Starting /dee2/code/volunteer_pipeline.sh SRR8618217 current disk space = 1545042313216 free memory = 1597741360 SRR8618217 SRAfilesize 3cfa40ffc231fae00b794cbdcee74fe2 SRR8618217.sra SRR8618217.sra file validated SRR8618217 is paired end SRR8618217 is conventional basespace SRR8618217 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618217_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.019 34.0 31.0 34.0 31.0 34.0 2 33.23225 34.0 34.0 34.0 31.0 34.0 3 33.342 34.0 34.0 34.0 31.0 34.0 4 35.34525 37.0 37.0 37.0 35.0 37.0 5 35.968 37.0 37.0 37.0 35.0 37.0 6 36.37725 37.0 37.0 37.0 35.0 37.0 7 36.21875 37.0 37.0 37.0 35.0 37.0 8 36.4385 37.0 37.0 37.0 35.0 37.0 9 38.34475 39.0 39.0 39.0 37.0 39.0 10-11 38.413125 39.0 39.0 39.0 37.0 39.0 12-13 38.413250000000005 39.0 39.0 39.0 37.0 39.0 14-15 40.015 41.0 40.0 41.0 38.0 41.0 16-17 40.00425 41.0 40.0 41.0 38.0 41.0 18-19 39.931375 41.0 40.0 41.0 38.0 41.0 20-21 39.88 41.0 40.0 41.0 38.0 41.0 22-23 39.782250000000005 41.0 40.0 41.0 37.5 41.0 24-25 39.68375 41.0 39.5 41.0 37.5 41.0 26-27 39.47825 41.0 39.0 41.0 36.0 41.0 28-29 39.305875 40.0 39.0 41.0 36.0 41.0 30-31 39.02825 40.0 38.0 41.0 35.0 41.0 32-33 39.046 40.0 38.5 41.0 35.0 41.0 34-35 39.223625 40.5 39.0 41.0 35.0 41.0 36-37 39.303250000000006 41.0 39.0 41.0 35.0 41.0 38-39 39.193625 41.0 38.0 41.0 35.0 41.0 40-41 39.059625 40.5 38.0 41.0 35.0 41.0 42-43 38.856624999999994 40.0 38.0 41.0 35.0 41.0 44-45 38.605000000000004 40.0 37.0 41.0 35.0 41.0 46-47 38.39425 40.0 36.5 41.0 35.0 41.0 48-49 38.132 40.0 35.5 41.0 34.0 41.0 50-51 37.8565 39.0 35.0 41.0 34.0 41.0 52-53 37.675125 39.0 35.0 41.0 34.0 41.0 54-55 37.386875 38.5 35.0 41.0 33.0 41.0 56-57 37.091625 37.5 35.0 41.0 33.0 41.0 58-59 36.87125 37.0 35.0 40.0 33.0 41.0 60-61 36.522625000000005 36.5 35.0 40.0 33.0 41.0 62-63 36.28037500000001 36.0 35.0 39.5 32.5 41.0 64-65 35.94825 35.0 35.0 39.0 32.0 41.0 66-67 35.68837499999999 35.0 35.0 39.0 32.0 41.0 68-69 35.468 35.0 34.5 37.5 32.0 40.0 70-71 35.12875 35.0 34.0 37.0 31.0 40.0 72-73 34.729749999999996 35.0 34.0 37.0 31.0 39.0 74-75 34.39425 35.0 34.0 36.0 30.0 39.0 76-77 33.64475 34.5 33.0 35.0 29.0 37.0 78-79 34.015625 35.0 33.5 35.0 30.5 37.0 80-81 33.955 35.0 34.0 35.0 30.5 37.0 82-83 33.677375 35.0 33.5 35.0 30.0 36.0 84-85 33.571625 35.0 33.5 35.0 30.0 36.0 86-87 33.371125000000006 35.0 33.0 35.0 29.5 36.0 88-89 33.069874999999996 35.0 33.0 35.0 29.0 35.0 90-91 32.825500000000005 35.0 33.0 35.0 29.0 35.0 92-93 32.506125 35.0 33.0 35.0 27.0 35.0 94-95 32.411500000000004 35.0 33.0 35.0 27.0 35.0 96-97 32.263374999999996 35.0 33.0 35.0 27.0 35.0 98-99 31.69625 34.5 32.5 35.0 26.0 35.0 100 31.375 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.010526315789476826 1101 2 0.057268170426063136 1101 3 -0.0116541353383397 1101 4 -1.3253132832080183 1101 5 -0.7253132832080169 1101 6 -0.18771929824561795 1101 7 -0.39511278195488586 1101 8 -0.22268170426065126 1101 9 -0.12192982456140555 1101 10-11 -0.04711779448621911 1101 12-13 0.012719298245613686 1101 14-15 0.11716791979949903 1101 16-17 0.17011278195488444 1101 18-19 0.07048872180451582 1101 20-21 0.14417293233082518 1101 22-23 0.15833333333333854 1101 24-25 0.09210526315789735 1101 26-27 0.01716791979949761 1101 28-29 0.07907268170426107 1101 30-31 0.1135338345864696 1101 32-33 -0.0179824561403521 1101 34-35 0.09373433583959923 