Starting /dee2/code/volunteer_pipeline.sh SRR8618218 current disk space = 1544874147840 free memory = 1477901808 SRR8618218 SRAfilesize 3cb974270ce2cbe81e3fe25298555da5 SRR8618218.sra SRR8618218.sra file validated SRR8618218 is paired end SRR8618218 is conventional basespace SRR8618218 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618218_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8735 34.0 31.0 34.0 31.0 34.0 2 33.13475 34.0 33.0 34.0 31.0 34.0 3 33.25225 34.0 34.0 34.0 31.0 34.0 4 35.45525 37.0 37.0 37.0 35.0 37.0 5 35.977 37.0 37.0 37.0 35.0 37.0 6 36.29 37.0 37.0 37.0 35.0 37.0 7 36.083 37.0 37.0 37.0 35.0 37.0 8 36.3725 37.0 37.0 37.0 35.0 37.0 9 38.2615 39.0 39.0 39.0 37.0 39.0 10-11 38.359 39.0 39.0 39.0 37.0 39.0 12-13 38.342875 39.0 39.0 39.0 37.0 39.0 14-15 39.951375 41.0 40.0 41.0 38.0 41.0 16-17 39.929874999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.884625 41.0 40.0 41.0 38.0 41.0 20-21 39.738375000000005 41.0 40.0 41.0 37.5 41.0 22-23 39.698375 41.0 40.0 41.0 37.0 41.0 24-25 39.532 41.0 39.5 41.0 36.5 41.0 26-27 39.403375 40.0 39.0 41.0 36.0 41.0 28-29 39.231875 40.0 39.0 41.0 35.5 41.0 30-31 38.936625 40.0 38.0 41.0 35.0 41.0 32-33 38.93025 40.0 38.0 41.0 35.0 41.0 34-35 39.102375 40.0 38.0 41.0 35.0 41.0 36-37 39.130375 40.0 38.0 41.0 35.0 41.0 38-39 39.026125 40.0 38.0 41.0 35.0 41.0 40-41 38.850375 40.0 38.0 41.0 35.0 41.0 42-43 38.669250000000005 40.0 37.0 41.0 35.0 41.0 44-45 38.376875 40.0 36.5 41.0 34.5 41.0 46-47 38.18675 40.0 35.5 41.0 34.0 41.0 48-49 37.9855 39.5 35.0 41.0 34.0 41.0 50-51 37.69475 39.0 35.0 41.0 33.0 41.0 52-53 37.556875 39.0 35.0 41.0 34.0 41.0 54-55 37.209625 38.0 35.0 41.0 33.0 41.0 56-57 36.931375 37.0 35.0 40.5 33.0 41.0 58-59 36.65537500000001 37.0 35.0 40.0 33.0 41.0 60-61 36.3515 36.0 35.0 40.0 32.5 41.0 62-63 36.08 35.5 35.0 39.5 32.0 41.0 64-65 35.693124999999995 35.0 35.0 39.0 31.0 41.0 66-67 35.381375000000006 35.0 34.0 38.5 31.0 41.0 68-69 35.118125 35.0 34.0 37.5 31.0 40.0 70-71 34.961375000000004 35.0 34.0 37.0 31.0 39.5 72-73 34.572 35.0 34.0 36.5 30.5 39.0 74-75 34.20725 35.0 33.0 36.0 30.0 39.0 76-77 33.36575 34.5 32.5 35.0 28.5 37.0 78-79 33.812250000000006 35.0 33.0 35.0 29.5 37.0 80-81 33.75925 35.0 33.0 35.0 30.0 37.0 82-83 33.574125 35.0 33.0 35.0 30.0 36.0 84-85 33.357375 35.0 33.0 35.0 29.0 36.0 86-87 33.093625 35.0 33.0 35.0 29.0 35.5 88-89 32.778375 35.0 33.0 35.0 28.0 35.0 90-91 32.520875000000004 35.0 33.0 35.0 27.0 35.0 92-93 32.198375 35.0 32.5 35.0 27.0 35.0 94-95 32.079875 35.0 32.5 35.0 27.0 35.0 96-97 31.711875 34.5 32.0 35.0 26.0 35.0 98-99 31.2735 34.0 32.0 35.0 24.5 35.0 100 30.864 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.10224005600139918 1101 2 0.08930223255580927 1101 3 0.09870246756168655 1101 4 -1.1848921223030615 1101 5 -0.5025250631265763 1101 6 -0.12682817070426466 1101 7 -0.4304357608940279 1101 8 -0.1416535413385347 1101 9 0.023425585639635926 1101 10-11 -0.018231705792643993 1101 12-13 0.11802795069876737 1101 14-15 0.05487012175304784 1101 16-17 0.20502387559688628 1101 18-19 0.08638965974149215 1101 20-21 0.02000050001250031 1101 22-23 0.1273656841420987 1101 24-25 0.1379034475861829 1101 26-27 0.23436835920897892 1101 28-29 0.1657603940098511 1101 30-31 0.22948698717467408 1101 32-33 0.1798107452686324 1101 34-35 0.24912497812444911 1101 36-37 0.2301182529563235 1101 