27.3 21.775 22.6375 28.287499999999998 72-73 26.375 22.675 23.625 27.325 74-75 27.474999999999998 23.325000000000003 21.8625 27.3375 76-77 27.650000000000002 22.675 22.05 27.625 78-79 27.1625 22.625 23.175 27.037499999999998 80-81 27.6875 22.35 22.6375 27.325 82-83 27.6 21.9625 22.6875 27.750000000000004 84-85 27.0 22.3375 22.975 27.6875 86-87 28.449999999999996 22.912499999999998 21.4875 27.150000000000002 88-89 27.787499999999998 21.75 22.875 27.5875 90-91 26.924999999999997 22.412499999999998 23.7125 26.950000000000003 92-93 27.099762172987855 22.65615220928777 23.49480535736638 26.749280260357995 94-95 28.40710177544386 23.305826456614152 21.567891972993248 26.71917979494874 96-97 27.487499999999997 23.2875 22.0625 27.1625 98-99 28.775000000000002 22.675 22.5875 25.9625 100 26.424999999999997 23.075000000000003 23.175 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 1.5 27 1.5 28 2.0 29 4.5 30 6.0 31 5.0 32 6.0 33 6.5 34 13.0 35 24.5 36 29.0 37 40.0 38 59.5 39 65.5 40 73.0 41 97.5 42 121.0 43 125.5 44 131.5 45 135.5 46 132.5 47 130.5 48 120.0 49 119.0 50 113.0 51 113.5 52 112.5 53 96.5 54 90.0 55 93.0 56 88.0 57 94.0 58 108.5 59 111.5 60 115.5 61 111.5 62 114.5 63 132.0 64 132.5 65 110.5 66 108.0 67 113.0 68 94.5 69 80.0 70 76.0 71 65.0 72 55.5 73 51.0 74 43.5 75 35.5 76 27.5 77 18.5 78 12.0 79 7.5 80 5.5 81 4.0 82 4.5 83 4.5 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 3.4750000000000005 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.13749999999999998 94-95 0.025 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01465386558868 97.975 2 0.9095502779181406 1.7999999999999998 3 0.07579585649317837 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618216 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618216_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.595 34.0 31.0 34.0 31.0 34.0 2 32.8385 34.0 31.0 34.0 31.0 34.0 3 33.00525 34.0 33.0 34.0 31.0 34.0 4 36.51175 37.0 37.0 37.0 35.0 37.0 5 36.55225 37.0 37.0 37.0 35.0 37.0 6 36.5605 37.0 37.0 37.0 35.0 37.0 7 36.472 37.0 37.0 37.0 35.0 37.0 8 36.49175 37.0 37.0 37.0 35.0 37.0 9 38.319 39.0 39.0 39.0 37.0 39.0 10-11 38.33775 39.0 39.0 39.0 37.0 39.0 12-13 38.3605 39.0 39.0 39.0 37.0 39.0 14-15 40.009249999999994 41.0 40.0 41.0 38.0 41.0 16-17 39.987875 41.0 40.0 41.0 38.0 41.0 18-19 39.929500000000004 41.0 40.0 41.0 38.0 41.0 20-21 39.885875 41.0 40.0 41.0 38.0 41.0 22-23 39.831625 41.0 40.0 41.0 38.0 41.0 24-25 39.72925 41.0 40.0 41.0 37.0 41.0 26-27 39.592375000000004 41.0 39.5 41.0 36.5 41.0 28-29 39.357625 40.5 39.0 41.0 36.0 41.0 30-31 39.19825 40.0 39.0 41.0 35.0 41.0 32-33 39.195499999999996 40.0 39.0 41.0 35.0 41.0 34-35 39.173625 40.0 38.5 41.0 35.0 41.0 36-37 38.977999999999994 40.0 38.0 41.0 35.0 41.0 38-39 38.791375 40.0 38.0 41.0 35.0 41.0 40-41 38.554249999999996 40.0 37.0 41.0 35.0 41.0 42-43 38.290875 40.0 37.0 41.0 34.0 41.0 44-45 38.013875 40.0 35.5 41.0 33.5 41.0 46-47 37.66325 39.0 35.0 41.0 33.0 41.0 48-49 37.515125 39.0 35.0 41.0 33.0 41.0 50-51 36.942625 38.0 34.5 40.0 32.5 40.5 52-53 37.061499999999995 38.0 35.0 40.0 33.0 