1101 36-37 -0.08201754385964932 1101 38-39 -0.0181704260651685 1101 40-41 0.11190476190476772 1101 42-43 0.02944862155388961 1101 44-45 0.06760651629072356 1101 46-47 -0.06290726817042724 1101 48-49 -0.10858395989975378 1101 50-51 0.07073934837092821 1101 52-53 -0.06704260651629568 1101 54-55 0.04053884711779432 1101 56-57 -0.08978696741854719 1101 58-59 0.03352130325814784 1101 60-61 -0.04592731829573893 1101 62-63 -0.07581453634085022 1101 64-65 -0.010651629072683022 1101 66-67 -0.08552631578947256 1101 68-69 0.07280701754385888 1101 70-71 0.09486215538847631 1101 72-73 0.03922305764410794 1101 74-75 0.12600250626566378 1101 76-77 -0.1541979949874701 1101 78-79 -0.18721804511277895 1101 80-81 -0.12619047619048018 1101 82-83 -0.07080200501253131 1101 84-85 0.057832080200498126 1101 86-87 -0.01553884711779574 1101 88-89 -0.01898496240601588 1101 90-91 -0.12136591478697056 1101 92-93 -0.3082080200501238 1101 94-95 0.15363408521303512 1101 96-97 0.35952380952380736 1101 98-99 0.1934837092731847 1101 100 0.33546365914786946 1103 1 0.01052631578946972 1103 2 -0.057268170426063136 1103 3 0.011654135338346805 1103 4 1.3253132832080254 1103 5 0.7253132832080169 1103 6 0.18771929824561084 1103 7 0.39511278195489297 1103 8 0.22268170426065126 1103 9 0.12192982456140555 1103 10-11 0.047117794486212006 1103 12-13 -0.012719298245613686 1103 14-15 -0.11716791979949903 1103 16-17 -0.17011278195488444 1103 18-19 -0.07048872180450871 1103 20-21 -0.14417293233082518 1103 22-23 -0.15833333333333144 1103 24-25 -0.09210526315789735 1103 26-27 -0.01716791979949761 1103 28-29 -0.07907268170425397 1103 30-31 -0.1135338345864696 1103 32-33 0.017982456140344993 1103 34-35 -0.09373433583959923 1103 36-37 0.08201754385964932 1103 38-39 0.018170426065161394 1103 40-41 -0.11190476190476062 1103 42-43 -0.02944862155388961 1103 44-45 -0.06760651629072356 1103 46-47 0.06290726817042724 1103 48-49 0.10858395989975378 1103 50-51 -0.07073934837092821 1103 52-53 0.06704260651628857 1103 54-55 -0.04053884711778721 1103 56-57 0.08978696741854719 1103 58-59 -0.03352130325814784 1103 60-61 0.04592731829573893 1103 62-63 0.07581453634085733 1103 64-65 0.010651629072683022 1103 66-67 0.08552631578947256 1103 68-69 -0.07280701754385888 1103 70-71 -0.0948621553884692 1103 72-73 -0.03922305764410794 1103 74-75 -0.12600250626566378 1103 76-77 0.154197994987463 1103 78-79 0.18721804511278606 1103 80-81 0.12619047619047308 1103 82-83 0.07080200501253131 1103 84-85 -0.057832080200498126 1103 86-87 0.01553884711779574 1103 88-89 0.01898496240601588 1103 90-91 0.12136591478697056 1103 92-93 0.3082080200501238 1103 94-95 -0.15363408521303512 1103 96-97 -0.3595238095238109 1103 98-99 -0.1934837092731847 1103 100 -0.33546365914786946 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 14.0 28 22.0 29 37.0 30 54.0 31 84.0 32 124.0 33 180.0 34 255.0 35 381.0 36 723.0 37 971.0 38 996.0 39 156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.10092662158778 11.119459053343352 14.149762083646381 45.62985224142249 2 26.125 18.5 30.875000000000004 24.5 3 26.325 21.375 23.325000000000003 28.975 4 29.4025974025974 26.90909090909091 17.402597402597404 26.285714285714285 5 31.05 29.9 17.150000000000002 21.9 6 22.825 33.800000000000004 18.8 24.575 7 22.0 14.2 38.275 25.525 8 22.85 19.675 22.900000000000002 34.575 9 23.7 18.825 27.525 29.95 10-11 