38-39 0.3882972074301847 1101 40-41 0.24066226655666156 1101 42-43 0.2710380259506451 1101 44-45 0.36132153303832837 1101 46-47 0.12966574164354228 1101 48-49 0.16192279806995202 1101 50-51 0.2875696892422255 1101 52-53 0.26671291782295015 1101 54-55 0.34278356958924405 1101 56-57 0.3089452236305874 1101 58-59 0.5151253781344494 1101 60-61 0.5568139203480129 1101 62-63 0.5092814820370535 1101 64-65 0.5324758118953028 1101 66-67 0.2584939623490641 1101 68-69 0.3565276631915779 1101 70-71 0.49666241656041166 1101 72-73 0.21021775544389243 1101 74-75 0.46826170654266264 1101 76-77 0.2180804520113 1101 78-79 -0.002875071876793811 1101 80-81 0.2553626340658468 1101 82-83 0.10879646991175207 1101 84-85 0.11042151053776195 1101 86-87 0.027606940173505734 1101 88-89 0.12408435210880242 1101 90-91 0.2226993174829346 1101 92-93 0.23420585514637793 1101 94-95 0.09637740943523454 1101 96-97 0.08654591364783926 1101 98-99 0.3279206980174507 1101 100 0.5549763744093603 1104 1 0.10224005600139918 1104 2 -0.08930223255581637 1104 3 -0.09870246756169365 1104 4 1.1848921223030544 1104 5 0.5025250631265834 1104 6 0.12682817070427177 1104 7 0.4304357608940208 1104 8 0.1416535413385276 1104 9 -0.023425585639643032 1104 10-11 0.018231705792643993 1104 12-13 -0.11802795069876737 1104 14-15 -0.05487012175304784 1104 16-17 -0.2050238755968934 1104 18-19 -0.08638965974149215 1104 20-21 -0.02000050001250031 1104 22-23 -0.1273656841421058 1104 24-25 -0.13790344758619 1104 26-27 -0.23436835920897892 1104 28-29 -0.1657603940098511 1104 30-31 -0.2294869871746812 1104 32-33 -0.1798107452686324 1104 34-35 -0.24912497812445622 1104 36-37 -0.2301182529563235 1104 38-39 -0.3882972074301847 1104 40-41 -0.24066226655666867 1104 42-43 -0.2710380259506451 1104 44-45 -0.36132153303832126 1104 46-47 -0.12966574164354228 1104 48-49 -0.16192279806995202 1104 50-51 -0.2875696892422326 1104 52-53 -0.26671291782294304 1104 54-55 -0.34278356958924405 1104 56-57 -0.3089452236305945 1104 58-59 -0.5151253781344565 1104 60-61 -0.5568139203480058 1104 62-63 -0.5092814820370535 1104 64-65 -0.5324758118952957 1104 66-67 -0.25849396234905697 1104 68-69 -0.3565276631915779 1104 70-71 -0.49666241656041166 1104 72-73 -0.21021775544388532 1104 74-75 -0.46826170654266264 1104 76-77 -0.2180804520113 1104 78-79 0.002875071876793811 1104 80-81 -0.2553626340658539 1104 82-83 -0.10879646991174496 1104 84-85 -0.11042151053776195 1104 86-87 -0.027606940173505734 1104 88-89 -0.12408435210880242 1104 90-91 -0.2226993174829346 1104 92-93 -0.23420585514637793 1104 94-95 -0.09637740943523454 1104 96-97 -0.08654591364784636 1104 98-99 -0.3279206980174507 1104 100 -0.5549763744093603 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 14.0 28 26.0 29 51.0 30 64.0 31 115.0 32 121.0 33 176.0 34 271.0 35 455.0 36 743.0 37 947.0 38 874.0 39 140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.812265331664577 9.637046307884855 13.366708385481852 47.18397997496871 2 26.900000000000002 18.6 30.225 24.275 3 27.950000000000003 22.35 21.349999999999998 28.349999999999998 4 31.773526370217166 26.08583247156153 15.796277145811787 26.344364012409514 5 29.375 30.3 18.425 21.9 6 22.900000000000002 31.624999999999996 20.825 24.65 7 20.549999999999997 14.625 37.225 27.6 8 23.25 19.475 23.45 33.825 9 23.9 18.325 27.425 30.349999999999998 10-11 27.275 26.974999999999998 18.575 27.175 12-13 