41.0 54-55 37.230000000000004 38.0 35.0 41.0 33.0 41.0 56-57 37.035624999999996 37.0 35.0 41.0 33.0 41.0 58-59 36.824 36.5 35.0 40.0 33.0 41.0 60-61 36.5235 36.0 35.0 40.0 33.0 41.0 62-63 36.300125 35.0 35.0 39.5 33.0 41.0 64-65 35.994749999999996 35.0 35.0 39.0 32.5 41.0 66-67 35.656875 35.0 35.0 39.0 32.0 41.0 68-69 35.4105 35.0 35.0 37.5 32.0 40.5 70-71 35.1125 35.0 34.0 37.0 31.0 39.5 72-73 34.81462500000001 35.0 34.0 36.5 31.0 39.0 74-75 34.565625 35.0 34.0 36.0 31.0 39.0 76-77 34.105500000000006 35.0 34.0 35.5 30.5 37.5 78-79 33.8785 35.0 34.0 35.0 30.0 37.0 80-81 33.72825 35.0 33.0 35.0 29.5 36.5 82-83 33.573125000000005 35.0 33.0 35.0 29.5 36.0 84-85 33.307 35.0 33.0 35.0 29.0 36.0 86-87 33.023375 35.0 33.0 35.0 29.0 35.5 88-89 32.87125 35.0 33.0 35.0 29.0 35.0 90-91 32.631625 35.0 33.0 35.0 27.0 35.0 92-93 32.126 35.0 32.5 35.0 27.0 35.0 94-95 32.010125 35.0 32.5 35.0 26.5 35.0 96-97 31.67425 35.0 32.5 35.0 25.0 35.0 98-99 31.131875 34.0 31.5 35.0 24.0 35.0 100 30.756 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.27719882762594494 1101 2 -0.2654124602319712 1101 3 0.22089731706706317 1101 4 -0.007690573411153423 1101 5 0.09318870713193661 1101 6 -0.08157769483203481 1101 7 0.0846088328866017 1101 8 -0.03631102983541723 1101 9 -0.008554823517627597 1101 10-11 -0.0229840426864385 1101 12-13 0.01786743154888626 1101 14-15 -0.013070217189806499 1101 16-17 0.03683083243568319 1101 18-19 0.022113529898042827 1101 20-21 -0.001064655928253444 1101 22-23 0.10717327588366743 1101 24-25 0.026760439890779253 1101 26-27 -0.04512888599413145 1101 28-29 0.1809476690297913 1101 30-31 0.06919010997269481 1101 32-33 0.20668729176582445 1101 34-35 0.03157644229565193 1101 36-37 -0.22832485783711576 1101 38-39 -0.049612966256667335 1101 40-41 0.07933565470076331 1101 42-43 0.06758060071644678 1101 44-45 0.05623888373957442 1101 46-47 0.15109972694707352 1101 48-49 0.3377526992159119 1101 50-51 0.07848392995816766 1101 52-53 0.09401538114682495 1101 54-55 0.1779102682932887 1101 56-57 0.1896152208221622 1101 58-59 0.0615120619253986 1101 60-61 0.24163931962223018 1101 62-63 0.136194543951504 1101 64-65 0.19165685513164732 1101 66-67 0.06302136827074634 1101 68-69 -0.22840627270222313 1101 70-71 -0.26547508705127854 1101 72-73 -0.11839600190385369 1101 74-75 -0.14081014053457608 1101 76-77 -0.23206994163179928 1101 78-79 -0.19305969588416616 1101 80-81 -0.19408051303890517 1101 82-83 -0.12621182895362892 1101 84-85 -0.22391592975775865 1101 86-87 -0.2733284901926396 1101 88-89 -0.31077932813948195 1101 90-91 -0.3357235902702982 1101 92-93 -0.2813384603822726 1101 94-95 -0.2902439940880299 1101 96-97 -0.25756531977253516 1101 98-99 -0.32863423432450745 1101 100 -0.2190811393070966 1104 1 -0.27719882762594494 1104 2 0.2654124602319712 1104 3 -0.22089731706705606 1104 4 0.007690573411160528 1104 5 -0.09318870713194372 1104 6 0.08157769483203481 1104 7 -0.0846088328865946 1104 8 0.03631102983541723 1104 9 0.008554823517620491 1104 10-11 0.022984042686445605 1104 12-13 -0.01786743154888626 1104 14-15 0.013070217189813604 1104 16-17 -0.03683083243568319 