27.450000000000003 27.5125 19.037499999999998 26.0 12-13 24.5375 21.025 26.2625 28.175 14-15 26.025 22.2625 24.5 27.212500000000002 16-17 25.8125 23.0125 23.599999999999998 27.575 18-19 25.924999999999997 23.0 23.549999999999997 27.525 20-21 26.3125 23.7 22.85 27.1375 22-23 27.075 22.575 23.5125 26.8375 24-25 26.6125 24.099999999999998 22.225 27.0625 26-27 26.474999999999998 23.575 22.625 27.325 28-29 25.8125 23.775 23.175 27.237499999999997 30-31 26.650000000000002 23.674999999999997 23.3625 26.3125 32-33 26.6 23.849999999999998 23.1125 26.437500000000004 34-35 26.1125 23.625 22.912499999999998 27.35 36-37 27.400000000000002 23.0 22.925 26.674999999999997 38-39 26.687499999999996 23.4875 23.175 26.650000000000002 40-41 27.625 23.599999999999998 22.375 26.400000000000002 42-43 27.1125 22.662499999999998 23.4875 26.737499999999997 44-45 26.8125 23.799999999999997 23.3875 26.0 46-47 26.437500000000004 23.2625 23.25 27.05 48-49 26.150000000000002 23.7625 23.2875 26.8 50-51 26.437500000000004 22.9625 23.625 26.974999999999998 52-53 26.224999999999998 23.375 23.200000000000003 27.200000000000003 54-55 26.787499999999998 22.9875 23.1625 27.0625 56-57 26.237500000000004 23.1375 23.150000000000002 27.474999999999998 58-59 27.2625 22.8375 23.0 26.900000000000002 60-61 26.474999999999998 23.3625 22.325 27.8375 62-63 26.5 23.1 23.5 26.900000000000002 64-65 27.737499999999997 22.775000000000002 22.8125 26.674999999999997 66-67 26.25 23.6375 23.4125 26.700000000000003 68-69 27.075 23.1 23.724999999999998 26.1 70-71 27.3 22.6 22.45 27.650000000000002 72-73 25.8625 23.5 23.3125 27.325 74-75 27.6875 23.075000000000003 23.474999999999998 25.7625 76-77 26.775 23.7125 22.775000000000002 26.737499999999997 78-79 27.55 23.0625 22.6 26.787499999999998 80-81 26.325 24.1625 22.275 27.237499999999997 82-83 27.025 22.7375 23.4875 26.75 84-85 26.4625 23.5125 23.25 26.775 86-87 27.8375 24.1625 22.4375 25.5625 88-89 27.55 22.900000000000002 23.3125 26.237500000000004 90-91 27.3 22.625 23.0 27.075 92-93 27.435512146255945 23.203105434510395 23.40345604808415 25.957926371149508 94-95 27.340917614701837 23.47793474184273 22.46530816352044 26.715839479934996 96-97 26.5125 23.974999999999998 22.412499999999998 27.1 98-99 27.950000000000003 23.200000000000003 22.8125 26.0375 100 28.349999999999998 22.875 21.7 27.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 1.5 29 2.0 30 4.5 31 5.5 32 7.5 33 12.5 34 17.0 35 22.5 36 31.5 37 44.0 38 56.0 39 68.5 40 81.5 41 97.0 42 117.0 43 138.0 44 142.5 45 138.5 46 147.0 47 163.5 48 156.5 49 128.5 50 128.0 51 131.0 52 122.5 53 112.5 54 96.5 55 83.5 56 79.5 57 91.0 58 99.5 59 110.5 60 120.5 61 112.0 62 107.0 63 101.5 64 96.0 65 93.5 66 94.5 67 96.0 68 77.5 69 69.0 70 68.5 71 61.0 72 59.5 73 45.0 74 34.0 75 35.0 76 31.0 77 20.0 78 13.0 79 12.5 80 8.0 81 2.5 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 3.75 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.17500000000000002 94-95 0.0125 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0125 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0125 0.0 0.0 0.0 0.025 86-87 0.1375 0.0 0.0 0.0 0.025 88 0.2 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618217 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618217_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.068 34.0 31.0 34.0 31.0 34.0 2 32.48625 34.0 31.0 