25.5125 20.674999999999997 25.5375 28.275 14-15 25.650000000000002 22.925 23.425 28.000000000000004 16-17 26.3 22.9375 22.7625 28.000000000000004 18-19 25.7875 23.1125 22.925 28.175 20-21 25.6125 23.25 22.75 28.3875 22-23 26.575 23.2875 22.650000000000002 27.487499999999997 24-25 26.3625 22.825 23.3375 27.474999999999998 26-27 26.85 22.325 23.1625 27.6625 28-29 26.787499999999998 22.6125 23.1375 27.462500000000002 30-31 26.387500000000003 23.7625 22.625 27.224999999999998 32-33 27.3375 24.0125 22.3125 26.337500000000002 34-35 26.7125 22.825 23.1375 27.325 36-37 26.525 23.025000000000002 22.7 27.750000000000004 38-39 27.1 23.4375 21.6 27.8625 40-41 27.5625 22.912499999999998 22.625 26.900000000000002 42-43 26.6625 23.0375 22.15 28.15 44-45 26.8125 23.6625 22.85 26.674999999999997 46-47 27.3875 21.7875 22.7375 28.0875 48-49 26.4625 22.75 23.1375 27.650000000000002 50-51 27.200000000000003 22.5125 22.0875 28.199999999999996 52-53 25.900000000000002 22.112499999999997 22.8875 29.099999999999998 54-55 26.6 22.6375 22.975 27.787499999999998 56-57 26.8625 23.075000000000003 23.4625 26.6 58-59 26.775 21.55 23.5 28.175 60-61 26.937499999999996 22.237499999999997 23.5 27.325 62-63 27.925 22.912499999999998 22.3 26.8625 64-65 27.150000000000002 22.6 23.3125 26.937499999999996 66-67 26.887499999999996 22.95 22.2125 27.950000000000003 68-69 28.125 22.675 22.125 27.075 70-71 26.974999999999998 23.2125 22.225 27.5875 72-73 27.6 22.9875 22.3 27.1125 74-75 27.437499999999996 22.6125 23.375 26.575 76-77 26.8125 22.75 22.55 27.8875 78-79 27.6125 22.037499999999998 23.474999999999998 26.875 80-81 27.500000000000004 23.2625 22.5 26.737499999999997 82-83 27.150000000000002 22.8375 22.662499999999998 27.35 84-85 27.1625 21.75 23.799999999999997 27.287499999999998 86-87 27.037499999999998 23.974999999999998 21.9375 27.05 88-89 28.462500000000002 21.85 22.35 27.3375 90-91 27.237499999999997 23.1 22.825 26.8375 92-93 27.03244394337968 23.449830890642616 22.084429412501567 27.433295753476138 94-95 28.275 22.4625 22.175 27.0875 96-97 26.6125 22.875 23.2625 27.250000000000004 98-99 28.000000000000004 23.200000000000003 21.325 27.474999999999998 100 28.050000000000004 22.95 21.475 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.5 28 2.5 29 3.5 30 4.0 31 4.0 32 5.0 33 7.5 34 13.5 35 24.5 36 32.5 37 30.0 38 45.0 39 69.5 40 89.0 41 103.5 42 110.0 43 119.0 44 126.0 45 145.5 46 147.5 47 127.0 48 131.0 49 132.0 50 114.5 51 109.5 52 114.5 53 99.0 54 87.5 55 93.0 56 90.5 57 94.5 58 101.5 59 115.5 60 125.5 61 131.5 62 121.5 63 107.5 64 109.5 65 98.5 66 96.0 67 104.0 68 97.5 69 85.0 70 72.5 71 70.0 72 68.0 73 54.0 74 44.0 75 33.5 76 22.0 77 16.5 78 15.5 79 14.5 80 8.0 81 2.5 82 2.5 83 1.5 84 1.0 85 1.5 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 3.3000000000000003 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.21250000000000002 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91276864728192 97.8 2 1.0366624525916561 2.0500000000000003 3 0.05056890012642225 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618218 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618218_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.498 34.0 31.0 34.0 31.0 34.0 2 32.71575 34.0 31.0 34.0 31.0 34.0 3 32.95825 34.0 31.0 34.0 31.0 34.0 4 36.4655 37.0 37.0 37.0 35.0 37.0 5 36.4935 37.0 37.0 37.0 35.0 37.0 6 36.53475 37.0 