1104 18-19 -0.022113529898042827 1104 20-21 0.001064655928253444 1104 22-23 -0.10717327588366743 1104 24-25 -0.026760439890779253 1104 26-27 0.04512888599413856 1104 28-29 -0.1809476690297842 1104 30-31 -0.06919010997269481 1104 32-33 -0.20668729176582445 1104 34-35 -0.03157644229565193 1104 36-37 0.22832485783712286 1104 38-39 0.04961296625667444 1104 40-41 -0.07933565470077042 1104 42-43 -0.06758060071645389 1104 44-45 -0.05623888373957442 1104 46-47 -0.15109972694706642 1104 48-49 -0.3377526992159119 1104 50-51 -0.07848392995816056 1104 52-53 -0.09401538114682495 1104 54-55 -0.1779102682932887 1104 56-57 -0.1896152208221693 1104 58-59 -0.0615120619253986 1104 60-61 -0.24163931962223728 1104 62-63 -0.136194543951504 1104 64-65 -0.1916568551316402 1104 66-67 -0.06302136827075344 1104 68-69 0.22840627270222313 1104 70-71 0.26547508705127854 1104 72-73 0.11839600190386079 1104 74-75 0.14081014053457608 1104 76-77 0.2320699416318064 1104 78-79 0.19305969588416616 1104 80-81 0.19408051303890517 1104 82-83 0.12621182895362892 1104 84-85 0.22391592975775865 1104 86-87 0.2733284901926396 1104 88-89 0.31077932813948195 1104 90-91 0.3357235902702982 1104 92-93 0.2813384603822726 1104 94-95 0.2902439940880299 1104 96-97 0.2575653197725387 1104 98-99 0.32863423432450745 1104 100 0.2190811393070966 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 5.0 27 15.0 28 20.0 29 52.0 30 56.0 31 101.0 32 124.0 33 170.0 34 284.0 35 446.0 36 773.0 37 935.0 38 872.0 39 147.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.727501256913023 9.326294620412268 13.700351935646054 49.24585218702866 2 26.275 17.4 29.625 26.700000000000003 3 28.125 22.2 21.725 27.950000000000003 4 30.15 27.675 15.0 27.175 5 32.125 28.175 18.475 21.224999999999998 6 23.775 32.0 19.400000000000002 24.825 7 21.25156445556946 13.74217772215269 38.1226533166458 26.883604505632043 8 24.28035043804756 18.272841051314142 24.455569461827285 32.99123904881102 9 23.942957217913435 18.038528896672503 27.370527895921942 30.64798598949212 10-11 27.326163081540773 26.43821910955478 18.684342171085543 27.55127563781891 12-13 24.6125 20.3 25.55 29.5375 14-15 26.075 22.75 23.275000000000002 27.900000000000002 16-17 26.937499999999996 22.55 22.900000000000002 27.6125 18-19 26.2875 23.4625 22.675 27.575 20-21 26.5375 22.8375 22.675 27.950000000000003 22-23 26.6625 23.5 21.512500000000003 28.325 24-25 26.6625 22.95 22.825 27.5625 26-27 27.6375 22.1375 22.475 27.750000000000004 28-29 27.037499999999998 22.475 22.162499999999998 28.325 30-31 25.5625 23.9 22.925 27.6125 32-33 26.85 22.9375 22.900000000000002 27.3125 34-35 26.674999999999997 23.674999999999997 21.6875 27.962500000000002 36-37 25.525 23.3875 23.775 27.3125 38-39 27.05 23.1 22.15 27.700000000000003 40-41 26.35 22.662499999999998 22.662499999999998 28.325 42-43 26.025 23.1625 23.150000000000002 27.6625 44-45 27.275 23.0125 22.162499999999998 27.55 46-47 27.787499999999998 22.5875 22.45 27.175 48-49 27.0125 22.6875 22.5125 27.787499999999998 50-51 26.437500000000004 23.05 22.575 27.9375 52-53 27.1625 22.225 22.6 28.012500000000003 