34.0 31.0 34.0 3 32.88275 34.0 31.0 34.0 31.0 34.0 4 36.3505 37.0 37.0 37.0 35.0 37.0 5 36.42425 37.0 37.0 37.0 35.0 37.0 6 36.48275 37.0 37.0 37.0 35.0 37.0 7 36.4295 37.0 37.0 37.0 35.0 37.0 8 36.5 37.0 37.0 37.0 35.0 37.0 9 38.2755 39.0 39.0 39.0 37.0 39.0 10-11 38.256625 39.0 39.0 39.0 37.0 39.0 12-13 38.319375 39.0 39.0 39.0 37.0 39.0 14-15 39.918000000000006 41.0 40.0 41.0 38.0 41.0 16-17 39.873875 41.0 40.0 41.0 37.5 41.0 18-19 39.756125 41.0 40.0 41.0 37.5 41.0 20-21 39.735125 41.0 40.0 41.0 37.0 41.0 22-23 39.735125 41.0 40.0 41.0 37.5 41.0 24-25 39.580875 41.0 39.0 41.0 37.0 41.0 26-27 39.518625 41.0 39.0 41.0 36.5 41.0 28-29 39.347375 40.5 39.0 41.0 36.0 41.0 30-31 39.1665 40.0 38.5 41.0 35.0 41.0 32-33 39.209875 40.0 39.0 41.0 35.0 41.0 34-35 39.167375 40.0 38.0 41.0 35.0 41.0 36-37 38.936875 40.0 38.0 41.0 35.0 41.0 38-39 38.7755 40.0 38.0 41.0 35.0 41.0 40-41 38.563375 40.0 37.5 41.0 34.5 41.0 42-43 38.355000000000004 40.0 37.0 41.0 34.0 41.0 44-45 38.065250000000006 40.0 36.0 41.0 33.5 41.0 46-47 37.778999999999996 39.0 35.0 41.0 33.0 41.0 48-49 37.6465 39.0 35.0 41.0 33.0 41.0 50-51 37.174625000000006 38.5 35.0 40.0 33.0 40.5 52-53 37.211124999999996 38.0 35.0 40.0 33.0 41.0 54-55 37.379125 38.5 35.0 41.0 33.0 41.0 56-57 37.21825 38.0 35.0 41.0 33.0 41.0 58-59 37.019625000000005 37.0 35.0 41.0 33.0 41.0 60-61 36.72475 36.5 35.0 40.0 33.0 41.0 62-63 36.448875 36.0 35.0 40.0 33.0 41.0 64-65 36.209 35.5 35.0 39.0 33.0 41.0 66-67 35.821 35.0 35.0 39.0 32.0 41.0 68-69 35.417125 35.0 34.5 38.5 31.0 41.0 70-71 35.214124999999996 35.0 34.5 37.0 31.0 40.0 72-73 35.03375 35.0 34.0 37.0 31.0 39.0 74-75 34.71975 35.0 34.0 36.0 31.0 39.0 76-77 34.29025 35.0 34.0 36.0 30.0 38.0 78-79 34.122125 35.0 34.0 35.5 30.0 37.0 80-81 33.917 35.0 34.0 35.0 30.5 37.0 82-83 33.76375 35.0 34.0 35.0 30.0 36.5 84-85 33.524375 35.0 33.0 35.0 30.0 36.0 86-87 33.310375 35.0 33.0 35.0 29.0 36.0 88-89 33.165000000000006 35.0 33.0 35.0 29.0 35.0 90-91 32.944625 35.0 33.0 35.0 29.0 35.0 92-93 32.6055 35.0 33.0 35.0 27.5 35.0 94-95 32.35625 35.0 33.0 35.0 27.0 35.0 96-97 32.0565 35.0 32.5 35.0 27.0 35.0 98-99 31.601374999999997 34.5 32.0 35.0 26.0 35.0 100 31.20125 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.5593984962405969 1101 2 0.12280701754386314 1101 3 0.07380952380952266 1101 4 0.004385964912280826 1101 5 -0.010401002506270629 1101 6 0.005639097744364108 1101 7 0.0832080200501224 1101 8 0.1785714285714306 1101 9 0.11040100250626494 1101 10-11 0.19141604010025048 1101 12-13 0.13947368421052175 1101 14-15 0.17687969924811853 1101 16-17 0.22299498746867386 1101 18-19 0.28182957393483576 1101 20-21 0.1483709273182967 1101 22-23 0.020238095238099163 1101 24-25 0.13270676691729477 1101 26-27 0.06021303258145139 1101 28-29 0.2631578947368425 1101 30-31 0.02650375939850136 1101 32-33 0.08496240601503757 1101 34-35 -0.06397243107769413 1101 36-37 0.10545112781954913 1101 38-39 0.08389724310777069 1101 40-41 -0.09135338345864596 1101 42-43 -0.028383458646615622 1101 44-45 0.26497493734335364 1101 46-47 0.37080200501252847 1101 48-49 0.19931077694236166 1101 50-51 0.14968671679197598 1101 52-53 0.22982456140351104 1101 54-55 0.14104010025062763 1101 56-57 -0.08264411027569452 1101 58-59 -9.398496240606846E-4 1101 60-61 -0.010275689223057327 1101 62-63 0.06309523809523654 1101 64-65 -0.013283208020048676 1101 