37.0 37.0 35.0 37.0 7 36.477 37.0 37.0 37.0 35.0 37.0 8 36.5115 37.0 37.0 37.0 35.0 37.0 9 38.3245 39.0 39.0 39.0 37.0 39.0 10-11 38.295874999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.347625 39.0 39.0 39.0 37.0 39.0 14-15 39.962374999999994 41.0 40.0 41.0 38.0 41.0 16-17 39.8755 41.0 40.0 41.0 38.0 41.0 18-19 39.908 41.0 40.0 41.0 38.0 41.0 20-21 39.827875000000006 41.0 40.0 41.0 38.0 41.0 22-23 39.735875 41.0 40.0 41.0 37.5 41.0 24-25 39.680499999999995 41.0 39.5 41.0 37.0 41.0 26-27 39.393125 41.0 39.0 41.0 36.0 41.0 28-29 39.362750000000005 40.5 39.0 41.0 36.0 41.0 30-31 39.15325 40.0 38.5 41.0 35.0 41.0 32-33 39.17125 40.0 38.5 41.0 35.0 41.0 34-35 39.04075 40.0 38.0 41.0 35.0 41.0 36-37 38.877125 40.0 38.0 41.0 35.0 41.0 38-39 38.683499999999995 40.0 38.0 41.0 35.0 41.0 40-41 38.39025 40.0 37.0 41.0 34.0 41.0 42-43 38.200125 40.0 36.5 41.0 34.0 41.0 44-45 37.807125 39.5 35.5 41.0 33.0 41.0 46-47 37.531125 39.0 35.0 41.0 33.0 41.0 48-49 37.464625 39.0 35.0 41.0 33.0 41.0 50-51 36.857749999999996 38.0 34.5 40.0 32.0 40.5 52-53 36.968625 38.0 35.0 40.0 33.0 41.0 54-55 37.115125 38.0 35.0 41.0 33.0 41.0 56-57 36.940875 37.0 35.0 41.0 33.0 41.0 58-59 36.72475 36.5 35.0 40.5 33.0 41.0 60-61 36.50325 36.0 35.0 40.0 33.0 41.0 62-63 36.209875 35.0 35.0 39.5 33.0 41.0 64-65 35.87925 35.0 35.0 39.0 32.0 41.0 66-67 35.632999999999996 35.0 35.0 39.0 32.0 41.0 68-69 35.377125 35.0 34.5 37.5 31.0 40.5 70-71 35.039125 35.0 34.0 37.0 31.0 39.5 72-73 34.8405 35.0 34.0 36.5 31.0 39.0 74-75 34.566374999999994 35.0 34.0 36.0 31.0 39.0 76-77 34.14125 35.0 34.0 35.5 30.0 37.5 78-79 33.865125000000006 35.0 33.5 35.0 30.0 37.0 80-81 33.764125 35.0 33.5 35.0 29.5 37.0 82-83 33.582875 35.0 33.0 35.0 29.5 36.0 84-85 33.323625 35.0 33.0 35.0 29.0 36.0 86-87 33.0565 35.0 33.0 35.0 29.0 35.5 88-89 32.86725 35.0 33.0 35.0 29.0 35.0 90-91 32.638374999999996 35.0 33.0 35.0 28.0 35.0 92-93 32.289125 35.0 33.0 35.0 27.0 35.0 94-95 32.02875 35.0 32.0 35.0 27.0 35.0 96-97 31.5235 34.0 31.5 35.0 25.0 35.0 98-99 30.93425 34.0 31.0 35.0 24.0 35.0 100 30.6105 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.4359233980849524 1101 2 -0.09136478411959814 1101 3 0.06535163379084707 1101 4 0.1505662641566019 1101 5 0.22006800170004226 1101 6 0.07956448911222225 1101 7 0.06725168129203496 1101 8 0.10267756693917818 1101 9 0.2792319807995227 1101 10-11 0.21544913622840767 1101 12-13 0.24991249781244562 1101 14-15 0.2652316307907725 1101 16-17 0.22674941873547283 1101 18-19 0.26943798594965074 1101 20-21 0.20595514887872213 1101 22-23 0.38314082852070896 1101 24-25 0.29082602065051333 1101 26-27 0.3142328558213947 1101 28-29 0.4808557713942889 1101 30-31 0.26765669141728665 1101 32-33 0.15737893447336404 1101 34-35 0.2919510487762196 1101 36-37 0.14612865321632995 1101 38-39 0.2312995324883076 1101 40-41 0.3015012875321901 1101 42-43 0.3321583039575984 1101 44-45 0.38851596289907775 1101 46-47 0.3550713767844158 1101 48-49 0.5033313332833345 1101 50-51 0.43096077401934707 1101 52-53 0.17257306432660613 1101 54-55 0.40429135728393106 1101 56-57 0.36716542913572425 1101 58-59 0.3357396434910882 1101 60-61 0.4316982924573125 1101 62-63 0.33785844646116203 1101 64-65 0.30497637440936387 1101 66-67 0.12185929648241256 1101 68-69 0.22205555138878452 1101 70-71 0.19853621340533323 1101 72-73 0.48296832420810176 1101 74-75 0.16102902572563949 