54-55 26.3 23.2875 22.112499999999997 28.299999999999997 56-57 27.0 22.9625 22.375 27.6625 58-59 27.712500000000002 23.075000000000003 22.400000000000002 26.8125 60-61 26.2875 22.7375 23.1375 27.8375 62-63 26.8375 23.1375 21.837500000000002 28.1875 64-65 27.287499999999998 22.0625 22.55 28.1 66-67 27.737499999999997 22.15 22.725 27.3875 68-69 27.8125 22.6375 22.0625 27.487499999999997 70-71 27.075 23.200000000000003 22.425 27.3 72-73 26.974999999999998 23.6125 22.7375 26.674999999999997 74-75 27.400000000000002 22.912499999999998 21.975 27.712500000000002 76-77 28.025 22.112499999999997 22.162499999999998 27.700000000000003 78-79 26.5875 22.575 23.175 27.6625 80-81 27.250000000000004 22.650000000000002 22.425 27.675 82-83 28.3875 22.375 22.275 26.9625 84-85 27.55 23.175 22.075 27.200000000000003 86-87 26.737499999999997 22.1875 23.525 27.55 88-89 27.725 23.1625 21.95 27.1625 90-91 27.0875 22.875 22.5 27.537499999999998 92-93 27.00675168792198 23.193298324581146 22.50562640660165 27.294323580895224 94-95 27.2625 22.900000000000002 22.662499999999998 27.175 96-97 26.674999999999997 22.925 22.725 27.675 98-99 28.95 22.1 22.9375 26.0125 100 27.425 23.35 22.7 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 2.0 29 4.0 30 5.5 31 6.0 32 6.5 33 10.0 34 13.5 35 19.5 36 31.0 37 35.0 38 45.5 39 72.5 40 80.5 41 88.0 42 113.5 43 122.0 44 128.5 45 157.5 46 150.5 47 134.0 48 133.5 49 109.0 50 103.0 51 109.0 52 108.5 53 99.5 54 85.5 55 80.0 56 87.5 57 102.0 58 101.0 59 108.5 60 120.5 61 120.5 62 125.0 63 111.0 64 98.0 65 102.0 66 104.0 67 107.0 68 103.0 69 92.5 70 82.5 71 70.0 72 57.5 73 53.0 74 50.0 75 42.0 76 29.0 77 15.0 78 14.5 79 15.5 80 11.5 81 7.0 82 3.5 83 3.0 84 1.5 85 1.0 86 1.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.125 8 0.125 9 0.075 10-11 0.05 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70689655172413 97.32499999999999 2 1.1663286004056794 2.3 3 0.12677484787018256 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560123 spots for SRR8618216.sra Written 560123 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra Read 560116 spots for SRR8618216.sra Written 560116 spots for SRR8618216.sra SRR ids: ['SRR8618216.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b0p1_vqu SRR8618216.sra spots: 11202327 blocks: [[1, 560116], [560117, 1120232], [1120233, 1680348], [1680349, 2240464], [2240465, 2800580], [2800581, 3360696], [3360697, 3920812], [3920813, 4480928], [4480929, 5041044], [5041045, 5601160], [5601161, 6161276], [6161277, 6721392], [6721393, 7281508], [7281509, 7841624], [7841625, 8401740], [8401741, 8961856], [8961857, 9521972], [9521973, 10082088], [10082089, 10642204], [10642205, 11202327]] SRR8618216 file size 2915433 SRR8618216 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618216 SRR8618216_1.fastq SRR8618216_2.fastq Input file: SRR8618216_1.fastq Paired file: SRR8618216_2.fastq trimmed: SRR8618216-trimmed-pair1.fastq, SRR8618216-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:45:43 2024 >> started Sat Dec 7 06:45:54 2024 >> done (10.176s) 11202327 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11202327 (100.00%) read pairs available; of these: 1453200 (12.97%) trimmed read pairs available after processing 9749127 (87.