66-67 0.04298245614035068 1101 68-69 0.2266290726817033 1101 70-71 -0.05914786967419161 1101 72-73 -0.24573934837092537 1101 74-75 -0.00776942355889787 1101 76-77 -0.041416040100251905 1101 78-79 -0.044924812030075145 1101 80-81 -0.15971177944862092 1101 82-83 -0.1548872180451113 1101 84-85 0.15595238095237818 1101 86-87 0.08690476190476204 1101 88-89 -0.0038220551378387313 1101 90-91 0.008270676691729761 1101 92-93 0.11553884711779716 1101 94-95 0.14448621553884067 1101 96-97 -0.0774436090225521 1101 98-99 -0.05187969924812208 1101 100 -0.07117794486215345 1103 1 -0.559398496240604 1103 2 -0.12280701754385603 1103 3 -0.07380952380952266 1103 4 -0.004385964912280826 1103 5 0.010401002506263524 1103 6 -0.005639097744357002 1103 7 -0.0832080200501295 1103 8 -0.1785714285714306 1103 9 -0.11040100250627205 1103 10-11 -0.19141604010025048 1103 12-13 -0.13947368421052886 1103 14-15 -0.17687969924812563 1103 16-17 -0.22299498746867386 1103 18-19 -0.28182957393483576 1103 20-21 -0.1483709273182967 1103 22-23 -0.020238095238092058 1103 24-25 -0.13270676691729477 1103 26-27 -0.06021303258145139 1103 28-29 -0.2631578947368425 1103 30-31 -0.026503759398494253 1103 32-33 -0.08496240601503757 1103 34-35 0.06397243107769413 1103 36-37 -0.10545112781954913 1103 38-39 -0.08389724310777069 1103 40-41 0.09135338345864596 1103 42-43 0.028383458646615622 1103 44-45 -0.26497493734336075 1103 46-47 -0.37080200501252847 1103 48-49 -0.19931077694235455 1103 50-51 -0.1496867167919831 1103 52-53 -0.22982456140351104 1103 54-55 -0.14104010025062763 1103 56-57 0.08264411027568741 1103 58-59 9.398496240606846E-4 1103 60-61 0.010275689223064433 1103 62-63 -0.06309523809524364 1103 64-65 0.013283208020048676 1103 66-67 -0.04298245614035068 1103 68-69 -0.2266290726817033 1103 70-71 0.059147869674184506 1103 72-73 0.24573934837092537 1103 74-75 0.00776942355889787 1103 76-77 0.041416040100251905 1103 78-79 0.044924812030075145 1103 80-81 0.15971177944862092 1103 82-83 0.1548872180451184 1103 84-85 -0.15595238095237818 1103 86-87 -0.08690476190476204 1103 88-89 0.0038220551378458367 1103 90-91 -0.008270676691729761 1103 92-93 -0.11553884711779716 1103 94-95 -0.14448621553884777 1103 96-97 0.0774436090225592 1103 98-99 0.05187969924812208 1103 100 0.071177944862157 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 12.0 28 26.0 29 30.0 30 52.0 31 101.0 32 130.0 33 177.0 34 266.0 35 467.0 36 735.0 37 903.0 38 931.0 39 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.992464204973622 9.721175584024115 13.69002763124843 46.59633257975383 2 27.025 18.175 30.975 23.825 3 27.375 22.400000000000002 22.575 27.650000000000002 4 30.075000000000003 26.974999999999998 15.525 27.425 5 30.4 29.45 18.375 21.775 6 22.0 33.35 19.075 25.575 7 20.915686765073804 14.886164623467602 39.00425318989242 25.193895421566175 8 22.6976976976977 19.144144144144143 23.923923923923923 34.234234234234236 9 23.63090772693173 17.95448862215554 28.35708927231808 30.057514378594647 10-11 26.987499999999997 26.650000000000002 19.05 27.3125 12-13 25.124999999999996 22.662499999999998 24.55 27.6625 14-15 25.5125 22.9625 23.849999999999998 27.675 16-17 26.437500000000004 22.75 22.6 28.212500000000002 18-19 27.250000000000004 22.425 23.025000000000002 27.3 20-21 25.7375 23.575 22.900000000000002 27.787499999999998 22-23 25.587500000000002 23.5125 23.5125 27.3875 