1101 76-77 0.1938485962149059 1101 78-79 0.3534588364709066 1101 80-81 0.3535400885022142 1101 82-83 0.2747006175154354 1101 84-85 0.31513287832196113 1101 86-87 0.2613565339133501 1101 88-89 0.5898522463061582 1101 90-91 0.5289507237680979 1101 92-93 0.6300532513312831 1101 94-95 0.38671591789794846 1101 96-97 -0.03290707267681725 1101 98-99 0.04642616065401839 1101 100 -0.1525663141578555 1104 1 -0.43592339808495595 1104 2 0.09136478411960525 1104 3 -0.06535163379084707 1104 4 -0.150566264156609 1104 5 -0.22006800170004226 1104 6 -0.07956448911222935 1104 7 -0.06725168129202785 1104 8 -0.10267756693917107 1104 9 -0.2792319807995156 1104 10-11 -0.21544913622840767 1104 12-13 -0.24991249781244562 1104 14-15 -0.2652316307907725 1104 16-17 -0.22674941873547283 1104 18-19 -0.26943798594965074 1104 20-21 -0.20595514887872213 1104 22-23 -0.38314082852070896 1104 24-25 -0.29082602065052043 1104 26-27 -0.3142328558213947 1104 28-29 -0.4808557713942818 1104 30-31 -0.26765669141728665 1104 32-33 -0.15737893447335694 1104 34-35 -0.2919510487762196 1104 36-37 -0.14612865321632995 1104 38-39 -0.2312995324883076 1104 40-41 -0.3015012875321901 1104 42-43 -0.3321583039575984 1104 44-45 -0.38851596289907064 1104 46-47 -0.3550713767844158 1104 48-49 -0.5033313332833345 1104 50-51 -0.4309607740193542 1104 52-53 -0.17257306432660613 1104 54-55 -0.40429135728393106 1104 56-57 -0.36716542913573136 1104 58-59 -0.3357396434910882 1104 60-61 -0.4316982924573125 1104 62-63 -0.3378584464611549 1104 64-65 -0.30497637440936387 1104 66-67 -0.12185929648241256 1104 68-69 -0.22205555138878452 1104 70-71 -0.19853621340533323 1104 72-73 -0.48296832420810887 1104 74-75 -0.1610290257256466 1104 76-77 -0.19384859621491302 1104 78-79 -0.3534588364709066 1104 80-81 -0.3535400885022142 1104 82-83 -0.2747006175154354 1104 84-85 -0.315132878321954 1104 86-87 -0.261356533913343 1104 88-89 -0.5898522463061582 1104 90-91 -0.5289507237680944 1104 92-93 -0.6300532513312866 1104 94-95 -0.38671591789794846 1104 96-97 0.03290707267681725 1104 98-99 -0.046426160654014836 1104 100 0.15256631415785193 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 23.0 28 34.0 29 50.0 30 71.0 31 88.0 32 130.0 33 170.0 34 289.0 35 463.0 36 751.0 37 914.0 38 851.0 39 166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.54202315047811 10.291897332662305 12.707599396074484 47.458480120785104 2 27.35 16.950000000000003 29.95 25.75 3 28.125 22.15 21.925 27.800000000000004 4 30.25 27.224999999999998 15.299999999999999 27.224999999999998 5 30.65 29.299999999999997 18.224999999999998 21.825 6 24.025 31.2 18.65 26.125 7 20.845845845845844 13.93893893893894 38.36336336336336 26.851851851851855 8 21.67167167167167 18.81881881881882 24.924924924924923 34.58458458458458 9 23.849999999999998 18.525 26.900000000000002 30.725 10-11 27.890986373296663 25.403175396924617 18.752344043005376 27.953494186773348 12-13 25.1 19.9875 25.55 29.362500000000004 14-15 25.5 22.650000000000002 23.3875 28.462500000000002 16-17 26.650000000000002 22.1 22.6125 28.6375 18-19 26.5875 23.775 21.95 27.6875 20-21 26.150000000000002 22.912499999999998 23.0125 27.925 22-23 26.387500000000003 22.7625 22.95 27.900000000000002 24-25 27.0125 22.5125 23.0125 27.462500000000002 26-27 27.037499999999998 23.05 22.1375 27.775 28-29 26.900000000000002 22.55 23.025000000000002 27.525 30-31 26.187500000000004 