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 41 1 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 1 0.00% 81 13 0.00% 82 39 0.00% 83 116 0.00% 84 5484 0.05% 85 5722 0.05% 86 6449 0.06% 87 7241 0.06% 88 8883 0.08% 89 10993 0.10% 90 17874 0.16% 91 33325 0.30% 92 47736 0.43% 93 65594 0.59% 94 87972 0.79% 95 112618 1.01% 96 148271 1.32% 97 205070 1.83% 98 294907 2.63% 99 394891 3.53% 100 9749127 87.03% 11202327 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=22 prefix-density=0.40 prefix-fanout=2.3 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.26 sequence-density-rank=11 fanout-score=7.65 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=3.6 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=2.3 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=29 fanout-score=9.55 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=5.2 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618216 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:46:22 Started mapping on | Dec 07 06:46:22 Finished on | Dec 07 06:46:51 Mapping speed, Million of reads per hour | 1390.63 Number of input reads | 11202327 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10977131 Uniquely mapped reads % | 97.99% Average mapped length | 198.34 Number of splices: Total | 6279131 Number of splices: Annotated (sjdb) | 5978215 Number of splices: GT/AG | 6194878 Number of splices: GC/AG | 69299 Number of splices: AT/AC | 1788 Number of splices: Non-canonical | 13166 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 94105 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 5329 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 131091 131091 131091 N_multimapping 94105 94105 94105 N_noFeature 238662 5486954 5524276 N_ambiguous 246743 21278 22384 UnstrandedReadsAssigned:10491726 PositiveStrandReadsAssigned:5468899 NegativeStrandReadsAssigned:5430471 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618216 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618216-trimmed-pair1.fastq SRR8618216-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,202,327 reads, 10,686,275 reads pseudoaligned [quant] estimated average fragment length: 163.76 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52973 SRR8618216.ke.tsv 35125 SRR8618216.se.tsv 88098 total ==> SRR8618216.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.42 3.85286 0.617019 PNS24247 1044 881.24 26.0608 3.66289 PNS24249 1928 1765.24 104.707 7.34685 PNS24246 1044 881.24 26.0608 3.66289 PNS24248 1044 881.24 26.0608 3.66289 PNS24244 1471 1308.24 11.2582 1.06589 PNS24243 293 136.723 2 1.81183 KQK14069 1603 1440.24 6019.03 517.634 KQK14071 474 312.402 518.907 205.735 ==> SRR8618216.se.tsv <== BRADI_1g14170v3 6977 BRADI_1g53295v3 137 BRADI_1g59795v3 239 BRADI_1g07683v3 1 BRADI_1g00485v3 6 BRADI_1g20270v3 164 BRADI_1g74790v3 75 BRADI_1g09890v3 1 BRADI_1g77505v3 126 BRADI_1g48960v3 0 SRR8618216 completed mapping pipeline successfully