24-25 26.450000000000003 23.25 23.0125 27.287499999999998 26-27 25.2375 23.3125 23.6625 27.787499999999998 28-29 26.400000000000002 22.925 23.0875 27.5875 30-31 26.424999999999997 23.45 22.975 27.150000000000002 32-33 26.25 23.45 23.5875 26.7125 34-35 26.6625 22.9375 23.3 27.1 36-37 26.2125 23.799999999999997 23.5 26.487500000000004 38-39 26.6 23.425 22.4625 27.5125 40-41 26.3625 23.974999999999998 22.4375 27.224999999999998 42-43 26.5625 22.9875 23.175 27.275 44-45 26.987499999999997 23.0625 22.325 27.625 46-47 25.825 23.474999999999998 23.6375 27.0625 48-49 26.0 23.0375 23.5875 27.375 50-51 26.237500000000004 22.912499999999998 23.5625 27.287499999999998 52-53 26.1625 23.225 22.8 27.8125 54-55 26.674999999999997 23.025000000000002 22.4875 27.8125 56-57 26.2875 23.200000000000003 23.5125 27.0 58-59 26.775 22.825 23.6375 26.7625 60-61 26.1125 23.1 22.7375 28.050000000000004 62-63 26.2625 23.9375 22.412499999999998 27.3875 64-65 26.5375 23.974999999999998 22.5 26.987499999999997 66-67 26.775 23.45 22.662499999999998 27.1125 68-69 26.1 23.75 23.575 26.575 70-71 26.25 23.0375 23.5 27.212500000000002 72-73 25.525 22.875 23.875 27.725 74-75 25.474999999999998 22.975 24.525 27.025 76-77 27.250000000000004 22.537499999999998 22.9875 27.224999999999998 78-79 27.237499999999997 23.125 22.05 27.5875 80-81 26.487500000000004 23.4625 23.375 26.674999999999997 82-83 26.8125 23.1625 22.5625 27.462500000000002 84-85 26.4625 23.4875 22.8125 27.237499999999997 86-87 26.825 22.175 24.425 26.575 88-89 26.85 22.3625 23.0 27.787499999999998 90-91 26.6 23.1375 22.9625 27.3 92-93 26.0125 24.575 23.1 26.3125 94-95 26.85 23.8625 23.150000000000002 26.137500000000003 96-97 27.1375 23.4375 23.05 26.375 98-99 27.6875 22.225 23.4875 26.6 100 27.35 23.400000000000002 23.3 25.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 2.0 30 5.0 31 8.0 32 12.0 33 14.5 34 11.5 35 17.5 36 26.0 37 41.0 38 64.5 39 80.0 40 91.0 41 97.5 42 120.0 43 140.5 44 148.0 45 145.0 46 137.5 47 141.0 48 134.0 49 134.5 50 136.0 51 119.5 52 117.0 53 114.5 54 97.0 55 94.5 56 96.0 57 93.5 58 99.5 59 99.0 60 100.0 61 105.0 62 107.0 63 96.0 64 93.0 65 109.5 66 101.5 67 87.5 68 84.5 69 76.0 70 65.0 71 60.5 72 57.5 73 41.0 74 34.0 75 41.0 76 33.5 77 24.0 78 16.0 79 7.5 80 5.5 81 7.0 82 4.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.075 8 0.1 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7566204287515763 1.5 3 0.025220680958385876 0.075 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552810 spots for SRR8618217.sra Written 552810 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra Read 552797 spots for SRR8618217.sra Written 552797 spots for SRR8618217.sra SRR ids: ['SRR8618217.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ewzgdfnf SRR8618217.sra spots: 11055953 blocks: [[1, 552797], [552798, 1105594], [1105595, 1658391], [1658392, 2211188], [2211189, 2763985], [2763986, 3316782], [3316783, 3869579], [3869580, 4422376], [4422377, 4975173], [4975174, 5527970], [5527971, 6080767], [6080768, 6633564], [6633565, 7186361], [7186362, 7739158], [7739159, 8291955], [8291956, 8844752], [8844753, 9397549], [9397550, 9950346], [9950347, 10503143], [10503144, 11055953]] SRR8618217 file size 2877193 SRR8618217 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618217 SRR8618217_1.fastq SRR8618217_2.fastq Input file: SRR8618217_1.fastq Paired file: SRR8618217_2.fastq trimmed: SRR8618217-trimmed-pair1.fastq, SRR8618217-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:46:45 2024 >> started Sat Dec 7 06:46:55 2024 >> done (9.872s) 11055953 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11055953 (100.00%) read pairs available; of these: 1373770 (12.43%) trimmed read pairs available after processing 9682183 (87.