23.0875 23.025000000000002 27.700000000000003 32-33 27.0125 22.675 22.95 27.3625 34-35 26.6625 22.875 22.425 28.037499999999998 36-37 26.150000000000002 22.8875 22.9875 27.975 38-39 26.8625 22.8 21.9625 28.375 40-41 26.987499999999997 23.150000000000002 22.075 27.787499999999998 42-43 27.8375 22.35 22.8125 27.0 44-45 26.950000000000003 22.3375 23.425 27.287499999999998 46-47 26.987499999999997 23.4625 22.4875 27.0625 48-49 25.95 23.724999999999998 22.725 27.6 50-51 26.825 22.35 22.8875 27.9375 52-53 27.1125 22.400000000000002 22.3625 28.125 54-55 27.1125 22.5625 22.8125 27.5125 56-57 26.900000000000002 23.05 23.175 26.875 58-59 27.175 22.3375 22.4375 28.050000000000004 60-61 26.2875 23.125 22.4625 28.125 62-63 27.375 22.825 22.5875 27.212500000000002 64-65 26.7625 22.1875 23.200000000000003 27.85 66-67 26.55 23.225 22.55 27.675 68-69 27.287499999999998 23.275000000000002 22.9375 26.5 70-71 27.0 22.6875 23.275000000000002 27.037499999999998 72-73 26.924999999999997 23.4625 22.1375 27.474999999999998 74-75 27.025 21.925 23.3625 27.6875 76-77 28.037499999999998 21.95 22.95 27.0625 78-79 27.500000000000004 22.25 22.525000000000002 27.725 80-81 27.1375 23.2125 22.475 27.175 82-83 27.075 22.325 22.2625 28.3375 84-85 27.212500000000002 22.8875 22.15 27.750000000000004 86-87 27.6 22.925 23.0625 26.4125 88-89 27.462500000000002 22.412499999999998 22.7125 27.4125 90-91 27.537499999999998 22.3 23.1625 27.0 92-93 27.450000000000003 22.9375 22.7125 26.900000000000002 94-95 27.187499999999996 23.025000000000002 22.3625 27.425 96-97 27.2625 23.425 22.45 26.8625 98-99 27.700000000000003 22.912499999999998 22.787499999999998 26.6 100 27.275 22.325 22.45 27.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.5 28 2.0 29 2.5 30 2.5 31 7.0 32 11.0 33 8.5 34 11.5 35 17.0 36 26.5 37 41.5 38 57.0 39 73.0 40 81.5 41 96.0 42 113.0 43 115.0 44 132.5 45 145.5 46 127.5 47 130.0 48 134.0 49 120.0 50 117.0 51 119.0 52 114.0 53 99.0 54 87.5 55 88.0 56 88.0 57 86.5 58 105.5 59 119.5 60 114.0 61 119.5 62 113.0 63 97.5 64 97.5 65 110.5 66 113.0 67 110.0 68 106.0 69 85.0 70 78.0 71 75.0 72 63.5 73 49.0 74 39.0 75 38.0 76 32.0 77 28.0 78 20.0 79 9.5 80 7.0 81 6.5 82 3.0 83 1.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.1 8 0.1 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0909090909091 98.1 2 0.8585858585858586 1.7000000000000002 3 0.025252525252525252 0.075 4 0.0 0.0 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0125 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0625 0.0 0.0 0.0 0.025 88 0.2 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554459 spots for SRR8618218.sra Written 554459 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra Read 554443 spots for SRR8618218.sra Written 554443 spots for SRR8618218.sra SRR ids: ['SRR8618218.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xch0ifuc SRR8618218.sra spots: 11088876 blocks: [[1, 554443], [554444, 1108886], [1108887, 1663329], [1663330, 2217772], [2217773, 2772215], [2772216, 3326658], [3326659, 3881101], [3881102, 4435544], [4435545, 4989987], [4989988, 5544430], [5544431, 6098873], [6098874, 6653316], [6653317, 7207759], [7207760, 7762202], [7762203, 8316645], [8316646, 8871088], [8871089, 9425531], [9425532, 9979974], [9979975, 10534417], [10534418, 11088876]] SRR8618218 file size 2885789 SRR8618218 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618218 SRR8618218_1.fastq SRR8618218_2.fastq Input file: SRR8618218_1.fastq Paired file: SRR8618218_2.fastq trimmed: SRR8618218-trimmed-pair1.fastq, SRR8618218-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:00:15 2024 >> started Sat Dec 7 07:00:27 2024 >> done (11.783s) 11088876 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11088876 (100.00%) read pairs available; of these: 1509298 (13.61%) trimmed read pairs available after processing 9579578 (86.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 77 1 0.00% 78 0 0.00% 79 0 0.00% 80 1 0.00% 81 7 0.00% 82 29 0.00% 83 97 0.00% 84 5844 0.05% 85 6293 0.06% 86 6846 0.06% 87 7754 0.07% 88 9380 0.08% 89 11864 0.11% 90 18852 0.17% 91 34912 0.31% 92 48645 0.44% 93 67723 0.61% 94 90387 0.82% 95 116995 1.06% 96 153781 1.39% 97 214257 1.93% 98 306504 2.76% 99 409126 3.69% 100 9579578 86.39% 11088876 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=28 prefix-density=0.40 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=31 fanout-score=9.87 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.3 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=29 fanout-score=8.56 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.9 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618218 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:01:07 Started mapping on | Dec 07 07:01:07 Finished on | Dec 07 07:01:44 Mapping speed, Million of reads per hour | 1078.92 Number of input reads | 11088876 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10834942 Uniquely mapped reads % | 97.71% Average mapped length | 198.32 Number of splices: Total | 6428575 Number of splices: Annotated (sjdb) | 6111418 Number of splices: GT/AG | 6341691 Number of splices: GC/AG | 72191 Number of splices: AT/AC | 1751 Number of splices: Non-canonical | 12942 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 100728 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 10233 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.90% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 153206 153206 153206 N_multimapping 100728 100728 100728 N_noFeature 266204 5432757 5467942 N_ambiguous 248770 23898 26076 UnstrandedReadsAssigned:10319968 PositiveStrandReadsAssigned:5378287 NegativeStrandReadsAssigned:5340924 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618218 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618218-trimmed-pair1.fastq SRR8618218-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,088,876 reads, 10,526,414 reads pseudoaligned [quant] estimated average fragment length: 165.608 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR8618218.ke.tsv 35125 SRR8618218.se.tsv 88098 total ==> SRR8618218.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.569 0 0 PNS24247 1044 879.392 15.4946 2.18249 PNS24249 1928 1763.39 74.4451 5.22926 PNS24246 1044 879.392 15.4946 2.18249 PNS24248 1044 879.392 15.4946 2.18249 PNS24244 1471 1306.39 12.071 1.14452 PNS24243 293 136.305 5 4.54373 KQK14069 1603 1438.39 5188.43 446.798 KQK14071 474 311.012 542.903 216.221 ==> SRR8618218.se.tsv <== BRADI_1g14170v3 6027 BRADI_1g53295v3 162 BRADI_1g59795v3 265 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 137 BRADI_1g74790v3 32 BRADI_1g09890v3 0 BRADI_1g77505v3 142 BRADI_1g48960v3 0 SRR8618218 completed mapping pipeline successfully