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 77 1 0.00% 78 0 0.00% 79 0 0.00% 80 1 0.00% 81 10 0.00% 82 34 0.00% 83 88 0.00% 84 5576 0.05% 85 5994 0.05% 86 6429 0.06% 87 7092 0.06% 88 8684 0.08% 89 10934 0.10% 90 17604 0.16% 91 32206 0.29% 92 45103 0.41% 93 61392 0.56% 94 82364 0.74% 95 106240 0.96% 96 138363 1.25% 97 191942 1.74% 98 278196 2.52% 99 375517 3.40% 100 9682183 87.57% 11055953 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=25 prefix-density=0.38 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=31 fanout-score=9.67 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.2 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=25 prefix-density=0.39 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=31 fanout-score=10.92 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.6 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618217 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:47:26 Started mapping on | Dec 07 06:47:26 Finished on | Dec 07 06:48:01 Mapping speed, Million of reads per hour | 1137.18 Number of input reads | 11055953 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10644817 Uniquely mapped reads % | 96.28% Average mapped length | 198.37 Number of splices: Total | 6382500 Number of splices: Annotated (sjdb) | 6073112 Number of splices: GT/AG | 6293861 Number of splices: GC/AG | 73519 Number of splices: AT/AC | 1869 Number of splices: Non-canonical | 13251 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 138139 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 32674 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 1.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 272997 272997 272997 N_multimapping 138139 138139 138139 N_noFeature 260402 5338108 5372324 N_ambiguous 239157 22360 23778 UnstrandedReadsAssigned:10145258 PositiveStrandReadsAssigned:5284349 NegativeStrandReadsAssigned:5248715 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618217 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618217-trimmed-pair1.fastq SRR8618217-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,055,953 reads, 10,410,232 reads pseudoaligned [quant] estimated average fragment length: 167.328 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR8618217.ke.tsv 35125 SRR8618217.se.tsv 88098 total ==> SRR8618217.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.731 0.00862224 0.00145563 PNS24247 1044 877.672 19.889 2.94476 PNS24249 1928 1761.67 61.0415 4.50267 PNS24246 1044 877.672 19.889 2.94476 PNS24248 1044 877.672 19.889 2.94476 PNS24244 1471 1304.67 14.283 1.42262 PNS24243 293 134.374 4 3.86825 KQK14069 1603 1436.67 2817.74 254.867 KQK14071 474 309.055 261.627 110.006 ==> SRR8618217.se.tsv <== BRADI_1g14170v3 3385 BRADI_1g53295v3 153 BRADI_1g59795v3 208 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 306 BRADI_1g74790v3 33 BRADI_1g09890v3 0 BRADI_1g77505v3 154 BRADI_1g48960v3 0 SRR8618217 completed mapping pipeline successfully